ID: 1103573081

View in Genome Browser
Species Human (GRCh38)
Location 12:121857679-121857701
Sequence GACAAGGGCAGGCCTCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103573081_1103573091 25 Left 1103573081 12:121857679-121857701 CCTGCTGGAGGCCTGCCCTTGTC 0: 1
1: 0
2: 1
3: 27
4: 217
Right 1103573091 12:121857727-121857749 CTCACTCCAGCACCTTGCCCCGG 0: 1
1: 0
2: 2
3: 29
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103573081 Original CRISPR GACAAGGGCAGGCCTCCAGC AGG (reversed) Intronic
901129070 1:6950876-6950898 GTCATGGGCTGGCCACCAGCAGG + Intronic
901703452 1:11057667-11057689 GGTCAGGGCAGGCCTCCAGGAGG - Intronic
902960220 1:19958036-19958058 CACAAGGGCAGGCCTTGGGCAGG - Intergenic
903543373 1:24108937-24108959 GACAAGGGCTGGGCTGCAGCTGG - Intronic
903677099 1:25071289-25071311 CCCAAGGGCAGGCCTGGAGCTGG + Intergenic
903685751 1:25130744-25130766 GACCAGGGCAGGGGTCCAGTGGG - Intergenic
903888897 1:26556852-26556874 GACAAGGGCTGGCCTCCTGAGGG + Intronic
905381143 1:37562391-37562413 GAGAAGGGGAGGGCTCCAGAGGG + Intronic
905928282 1:41767536-41767558 GACAAAGGCAGGGCTGCAGAAGG - Intronic
908710079 1:67005230-67005252 GCCCAGGTCAGGCATCCAGCTGG - Intronic
912491026 1:110062949-110062971 GCCCAGGGGAGGCCTACAGCGGG - Intronic
913240365 1:116825040-116825062 GAGAAGCACAGGCCTCCAACCGG + Intergenic
914997691 1:152559251-152559273 GACAAGCCCAGGCTTCCATCAGG - Intronic
915049163 1:153049479-153049501 GACAAGTGGAGAACTCCAGCGGG + Intergenic
917973978 1:180227100-180227122 GAAAAGGGCAGGACCCCAGCAGG + Intergenic
920437960 1:205960438-205960460 GAGACTGGCAGGCCACCAGCTGG + Intergenic
1063382059 10:5591679-5591701 CCCAAGGGCTGGCCTCCTGCAGG + Intergenic
1064600278 10:16985946-16985968 GCCTAGGCCAGGCCTCCAGGAGG + Intronic
1064686368 10:17866500-17866522 GAGCACGGCAGGCCTTCAGCAGG + Intronic
1067368824 10:45662782-45662804 GACTAGGGTTGCCCTCCAGCTGG - Intronic
1067727094 10:48778631-48778653 GAGAAGGTCAGACCTCCAGGAGG - Exonic
1067740951 10:48895866-48895888 AACAGAGGCATGCCTCCAGCAGG - Intronic
1067781637 10:49211899-49211921 GACAAGGCCAGGATTCCAGCTGG - Intergenic
1069579012 10:69552442-69552464 CACAAGGTCAGGCTACCAGCTGG + Intergenic
1069797687 10:71063681-71063703 CACAGGGGCCGGCCTCCAGGAGG + Intergenic
1070628536 10:78068107-78068129 AACAAGGGCAGGCTTCAAACAGG + Intergenic
1072557379 10:96531191-96531213 GACAAGAGAAGGCATCCAGGTGG - Intronic
1072570569 10:96654520-96654542 GACAAGGCTGGGCCTGCAGCAGG - Intronic
1072610514 10:97014473-97014495 GATAAGGGCAGGCTTCCTGGAGG + Intronic
1073288855 10:102403494-102403516 GACCAGGGAGGGCCGCCAGCAGG + Intronic
1073344207 10:102769990-102770012 GACAAAGGCAGGCATGTAGCAGG - Intronic
1073469943 10:103716212-103716234 GGCTGGGGCAGGCCTCCCGCAGG + Intronic
1073624856 10:105086449-105086471 GACGAGGGAAGGCTTCCAGGAGG + Intronic
1075271332 10:121054356-121054378 CTCAAGGGCAGGTTTCCAGCAGG - Intergenic
1075575276 10:123573095-123573117 GACCAAGGAAGGCCTGCAGCGGG + Intergenic
1075580435 10:123613683-123613705 GGCTAGAACAGGCCTCCAGCAGG + Intergenic
1076133798 10:128030890-128030912 GACAGGGGCAGGCACCCTGCAGG + Intronic
1076531630 10:131149038-131149060 GTCAAGGGCAGGGCTGGAGCTGG - Intronic
1076994940 11:293275-293297 CACCGGGGCAGGTCTCCAGCTGG - Intronic
1077693798 11:4375071-4375093 GACAGGGGCATGGCTCCAGTTGG + Intergenic
1079934220 11:26597416-26597438 AACAACGGCAAGCCTCTAGCTGG + Intronic
1083713901 11:64564965-64564987 GATAAGGGAAGGCTTCCAGAAGG + Intronic
1083806493 11:65077390-65077412 GGTAAGGCCAGGCCTCCAGTGGG - Intronic
1084887952 11:72223235-72223257 TAAAGGCGCAGGCCTCCAGCCGG - Intergenic
1084959280 11:72707790-72707812 GACAGGGACAGGCCTGCATCAGG + Intronic
1085958366 11:81428978-81429000 GACCAGGGAAGGCCTCTGGCGGG - Intergenic
1087951924 11:104231471-104231493 AACAAGGGCAGGTATGCAGCAGG + Intergenic
1089127242 11:116185204-116185226 AATAAGCTCAGGCCTCCAGCAGG - Intergenic
1089518124 11:119046561-119046583 GAGAAGGTCATCCCTCCAGCAGG - Exonic
1089558731 11:119332396-119332418 CACCAGAGCAGGCCTCCAGAGGG + Intergenic
1090126976 11:124096591-124096613 GAGATGGGCAGTTCTCCAGCGGG + Intergenic
1091311102 11:134575914-134575936 GCCATGGGCAGGCTCCCAGCTGG - Intergenic
1091659423 12:2372454-2372476 GACACAGGCAGATCTCCAGCAGG + Intronic
1092107237 12:5930538-5930560 TACCAGGGCATGCCTTCAGCAGG - Intronic
1092947352 12:13469092-13469114 GACAGATGCAGCCCTCCAGCTGG + Intergenic
1093027162 12:14255414-14255436 GACAAGGGCAGGCTTCAAACAGG - Intergenic
1094219058 12:27974206-27974228 GCCAAGGGCAGGCATCTGGCTGG - Intergenic
1094765063 12:33584923-33584945 GACAAGGGCAGCACTACAGAGGG - Intergenic
1101118704 12:101556494-101556516 GACAAGGGTAGGGCACCAACAGG + Intergenic
1101724177 12:107375673-107375695 GCCCAGGTCTGGCCTCCAGCAGG - Intronic
1102045219 12:109825661-109825683 GACAAGGGCTGCCTCCCAGCTGG + Intronic
1102491081 12:113289945-113289967 GCCAAGGGCATTCCTTCAGCAGG + Intronic
1103573081 12:121857679-121857701 GACAAGGGCAGGCCTCCAGCAGG - Intronic
1105359013 13:19689226-19689248 GGAAAAGGCAGGCCTCCAGAGGG + Intronic
1105673040 13:22642119-22642141 TCCAGGGGCAGGCCCCCAGCTGG + Intergenic
1108947051 13:56040191-56040213 AACAACTGCAAGCCTCCAGCCGG + Intergenic
1115961742 14:38841777-38841799 GTCAAGGACAGGCTTCCAGTGGG - Intergenic
1118772612 14:68952247-68952269 GCCCAGGGCTGGCCTCCAGCAGG - Intronic
1119193078 14:72697450-72697472 GACATGAGCAGGACTTCAGCAGG + Intronic
1119432576 14:74578107-74578129 GGCCAGGGCAGGCCTTCAGGTGG + Intronic
1120057951 14:79947609-79947631 TAAAGGGGCTGGCCTCCAGCTGG - Intergenic
1121335585 14:93075898-93075920 GACATGGCCAGGCCACCATCAGG + Intronic
1121840784 14:97132092-97132114 GACGAGGGCAAGACCCCAGCTGG - Intergenic
1122075668 14:99233137-99233159 GGCTAGGGCAGGCTTCCAGGAGG - Intronic
1122671785 14:103378397-103378419 GGAAAGGGCAGCCCTCCAGGAGG + Intergenic
1122809786 14:104282232-104282254 GCCAAGGCCAGGCCTCCTGGGGG + Intergenic
1124372128 15:29109976-29109998 GACCAGGCCAGACCACCAGCTGG - Intronic
1127358464 15:58224366-58224388 GTCAGGGACAGGCCTCTAGCTGG - Intronic
1127847791 15:62886604-62886626 GACAATGGCAGGGCTGCAGGGGG + Intergenic
1128083132 15:64868038-64868060 GAGAAGGGCAGCCCTGGAGCTGG - Intronic
1128449928 15:67799644-67799666 AACAACTGCAGGCCTCCTGCAGG + Intronic
1128663773 15:69523562-69523584 GAGAAAGGCAGGCCTGCAGGGGG + Intergenic
1129334734 15:74845175-74845197 GACAGGGGCCAGCTTCCAGCAGG - Exonic
1131131531 15:89903664-89903686 GGCAAGGGCTGGCCTCCATGGGG - Intronic
1132809871 16:1792386-1792408 GCCAGGGCCAGGCCTCCTGCGGG + Exonic
1133022043 16:2971024-2971046 GCCAAGGCCAGGCCGCCAACTGG + Intronic
1133176753 16:4021296-4021318 GACAAGGCCACGCCGGCAGCAGG + Intronic
1133998558 16:10765563-10765585 GGCAAGGGCAGGCCTGTGGCTGG - Intronic
1134121520 16:11587371-11587393 GAGAAGGGCCGCCCTCCAGAGGG - Exonic
1134826482 16:17288515-17288537 GCCAAGGGCAAGCATACAGCAGG - Intronic
1135530092 16:23245662-23245684 GACCAGCCCAGGCCTCAAGCAGG + Intergenic
1136718334 16:32302027-32302049 GACAAAGCCAGGCCCACAGCAGG + Intergenic
1136836708 16:33508297-33508319 GACAAAGCCAGGCCCACAGCAGG + Intergenic
1137275213 16:46929011-46929033 GCCAAGGACAGGTCTCCCGCTGG - Exonic
1138127632 16:54452068-54452090 GCCTAGGGCAGGGCTCCAACGGG - Intergenic
1140677149 16:77343601-77343623 AACAAAGGCAGGCCTCAAGCTGG + Intronic
1141669025 16:85481889-85481911 GTGCAGGGCAGCCCTCCAGCCGG + Intergenic
1141684449 16:85562313-85562335 GAAAAGGGCTGGGCTGCAGCTGG - Intergenic
1141725378 16:85784719-85784741 TACATGGGCAGGCCTCCTGAGGG - Intronic
1142161339 16:88559143-88559165 GTCAAGGGCTGGCCTCTTGCTGG - Intergenic
1142268294 16:89075511-89075533 GCAAAAGACAGGCCTCCAGCCGG + Intergenic
1142376551 16:89709701-89709723 GAGCAGGGCAGGCCTCCTGGGGG + Intronic
1203008094 16_KI270728v1_random:215738-215760 GACAAAGCCAGGCCCACAGCAGG - Intergenic
1203146894 16_KI270728v1_random:1808598-1808620 GACAAAGCCAGGCCCACAGCAGG + Intergenic
1143295320 17:5867154-5867176 GAGCTGGGCTGGCCTCCAGCGGG + Intronic
1144090494 17:11851724-11851746 GGCAAGGGCAGGCATGGAGCTGG - Intronic
1144386148 17:14751024-14751046 CAGAAGGGCAGGGCTCCCGCTGG - Intergenic
1146352118 17:32103680-32103702 GAGAGGGGCAGGCAGCCAGCGGG + Intergenic
1146630367 17:34465216-34465238 GACAGAGCCAGGCCTCGAGCAGG + Intergenic
1146913225 17:36661288-36661310 GACAACCTCAGCCCTCCAGCCGG - Intergenic
1147429165 17:40361311-40361333 GACAGGGGCAGGGCTTCAGAAGG + Intronic
1147615242 17:41823472-41823494 AAAGAGGGGAGGCCTCCAGCAGG + Intergenic
1148674759 17:49438815-49438837 GACCAGGGCAGGCTTCCTGGAGG + Intronic
1153463842 18:5366945-5366967 TACAAAGGCAGGCCTCAAGTAGG - Intergenic
1153474331 18:5481523-5481545 GGCAAGGGCAGGTCTCCTGCAGG - Intronic
1154339668 18:13492621-13492643 GACTGGGGCGGCCCTCCAGCAGG + Intronic
1161566617 19:5006152-5006174 GAAGAGGGCAGGCCTGCAGCAGG - Intronic
1162449704 19:10747475-10747497 GCCAAGGGCGGGCCTCGAGCCGG + Intronic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1162824836 19:13245002-13245024 GACAAGGGCAGCCCCTCAGGAGG - Intronic
1164553512 19:29232430-29232452 CACAAGGGCAGGGCTGCACCTGG + Intergenic
1165026840 19:32968574-32968596 CCCAAGGGCTGGCGTCCAGCAGG + Intronic
1165813388 19:38626069-38626091 GGAAATGGCAGGTCTCCAGCAGG - Exonic
1166303015 19:41922709-41922731 CACAAGGGCCGGGGTCCAGCCGG + Intronic
1166696171 19:44852646-44852668 GACAACTGCAGTCCTCCAGGTGG + Intronic
925184151 2:1835837-1835859 GCCCATGGCAGGGCTCCAGCAGG + Intronic
925639003 2:5969465-5969487 GGCCAGGGCAGGCTGCCAGCTGG + Intergenic
927721833 2:25388019-25388041 GAGACGGGCTGGTCTCCAGCGGG - Intronic
927869108 2:26612609-26612631 GAAAAGGGAAGGCTCCCAGCAGG - Intronic
928332524 2:30368585-30368607 CACAAGCCCAGGCCTCCAGCAGG - Intergenic
929970406 2:46569496-46569518 GACAAGGCCAGTCCTCTAGCTGG + Intronic
932197062 2:69794131-69794153 GGCAAGGGCAGGTTTTCAGCTGG + Intronic
934659987 2:96138200-96138222 GCCAAGGGGAGGCCTCCTGAAGG - Intronic
936095173 2:109525798-109525820 ATCCAGGACAGGCCTCCAGCAGG - Intergenic
936636066 2:114260128-114260150 GAGAAGGGCAGCCATGCAGCTGG - Intergenic
937363775 2:121246394-121246416 TCCGAGGCCAGGCCTCCAGCAGG + Intronic
937759351 2:125581710-125581732 GACAACGGCAGCACTACAGCTGG + Intergenic
938383115 2:130847773-130847795 GAGAAGGTGAGGCCTCCACCTGG + Intronic
947551052 2:231047122-231047144 GAGTGTGGCAGGCCTCCAGCAGG - Exonic
948439651 2:237978543-237978565 GCCATGGGGAGGCCTCCAGATGG + Intronic
948850558 2:240703457-240703479 GGCAGGGGCTGGCCTCCAGGAGG + Intergenic
1168949561 20:1787318-1787340 GTCAAGGGAAGGCCTCCTGGGGG - Intergenic
1169193148 20:3670253-3670275 GACAGGGGCAGGGCACCACCTGG - Intronic
1171255319 20:23685788-23685810 CACATGGGGAGGCCTCCCGCAGG + Exonic
1171262659 20:23747710-23747732 CACATGGGGAGGCCTCCCGCAGG + Exonic
1172192063 20:33068102-33068124 AACAAGGGCATACCTGCAGCTGG + Intronic
1172768012 20:37361404-37361426 GCCAGGGGCAGGCCACCTGCAGG + Intronic
1173438405 20:43053615-43053637 GACAAAGGCAGGAATCCAGGCGG - Intronic
1174393409 20:50232034-50232056 GGCAGGGGCCGGCCTCCAGGAGG - Intergenic
1174402870 20:50285350-50285372 GACAAGGTCAGCCATCCTGCAGG + Intergenic
1175798732 20:61788626-61788648 AACATGGTCAGGCCTCCTGCAGG - Intronic
1175816642 20:61886517-61886539 GACAGGAGCATGCATCCAGCAGG + Intronic
1179130319 21:38630473-38630495 GACAAGGGCACTCCTCTACCTGG + Intronic
1179144031 21:38751975-38751997 GACCAGGTCAGGTCTCCATCAGG - Intergenic
1181165452 22:20980637-20980659 GACAGGGGCAGGCTTCAGGCTGG + Intronic
1182712700 22:32332521-32332543 GATAAGGACAGGCCCTCAGCTGG - Intergenic
1182782273 22:32877641-32877663 GACAAGAGGAGCCCTGCAGCAGG - Intronic
1183616431 22:38948620-38948642 GACCAGGGCTGGCCAGCAGCGGG - Intergenic
1184399943 22:44267903-44267925 GATAAGGACAGGCCCTCAGCTGG - Intronic
1184473223 22:44707457-44707479 GCCAAGGGCATGCCGGCAGCTGG - Intronic
1185006115 22:48277946-48277968 GACAAGGCCAGGCTACCAGCCGG - Intergenic
950411904 3:12844082-12844104 GACACAGGCAGGTCTGCAGCAGG - Intronic
950453611 3:13079492-13079514 GACCAGGGCATGACTCAAGCAGG + Intergenic
950590800 3:13934785-13934807 GACAATGGCAGGCCTTGGGCTGG + Intergenic
951359933 3:21713266-21713288 GACAAGTGCAGGTCTGCAGATGG - Intronic
951606368 3:24439212-24439234 GTCAAGGGCAATCCTCCAGAGGG + Intronic
953068798 3:39499488-39499510 GTCAAGGGAAGGCTTCCAGGAGG - Intronic
954139247 3:48596416-48596438 AAGAAGGGCAGGCCCCCATCTGG + Intergenic
954388847 3:50258532-50258554 GACAAGGGCAGGCTTCAAACAGG - Exonic
955611048 3:60757901-60757923 GGTAATGGCAGGCATCCAGCAGG - Intronic
957290183 3:78269070-78269092 GACAGTGGCAGCCCTCAAGCAGG + Intergenic
961667874 3:128504816-128504838 GAAAAGGCCAGGGCTCTAGCTGG - Intergenic
961717049 3:128864883-128864905 GACAGAGGCAGGCCTGCAGCAGG + Intergenic
961804851 3:129482073-129482095 GACACAGGCAGGCCTGCAGCAGG - Intronic
964850266 3:161088417-161088439 GACAAAGGGAGGCCTACAGCAGG + Intronic
968317347 3:197736286-197736308 GACAGGGGCAGGGCACCACCCGG - Intronic
968684396 4:1947257-1947279 GACAAGGGCAGGCCTTGAATTGG + Intronic
969489987 4:7493689-7493711 CAGAAGGGCTGGGCTCCAGCTGG + Intronic
969562777 4:7960084-7960106 GACAAGGGAAGGGACCCAGCTGG + Intergenic
970281190 4:14457583-14457605 GACAAGCTCAGGCCTTCACCTGG + Intergenic
972357077 4:38289807-38289829 GAGAAGGGCAGACCCCCAGCAGG + Intergenic
979477732 4:121178074-121178096 GACTAGAGCAGAGCTCCAGCTGG - Intronic
982156790 4:152531262-152531284 GACAAGAGAAGGCCTCCATATGG + Intronic
983286330 4:165743848-165743870 GACAAAGGCAGCCCTCAAGCTGG - Intergenic
984140533 4:176000093-176000115 GAAAAGAGCAGGCCTGTAGCAGG - Intronic
986148951 5:5109577-5109599 GCACAGGGCAGCCCTCCAGCAGG - Intergenic
986202038 5:5587715-5587737 GACCAGGGCAGGGGTGCAGCTGG + Intergenic
986446187 5:7823634-7823656 GACATGGGCTGGCCTGCAGGTGG - Intronic
997200974 5:132010077-132010099 GACAAGGGCAGGGCTAGAGCTGG - Intronic
998432522 5:142078455-142078477 AAGAAGGGCTGGCCTCCAGTTGG - Intergenic
998582117 5:143387549-143387571 GACAAGGACAGGGCTCTAGAAGG - Intronic
998822966 5:146073415-146073437 GACACGGACATGCTTCCAGCTGG + Intronic
999721503 5:154402191-154402213 GACGCGGGCAGGGCTCCCGCAGG - Intronic
1004264823 6:14140074-14140096 GAGGAGGGCTGGACTCCAGCCGG + Intergenic
1005372959 6:25154081-25154103 GACAAGGGCAGGCCCCTGGGGGG + Intergenic
1006019512 6:31109785-31109807 GACCAGGGCAGGCACTCAGCAGG - Intergenic
1007926587 6:45654604-45654626 GAGAAGGGCAGCCATCCAGATGG - Intronic
1012821214 6:104087440-104087462 TACAAGGGCAGGCCTGCTGCTGG + Intergenic
1012976893 6:105789786-105789808 GACAGGGGAAGGCTTCCACCAGG + Intergenic
1015224506 6:130841525-130841547 GACCAGTGCAGGAGTCCAGCTGG + Intronic
1017141696 6:151196735-151196757 TAGAAGGGCAGGAATCCAGCTGG + Intergenic
1019049203 6:169170283-169170305 GGCAAGGGCAGGCCTCAGGATGG - Intergenic
1019321707 7:419021-419043 GACAGGGGCAGGATTCCAGGGGG - Intergenic
1019863857 7:3686709-3686731 GAGAAGGCCAGGCCACCAGCAGG + Intronic
1021913595 7:25410036-25410058 GACAAGGCCACGGCTCCAGGTGG - Intergenic
1022100996 7:27169168-27169190 GGCAGGCGCAGGCCTCCAGTGGG + Intronic
1022174903 7:27863452-27863474 GATCAGGGCAGGCCTCCTGGGGG - Intronic
1023225747 7:37967087-37967109 GACAAAGGCAGGGCTCCAGCAGG + Intronic
1023809599 7:43901752-43901774 GACCAGGCCGGGCCTCCAGTGGG + Intronic
1024079697 7:45845994-45846016 GACAAGAGCAAGACTCCATCTGG + Intergenic
1025125081 7:56337985-56338007 GACAAGAGCAAGACTCCATCTGG - Intergenic
1029647890 7:101869603-101869625 GCCAAGGTCAGGCGGCCAGCAGG + Intronic
1031964926 7:128020742-128020764 GGAAAGGGAAAGCCTCCAGCGGG + Intronic
1033625343 7:143105536-143105558 GACAGGGGCTGGCCTCCTGAAGG - Intergenic
1035545512 8:479379-479401 GTTAAAGGCAGGCCTCCTGCTGG - Intergenic
1035807861 8:2468708-2468730 GAGGAGGGCGGGCCCCCAGCAGG - Intergenic
1036184651 8:6613113-6613135 GAGGAAGGCAGGCCTGCAGCAGG + Intronic
1036756995 8:11477344-11477366 GAGAAGGGCAGGCCTTAGGCAGG + Intergenic
1037257592 8:16972808-16972830 GTCAAGGGCTGGTCTCCAGCAGG - Intergenic
1040072631 8:43200912-43200934 GACATGGGCTGGCCTCCAGGTGG - Exonic
1043756505 8:84010362-84010384 GACAAGGGCACTACTCCCGCTGG + Intergenic
1045345165 8:101287546-101287568 CCCAAGGTCAGGCCTCCTGCAGG - Intergenic
1047068403 8:121314184-121314206 AACAAGAGCAGGCCTACAGCAGG - Intergenic
1047616251 8:126564764-126564786 TAAAACAGCAGGCCTCCAGCAGG - Intergenic
1048276637 8:133071078-133071100 GACACAGGGAGGCCTCCAGCTGG - Intronic
1048327109 8:133448351-133448373 GACCAGGGCAGGCCCTCGGCAGG - Intergenic
1048840208 8:138558950-138558972 AACAAGGCCATGCCTCCAACAGG + Intergenic
1049088224 8:140494246-140494268 GCCAAGGGCATGACTCCAGGGGG + Intergenic
1049099631 8:140569588-140569610 AACAAGGGCAGGCATGGAGCTGG + Intronic
1049657206 8:143804174-143804196 GACAAGGACAGGCCTCGGTCAGG + Intronic
1054927330 9:70601836-70601858 GAAAAGGGAAGGACTCGAGCAGG - Intronic
1056114863 9:83432172-83432194 GACAAGGCTAGGCATCCAGAGGG - Intronic
1057443602 9:95098834-95098856 GACAAGGGCAGGCATCTGGCAGG - Intergenic
1060966906 9:127716641-127716663 GAGAAGGGCAGGACTGCAGAGGG + Exonic
1060997722 9:127884588-127884610 GACATGGGCAGGCAGCCTGCTGG - Intergenic
1061192001 9:129087610-129087632 GAGAAGGGCCGGCCTTCGGCCGG - Intronic
1061482184 9:130902785-130902807 CACAAGGGCAGGGCTGGAGCCGG - Exonic
1061592006 9:131603757-131603779 GCAAAGGGCAGACCTCCACCTGG + Intronic
1062186772 9:135222423-135222445 CACAGGGCCAGGCCTCCTGCAGG + Intergenic
1185601295 X:1341279-1341301 GACAAGGGCGAGTCTCCATCAGG + Intronic
1189247886 X:39577518-39577540 GACCAGGGCAGCCCAGCAGCCGG + Intergenic
1190385235 X:49878435-49878457 GACAAGGCCATCCCTACAGCTGG - Intergenic
1191816681 X:65253430-65253452 GATAGGGGCAGAACTCCAGCTGG + Intergenic
1194931738 X:99896618-99896640 GAGAAGAGCAGGGCTTCAGCCGG - Intergenic
1195289173 X:103414762-103414784 GGCAGGGGCAGAACTCCAGCTGG - Intergenic
1198962256 X:142195252-142195274 GACAAGGACATGCCTGCTGCTGG - Intergenic