ID: 1103571344

View in Genome Browser
Species Human (GRCh38)
Location 12:121847036-121847058
Sequence GATCCAGGTGAGGCCGCCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 149}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103571344_1103571351 14 Left 1103571344 12:121847036-121847058 CCAGGGGCGGCCTCACCTGGATC 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1103571351 12:121847073-121847095 GCCAGGCGCTGGCTCATTGATGG 0: 1
1: 0
2: 0
3: 8
4: 150
1103571344_1103571350 3 Left 1103571344 12:121847036-121847058 CCAGGGGCGGCCTCACCTGGATC 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1103571350 12:121847062-121847084 GACTTCTTCTTGCCAGGCGCTGG 0: 1
1: 0
2: 1
3: 4
4: 108
1103571344_1103571354 26 Left 1103571344 12:121847036-121847058 CCAGGGGCGGCCTCACCTGGATC 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1103571354 12:121847085-121847107 CTCATTGATGGGCATCTTGATGG 0: 1
1: 0
2: 1
3: 24
4: 236
1103571344_1103571349 -3 Left 1103571344 12:121847036-121847058 CCAGGGGCGGCCTCACCTGGATC 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1103571349 12:121847056-121847078 ATCTGGGACTTCTTCTTGCCAGG 0: 1
1: 0
2: 1
3: 10
4: 174
1103571344_1103571353 15 Left 1103571344 12:121847036-121847058 CCAGGGGCGGCCTCACCTGGATC 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1103571353 12:121847074-121847096 CCAGGCGCTGGCTCATTGATGGG 0: 1
1: 0
2: 0
3: 7
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103571344 Original CRISPR GATCCAGGTGAGGCCGCCCC TGG (reversed) Exonic
900164590 1:1239678-1239700 GACCCAGCCGAGGCAGCCCCGGG + Intergenic
900793815 1:4695647-4695669 GTTCCTGCTGAGGCCGCTCCTGG + Intronic
900832169 1:4973176-4973198 GATCCAGGCAAGTCCGCCCTGGG + Intergenic
901318856 1:8327053-8327075 GATCCAGCTGAGGCCCCGCAGGG - Intronic
903767135 1:25742096-25742118 GAACCAGTTCAGGCTGCCCCTGG + Intronic
904263406 1:29304075-29304097 GAGCCAGGTGAGGCCTCTGCAGG - Intronic
904948471 1:34216509-34216531 GATCAAGGTGAGGCTGCACCTGG + Intronic
905199540 1:36306749-36306771 GGTGCAGGTGAGGCCGAGCCAGG + Exonic
913200754 1:116493844-116493866 TTTCCTGGTGAGGCCACCCCCGG - Intergenic
913323579 1:117606987-117607009 GATACCGGTGCGGCTGCCCCGGG + Intronic
914490216 1:148146915-148146937 GCACCAGGTGAGGGCGACCCTGG + Intronic
914755628 1:150560166-150560188 GATCCTGGGGAGACCGCTCCAGG - Exonic
915286919 1:154859020-154859042 GATGCAGGGGAGGCCTCCTCAGG - Intronic
922088113 1:222370206-222370228 CATCCAGATGAGGCAGACCCAGG - Intergenic
923651322 1:235876873-235876895 GGTCCTGGTGGGGCAGCCCCAGG + Intronic
1062886362 10:1019561-1019583 CATCCAGGTGAGGCCACCACCGG + Exonic
1063949861 10:11212324-11212346 GCTCCCTGTGAGGCCCCCCCGGG + Intronic
1066010749 10:31191688-31191710 GCTCCAGGGGAGACAGCCCCAGG - Intergenic
1066088951 10:31998961-31998983 TATCCAGGTGAAGCCTCCACAGG - Intergenic
1069994909 10:72336166-72336188 CATCCTGGTCAGGCCTCCCCAGG + Intronic
1076579399 10:131496549-131496571 GTTCCAGGGGAGGGAGCCCCTGG - Intergenic
1076727807 10:132421555-132421577 GCTCCAGCTGAGGCTGTCCCAGG + Intergenic
1077021199 11:417824-417846 GAACCAGGTGAGGCCGCCTCAGG - Intergenic
1078176333 11:8974109-8974131 GATCCAGCTGTGGATGCCCCCGG - Intergenic
1081657828 11:44868915-44868937 GAGCCAGGTGATGCTGGCCCTGG + Intronic
1083823142 11:65183586-65183608 TTTCCAGGTGAGGGCTCCCCTGG + Exonic
1083924538 11:65797976-65797998 GACACAGGTGTGGCCGTCCCTGG - Intergenic
1084544429 11:69807622-69807644 GAGTCAGGAAAGGCCGCCCCAGG - Intergenic
1084586388 11:70065222-70065244 GAGCCGGGTGGGGCTGCCCCAGG + Intergenic
1084604555 11:70164963-70164985 GATCGAGTTGCGGCAGCCCCAGG - Intronic
1084758263 11:71252409-71252431 GAGCCAGGTGAGGCGGCGGCCGG - Intronic
1089289030 11:117426730-117426752 GGCCCCGGTGAGGCCGCACCTGG - Intergenic
1090393715 11:126405884-126405906 GATCCAGGTGAGCCCTGCCACGG - Exonic
1093583174 12:20807328-20807350 GCCCCAGGTGAGGCAGCCTCTGG - Intergenic
1096403223 12:51324213-51324235 GAGCCACCTCAGGCCGCCCCTGG + Intronic
1101854414 12:108430162-108430184 GGTGCAGGTGAGGCTGGCCCAGG - Intergenic
1102681236 12:114692149-114692171 GATCTAGGTGAAGCCCCCCGGGG - Intergenic
1103571344 12:121847036-121847058 GATCCAGGTGAGGCCGCCCCTGG - Exonic
1119147648 14:72331535-72331557 GCCCCAGGTGAGGCAGCTCCCGG - Intronic
1120951478 14:90045915-90045937 TTTCCAGGTGGGGCCCCCCCAGG - Intergenic
1121319969 14:92986598-92986620 GGTCCAGGTGGGCCTGCCCCAGG - Intronic
1121451143 14:94008993-94009015 GATCCAGGTAAGGCCTGCCTGGG + Intergenic
1122079016 14:99254131-99254153 GATCCAGGTGGGGACACCCAGGG + Intronic
1122961536 14:105096174-105096196 GGCCCAGGGGAGGCCTCCCCTGG - Intergenic
1124291759 15:28457596-28457618 GCACCAGGTGAGGGCGACCCCGG - Intergenic
1132336307 15:101050618-101050640 CATGCAGGTGAGGCCGGCCCAGG - Intronic
1132586772 16:709011-709033 TTTCCAGGTGAGGGTGCCCCGGG - Intronic
1132662103 16:1066164-1066186 GTTGCAGGTGAGGCCACCTCAGG + Intergenic
1133279026 16:4654817-4654839 CCACCAGGTGAGGCCGCCCTTGG + Intronic
1136239110 16:28933297-28933319 GGTCCAGGAGAGGGGGCCCCTGG - Exonic
1136707021 16:32200067-32200089 GCACCAGGTGAGGGCGACCCCGG + Intergenic
1136760889 16:32729350-32729372 GCACCAGGTGAGGGCGACCCCGG - Intergenic
1136807214 16:33141036-33141058 GCACCAGGTGAGGGCGACCCCGG + Intergenic
1137943945 16:52716228-52716250 GATCCAGGGGACGACGCCCTTGG - Intergenic
1139922485 16:70468899-70468921 CACCCACGTGAGCCCGCCCCTGG + Exonic
1140124354 16:72107542-72107564 AACACAGGTGAGGCGGCCCCGGG + Exonic
1140469034 16:75204589-75204611 CATGCAGCTGAGGCTGCCCCTGG - Intronic
1140524211 16:75608814-75608836 GATCCAGGTTAGACCTGCCCTGG - Intronic
1142041689 16:87898269-87898291 GCTGCAGGTGAGCCCGTCCCTGG + Intronic
1142283741 16:89162521-89162543 CCTCCAGGTGCGGCTGCCCCGGG + Intergenic
1142304445 16:89277758-89277780 GATCCAGGAGCGGGCGCCCTCGG - Intronic
1203063041 16_KI270728v1_random:989664-989686 GCACCAGGTGAGGGCGACCCCGG - Intergenic
1142768787 17:2081794-2081816 GATCCAGGTGAAGTCGGCCTGGG - Exonic
1145190808 17:20841518-20841540 GCACCAGGTGAGGGCGACCCTGG + Intronic
1147155911 17:38544421-38544443 GATGCAGGTGAGGTCTCCCTAGG + Intronic
1148127696 17:45245422-45245444 CCTCCAGGTGAGGCCAGCCCTGG - Intronic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1150128351 17:62653014-62653036 GGTCAAGGTGTGCCCGCCCCCGG + Intronic
1150493837 17:65592558-65592580 GACCCAGGGGAGGCCCCCTCTGG + Intronic
1151063170 17:71120250-71120272 GAGCCAGGTGAGGCTGCTCCTGG + Intergenic
1152695480 17:81741754-81741776 GACCCGGGTGTGGCCGCGCCTGG - Intergenic
1152748099 17:82050443-82050465 GGTCCAGGCTGGGCCGCCCCAGG + Exonic
1152757876 17:82094472-82094494 GATCCAGGTGCTCCCTCCCCGGG - Intronic
1153314784 18:3711079-3711101 GAGCCAGGAGGGGCCGCCCTGGG + Intronic
1156313915 18:35950151-35950173 GGACCAGGTGAGCCCGCGCCCGG - Intergenic
1156313934 18:35950216-35950238 GGACCAGGTGAGGCTGCGCCCGG - Intergenic
1159210779 18:65318669-65318691 CATCCAGGAGAGTCTGCCCCAGG - Intergenic
1159921566 18:74231590-74231612 GAGCCAGGTGAAGCCACCTCTGG + Intergenic
1160159719 18:76461876-76461898 CATCCAGGTGAGGCTGCCCAGGG - Intronic
1160168209 18:76531771-76531793 GACTCAGGTGCGGCCGCACCTGG + Intergenic
1160995396 19:1879905-1879927 GCACCAGGTGAGGGCGACCCTGG - Exonic
1163534480 19:17869293-17869315 GATCCAGGTGGACCCACCCCAGG - Intergenic
1163714433 19:18865772-18865794 GTCCCAGGTGAGCCCGCCCCTGG + Exonic
1163726155 19:18924302-18924324 GAAGCAGGTGAGGCCACCCTGGG + Exonic
1165081640 19:33310299-33310321 GGTCCAGGTGAGAAAGCCCCGGG - Intergenic
1165083919 19:33329420-33329442 GAGACAAGTGAGGCTGCCCCTGG - Intergenic
1166011265 19:39944513-39944535 GGACCAGGTGAGGCAGGCCCTGG - Intergenic
1166302755 19:41921704-41921726 GATGCAGGCGAGCCCGGCCCTGG + Intronic
1168694658 19:58397466-58397488 GATCCGTGTGGGGCTGCCCCTGG - Intergenic
925099942 2:1235704-1235726 GATCCAGGAAAAGCTGCCCCTGG + Intronic
927713594 2:25340228-25340250 GAGCCGGGGGAGGCAGCCCCTGG + Intronic
932892288 2:75607592-75607614 CCTCCAGGTGTGGCAGCCCCAGG + Intergenic
933559276 2:83872071-83872093 GATCCAGGAGTGGCCAACCCAGG + Intergenic
935011674 2:99141662-99141684 CATCCAGGTGCGGCAGCCTCAGG - Exonic
937588404 2:123584672-123584694 GGTCCAGGTCAGGCCCACCCAGG - Intergenic
938103246 2:128512503-128512525 GATGGTGGTGAGGCCGGCCCTGG + Intergenic
944329424 2:198447786-198447808 GAAGCAGGAGAAGCCGCCCCTGG - Intronic
946843259 2:223837823-223837845 GCTCCAGGTGCGGCCGGCTCGGG - Intronic
947448820 2:230186125-230186147 TGCCCAGGTGAGGCTGCCCCTGG + Exonic
948189427 2:236046400-236046422 GATGCTGGTGAGGACGCCCATGG + Intronic
949063346 2:241974252-241974274 GTTCCAGGTGACGCTGCCCTGGG + Intergenic
1169065618 20:2692944-2692966 GCTCCAGGTGCTGCCGCCCGGGG + Exonic
1173548343 20:43915622-43915644 GACCGAGGTGTGGCCGTCCCTGG - Intronic
1175549720 20:59809200-59809222 TAAGCAGGTGAGGCCGGCCCGGG + Intronic
1176078754 20:63261212-63261234 GCTGCAGATGAGGCTGCCCCAGG + Intronic
1176140796 20:63544201-63544223 GAGGCAGGAGGGGCCGCCCCAGG + Intronic
1176286184 21:5020687-5020709 GATTCAGGTGCGCCCGGCCCTGG + Intergenic
1179189064 21:39107987-39108009 GATGAAGGTGGGGCCGCCCACGG + Intergenic
1179584197 21:42364705-42364727 GGCTCAGGTGAGGGCGCCCCAGG + Intronic
1179870997 21:44242788-44242810 GATTCAGGTGCGCCCGGCCCTGG - Intergenic
1181121469 22:20670445-20670467 GCACCAGGTGAGGGCGACCCTGG - Intergenic
1181334428 22:22117469-22117491 GCACCAGGTGAGGGCGACCCTGG - Intergenic
1181855716 22:25780192-25780214 GCTCCAGGTGAGGCCTCTCGGGG + Exonic
1183708174 22:39487716-39487738 GATGCTGGAGAGGCCGCCCCCGG + Exonic
1184262164 22:43324652-43324674 TATCCAGGAGTCGCCGCCCCTGG + Intronic
1184459394 22:44628489-44628511 ACTCCAGGTGAGGCCCTCCCAGG + Intergenic
1184729493 22:46364964-46364986 GGTCCAGGTGAGGCTGCCAGTGG - Intronic
950184234 3:10935193-10935215 GCCCGAGGTGAGACCGCCCCAGG + Exonic
961200701 3:125043249-125043271 GCTCCAGGCCAGGCCTCCCCTGG - Intronic
972607879 4:40630447-40630469 GCCCCAGGTAAGGACGCCCCGGG - Intronic
973588889 4:52420470-52420492 GTTCCAGGTGAGGACCCTCCAGG + Intergenic
985054452 4:186024185-186024207 CGTCCAGGTGAGGCCGAACCAGG + Intergenic
988826702 5:34943363-34943385 GATTCAGGTTATGCAGCCCCAGG + Intronic
999322750 5:150625213-150625235 GATCAGGGCGAGGCAGCCCCAGG + Intronic
1002535998 5:179875887-179875909 GACCCAGGCGAGGCAGCACCCGG + Intronic
1003872467 6:10413415-10413437 GCTCCAGGTGTGGGCGCCCTCGG - Intronic
1007377767 6:41468290-41468312 GCTCCAAGTAAGGCCGCTCCAGG + Intergenic
1017914376 6:158819679-158819701 GGGCCAGGTGCAGCCGCCCCAGG - Intergenic
1019523602 7:1471117-1471139 GCCCCAGGTGAGGCCACCGCCGG - Exonic
1020688329 7:11323422-11323444 GTTCCAGGTGACGCTGCACCTGG - Intergenic
1020688943 7:11330609-11330631 GTTCCAGGTGACGCTGCACCTGG - Intergenic
1026708699 7:72717528-72717550 GATCCAGGAGTGGCCAACCCGGG - Intronic
1026930414 7:74220353-74220375 GGGCCAGGCGAGGCCTCCCCAGG + Intronic
1030903841 7:115158159-115158181 CACCCAGGTGAAGCCGCCTCAGG + Intergenic
1035070974 7:156144556-156144578 GATCCAGATGAGAAAGCCCCCGG - Intergenic
1035283511 7:157792359-157792381 GACCCAGGAGAGGTGGCCCCGGG - Intronic
1035310055 7:157961897-157961919 GGTCCCGGTGCGGCCGCCGCCGG - Intronic
1039502912 8:38031073-38031095 GATCCAGGAGAGGCCTGGCCTGG + Intronic
1039843631 8:41310315-41310337 TCTCCAGGTGGGGCCGCCCATGG + Intergenic
1044533843 8:93337745-93337767 GAGCCAGGTGGGGCTGCCTCTGG - Intergenic
1049378769 8:142301740-142301762 GCTCCTGGTGAGGCCGGTCCTGG - Intronic
1056712345 9:89001148-89001170 AATCCACGAGAGGGCGCCCCAGG - Exonic
1056720143 9:89064366-89064388 GAGCCTGGTGAGGCAGCCACGGG + Intronic
1057315782 9:93967382-93967404 TGTGCAGGTGAGGCCGACCCAGG + Intergenic
1061857437 9:133449906-133449928 GTTCCGGGCGAGGCAGCCCCTGG - Exonic
1062091295 9:134679942-134679964 GATCCAAGTCAGTCCACCCCGGG + Intronic
1062370568 9:136236727-136236749 GCTCCAGGTGACGCAGACCCAGG - Intronic
1062370584 9:136236781-136236803 GCTCCAGGTGTCGCCGGCCCAGG - Intronic
1062370638 9:136236981-136237003 GCTCCAGGTGACGCCGGCCCAGG - Intronic
1062370647 9:136237008-136237030 GCTCCAGGTGACACCGGCCCAGG - Intronic
1062370677 9:136237127-136237149 GCTCCAGGTGACGCCGGCCCAGG - Intronic
1062370711 9:136237254-136237276 GCTCCAGGTGACGCCAGCCCAGG - Intronic
1062370744 9:136237381-136237403 GCTCCAGGTGACGCCAGCCCAGG - Intronic
1062370750 9:136237408-136237430 GCTCCAGGTGATGCAGGCCCAGG - Intronic
1062370791 9:136237562-136237584 GCTCCAGGTGACGCCGCCACAGG - Intronic
1062370804 9:136237612-136237634 GCTCCAGGTGACGCTGGCCCAGG - Intronic
1062461789 9:136665467-136665489 GAGCCAGGAGAGGCCGCCCAGGG - Intronic
1062496266 9:136833165-136833187 GACCCAGGTGGGGCAGCCCAGGG - Intronic
1062496313 9:136833296-136833318 GATCCAGCTGGGGCAGCCCAGGG - Intronic
1062587440 9:137255605-137255627 GTTCCAGGTGGGGCGGCCCCCGG + Exonic
1187055793 X:15740518-15740540 GATCCAGGTGAGGAGGTTCCAGG - Intronic
1189333678 X:40157357-40157379 GCTCCAGTTTAGGCAGCCCCCGG - Intronic
1197853405 X:130889144-130889166 GCCCCAGGTGTGGCCACCCCAGG - Intronic