ID: 1103576400

View in Genome Browser
Species Human (GRCh38)
Location 12:121880785-121880807
Sequence AACAATAATAAGATACTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103576400_1103576405 24 Left 1103576400 12:121880785-121880807 CCAGGCAGTATCTTATTATTGTT No data
Right 1103576405 12:121880832-121880854 TCACCCAGGCTGGTGTGCAGTGG 0: 588
1: 84511
2: 174930
3: 205489
4: 178962
1103576400_1103576403 10 Left 1103576400 12:121880785-121880807 CCAGGCAGTATCTTATTATTGTT No data
Right 1103576403 12:121880818-121880840 AGGGTCTCAATCTGTCACCCAGG 0: 70
1: 7752
2: 28748
3: 72439
4: 130917
1103576400_1103576404 14 Left 1103576400 12:121880785-121880807 CCAGGCAGTATCTTATTATTGTT No data
Right 1103576404 12:121880822-121880844 TCTCAATCTGTCACCCAGGCTGG 0: 238
1: 33991
2: 84294
3: 158714
4: 171096
1103576400_1103576402 -9 Left 1103576400 12:121880785-121880807 CCAGGCAGTATCTTATTATTGTT No data
Right 1103576402 12:121880799-121880821 ATTATTGTTATTATTTTCAAGGG No data
1103576400_1103576401 -10 Left 1103576400 12:121880785-121880807 CCAGGCAGTATCTTATTATTGTT No data
Right 1103576401 12:121880798-121880820 TATTATTGTTATTATTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103576400 Original CRISPR AACAATAATAAGATACTGCC TGG (reversed) Intergenic
No off target data available for this crispr