ID: 1103580611

View in Genome Browser
Species Human (GRCh38)
Location 12:121912319-121912341
Sequence CCGTGCCCGGCGCTTTGTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 68}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103580603_1103580611 20 Left 1103580603 12:121912276-121912298 CCGTCTTGGCCTCCCAAAGTGCT 0: 3853
1: 66063
2: 153594
3: 157369
4: 93226
Right 1103580611 12:121912319-121912341 CCGTGCCCGGCGCTTTGTTTAGG 0: 1
1: 0
2: 1
3: 8
4: 68
1103580604_1103580611 11 Left 1103580604 12:121912285-121912307 CCTCCCAAAGTGCTGCTATTATA 0: 6
1: 579
2: 35784
3: 360071
4: 251872
Right 1103580611 12:121912319-121912341 CCGTGCCCGGCGCTTTGTTTAGG 0: 1
1: 0
2: 1
3: 8
4: 68
1103580607_1103580611 7 Left 1103580607 12:121912289-121912311 CCAAAGTGCTGCTATTATAGGCG 0: 1
1: 175
2: 12862
3: 168507
4: 308822
Right 1103580611 12:121912319-121912341 CCGTGCCCGGCGCTTTGTTTAGG 0: 1
1: 0
2: 1
3: 8
4: 68
1103580602_1103580611 21 Left 1103580602 12:121912275-121912297 CCCGTCTTGGCCTCCCAAAGTGC 0: 3193
1: 67348
2: 183905
3: 230078
4: 178472
Right 1103580611 12:121912319-121912341 CCGTGCCCGGCGCTTTGTTTAGG 0: 1
1: 0
2: 1
3: 8
4: 68
1103580606_1103580611 8 Left 1103580606 12:121912288-121912310 CCCAAAGTGCTGCTATTATAGGC 0: 4
1: 424
2: 27380
3: 276338
4: 277492
Right 1103580611 12:121912319-121912341 CCGTGCCCGGCGCTTTGTTTAGG 0: 1
1: 0
2: 1
3: 8
4: 68
1103580601_1103580611 24 Left 1103580601 12:121912272-121912294 CCACCCGTCTTGGCCTCCCAAAG 0: 1006
1: 24236
2: 114799
3: 168022
4: 159461
Right 1103580611 12:121912319-121912341 CCGTGCCCGGCGCTTTGTTTAGG 0: 1
1: 0
2: 1
3: 8
4: 68
1103580600_1103580611 25 Left 1103580600 12:121912271-121912293 CCCACCCGTCTTGGCCTCCCAAA 0: 14
1: 353
2: 1900
3: 4594
4: 6251
Right 1103580611 12:121912319-121912341 CCGTGCCCGGCGCTTTGTTTAGG 0: 1
1: 0
2: 1
3: 8
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103580611 Original CRISPR CCGTGCCCGGCGCTTTGTTT AGG Intronic
900585367 1:3430040-3430062 GCGTGCCCTGCCCTTTGCTTGGG + Intronic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
902113284 1:14100619-14100641 CAGTGCCCAGGGCTTTGTTGGGG + Intergenic
904661411 1:32088125-32088147 CCGTGCCTGGCTTTTTTTTTTGG - Intronic
907392789 1:54169142-54169164 CCGTGCCAGGTGCTGTGTTTGGG + Intronic
914712044 1:150223388-150223410 CCGCGCCCGGCCCTTTAGTTAGG - Intronic
915865141 1:159491511-159491533 CCATGCCCGGCCCTTCGTTAAGG + Intergenic
919091128 1:192979860-192979882 CCGTGACCGGCGCGGAGTTTTGG + Intergenic
923141298 1:231162992-231163014 CCGTGTGCGGCTCTCTGTTTCGG + Exonic
1067524236 10:47028659-47028681 CCGTTCCAGGGGCTTTGTTGGGG - Intergenic
1078792824 11:14561707-14561729 CCATGCCCTGCGCTGTTTTTGGG + Intronic
1081117595 11:39223342-39223364 CCGTGCCCGGCCTTTTCTTGGGG - Intergenic
1081913328 11:46715109-46715131 CCCTGCCCCCCGCTTTGTTATGG + Intergenic
1087760343 11:102098575-102098597 CCGTGCCCGGCCTTTTTTTTTGG - Intergenic
1088551874 11:111021449-111021471 CCCTGCCTGCCTCTTTGTTTTGG - Intergenic
1090637854 11:128703552-128703574 CCGTGCCCGGCCCAATATTTTGG - Intronic
1093446687 12:19267671-19267693 CCGTGCCTGGCTATTTTTTTGGG - Intronic
1095156163 12:38857738-38857760 CCATGCCCGGCTATTTTTTTTGG - Intronic
1096222778 12:49842547-49842569 GCGTGCCTGGCGCTTTGGCTGGG - Intronic
1096811980 12:54176514-54176536 CCGTGCCCGGCCTTTTTTTTTGG - Intronic
1097114002 12:56683667-56683689 CCGCGCCCGGCCCATAGTTTTGG - Intronic
1098416275 12:70238834-70238856 CCGTGCCTGGCCTTTTCTTTTGG + Intergenic
1103580611 12:121912319-121912341 CCGTGCCCGGCGCTTTGTTTAGG + Intronic
1107857940 13:44633920-44633942 CCGCGCCCGGCCCTGTTTTTTGG - Intergenic
1113569267 13:111342332-111342354 CCCTGCCCGGAGCTGTCTTTGGG + Intronic
1113618760 13:111699094-111699116 CCTTTCCCGGGGCTGTGTTTAGG + Intergenic
1113624289 13:111784355-111784377 CCTTTCCCGGGGCTGTGTTTAGG + Intergenic
1114346836 14:21805480-21805502 CCATGCCCGGCTAATTGTTTTGG - Intergenic
1115075182 14:29380595-29380617 CCGTGCTCTTTGCTTTGTTTTGG - Intergenic
1118259633 14:64235059-64235081 CCGTGACCGATGCTTTGGTTTGG - Exonic
1119277999 14:73377674-73377696 CCATGCCCGGCCCTATATTTTGG - Intronic
1137853657 16:51771651-51771673 ACATGCCTGGCGTTTTGTTTAGG + Intergenic
1138040133 16:53654666-53654688 CCCTGCCCAGCACTTTGCTTAGG + Intronic
1141709496 16:85689530-85689552 CCGGGCCCGGTGCTGAGTTTGGG - Intronic
1141910215 16:87053550-87053572 CCCTGCCAGGCTGTTTGTTTTGG - Intergenic
1142962311 17:3558476-3558498 CCGTGCCCTGGGCCTTGTTCTGG - Intergenic
1146041380 17:29457818-29457840 CCGTGCCTGGCCTTTTGTTATGG - Intronic
1151192739 17:72410465-72410487 CCGTGCCCAGCCCGTTGTTGTGG + Intergenic
1153782648 18:8507611-8507633 CCGTGCCCGGCACGTTGTCCAGG - Intergenic
1156231372 18:35156791-35156813 CTGTGCCCGGCCTTTTGTTTTGG - Intergenic
1157611650 18:48960519-48960541 CCATGCCCGGCCCCTTGTGTGGG + Intergenic
1161769049 19:6221608-6221630 CCGTGCCCGGCTCCCTATTTAGG - Intronic
1166091867 19:40514509-40514531 CAGAGCCCTGGGCTTTGTTTTGG - Intronic
929059300 2:37906794-37906816 CCATGCCCGGCTATTTTTTTTGG - Intergenic
929155247 2:38783158-38783180 CCGTGCCCGGCTGTTTTTTGTGG + Exonic
930420442 2:51145907-51145929 CGGAGCCCGGTGCTTTGTTGTGG + Intergenic
930764418 2:55070266-55070288 CTGTGCCTGGCCTTTTGTTTGGG - Intronic
932161792 2:69466829-69466851 CCGTGCCTGGCCCTGTGTGTAGG - Intronic
940585299 2:155640571-155640593 CCACGCCCGGCCCATTGTTTTGG + Intergenic
943374107 2:187054123-187054145 CCACGCCCGGCCCTTTCTTTTGG + Intergenic
1172535801 20:35672246-35672268 CTGTGCCCGGCTTTTTTTTTTGG + Intronic
1173732407 20:45337984-45338006 CCGTGCCTGTGGCTTTGGTTTGG + Intronic
1183909582 22:41068368-41068390 CCGTGCCCGGCTATTTTTTTTGG + Intergenic
1185001328 22:48248290-48248312 CTGTGACCTGCGCTGTGTTTAGG - Intergenic
950386596 3:12664989-12665011 AAGGGCCCGGCGCTTTTTTTGGG + Intergenic
969493020 4:7510625-7510647 CCGGGGCCGGCGCCTTGTTCTGG + Intronic
970113417 4:12664262-12664284 CCGCGCCCGGCCTTTTGTGTGGG + Intergenic
971360724 4:25936211-25936233 CCATGCCCAGCCCTTTTTTTAGG - Intergenic
978717610 4:111864953-111864975 CTGTGCCCGGCCCTTTGTATAGG + Intergenic
978741938 4:112146107-112146129 CCGTGCCCTGCGCCAGGTTTAGG + Intronic
982282133 4:153694155-153694177 CAGAGCCCATCGCTTTGTTTTGG - Intergenic
991903770 5:71487531-71487553 CCGTGCCCGGCCCTTTGTATTGG + Intronic
992144777 5:73835179-73835201 CCGTGCCCGGCCCGTCCTTTTGG - Intronic
997928599 5:138053661-138053683 CAGTGCCTGGCACTTTTTTTGGG - Intergenic
1006389847 6:33751849-33751871 CCAAGCCCGGCGCCATGTTTGGG + Intergenic
1015400362 6:132781466-132781488 CCGTGCCCGGCCCTTTTCTGGGG - Intronic
1024259783 7:47565363-47565385 CCGCGCCCGGCCTTTTTTTTTGG + Intronic
1024428140 7:49253475-49253497 CCGTGCCTGGCCCTGTCTTTAGG + Intergenic
1025095859 7:56094860-56094882 CCGTGCCTGGCCCTTTTTTTTGG + Intergenic
1027798258 7:82720208-82720230 CCTTGCATGGCCCTTTGTTTTGG - Intergenic
1030333505 7:108298353-108298375 CCGTGCCCTGCGGGTTTTTTTGG - Intronic
1035116679 7:156530412-156530434 CCGAGCCGGGCCCCTTGTTTTGG + Intergenic
1038467074 8:27774316-27774338 CCGTTCCCGGGGCCTTGTTTAGG - Intronic
1038751330 8:30298879-30298901 CCGTGCCCGGCGATCTCTTGAGG - Intergenic
1060968623 9:127725272-127725294 CCGTGCCCAGCCTTTTTTTTTGG - Intronic
1189195912 X:39152305-39152327 ACTTGCCCGGAGCTTTGTTAGGG - Intergenic
1195615012 X:106905264-106905286 CCGTGCCAGGCCCTTGGGTTAGG - Intronic
1199926282 X:152468149-152468171 CCGTGCCCGGCTCATTTTTGTGG - Intergenic