ID: 1103581449

View in Genome Browser
Species Human (GRCh38)
Location 12:121918564-121918586
Sequence CCATGGGGACGGAGCTTGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 162}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103581428_1103581449 30 Left 1103581428 12:121918511-121918533 CCACCGCCCTGCCCTGTCGCTTT 0: 1
1: 0
2: 1
3: 20
4: 307
Right 1103581449 12:121918564-121918586 CCATGGGGACGGAGCTTGGGTGG 0: 1
1: 0
2: 1
3: 12
4: 162
1103581434_1103581449 19 Left 1103581434 12:121918522-121918544 CCCTGTCGCTTTAGGGCCTGTCG 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1103581449 12:121918564-121918586 CCATGGGGACGGAGCTTGGGTGG 0: 1
1: 0
2: 1
3: 12
4: 162
1103581435_1103581449 18 Left 1103581435 12:121918523-121918545 CCTGTCGCTTTAGGGCCTGTCGC 0: 1
1: 1
2: 0
3: 1
4: 30
Right 1103581449 12:121918564-121918586 CCATGGGGACGGAGCTTGGGTGG 0: 1
1: 0
2: 1
3: 12
4: 162
1103581439_1103581449 3 Left 1103581439 12:121918538-121918560 CCTGTCGCTTCCGGCGGTGGCGG 0: 1
1: 0
2: 0
3: 8
4: 45
Right 1103581449 12:121918564-121918586 CCATGGGGACGGAGCTTGGGTGG 0: 1
1: 0
2: 1
3: 12
4: 162
1103581432_1103581449 24 Left 1103581432 12:121918517-121918539 CCCTGCCCTGTCGCTTTAGGGCC 0: 1
1: 0
2: 1
3: 18
4: 103
Right 1103581449 12:121918564-121918586 CCATGGGGACGGAGCTTGGGTGG 0: 1
1: 0
2: 1
3: 12
4: 162
1103581429_1103581449 27 Left 1103581429 12:121918514-121918536 CCGCCCTGCCCTGTCGCTTTAGG 0: 1
1: 0
2: 9
3: 15
4: 210
Right 1103581449 12:121918564-121918586 CCATGGGGACGGAGCTTGGGTGG 0: 1
1: 0
2: 1
3: 12
4: 162
1103581442_1103581449 -7 Left 1103581442 12:121918548-121918570 CCGGCGGTGGCGGTTGCCATGGG 0: 1
1: 0
2: 1
3: 68
4: 306
Right 1103581449 12:121918564-121918586 CCATGGGGACGGAGCTTGGGTGG 0: 1
1: 0
2: 1
3: 12
4: 162
1103581433_1103581449 23 Left 1103581433 12:121918518-121918540 CCTGCCCTGTCGCTTTAGGGCCT 0: 1
1: 0
2: 1
3: 13
4: 149
Right 1103581449 12:121918564-121918586 CCATGGGGACGGAGCTTGGGTGG 0: 1
1: 0
2: 1
3: 12
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103581449 Original CRISPR CCATGGGGACGGAGCTTGGG TGG Exonic
900485834 1:2922266-2922288 ACACGGGGACGGAGCTGGGCTGG - Intergenic
900511602 1:3063442-3063464 CCGTGGAGACGGAGCTGCGGTGG - Intergenic
900695618 1:4008033-4008055 CCATGGGGAAGGAACTGGGCAGG + Intergenic
900756142 1:4436339-4436361 CCATGGGGAGGGAGCCTGCTGGG - Intergenic
901772380 1:11536949-11536971 CCATGGTGACCGGGCATGGGAGG - Exonic
902583169 1:17422174-17422196 CCATGGAGCCGGAGCTGAGGAGG + Intronic
903982983 1:27203402-27203424 GCATGGGGAAGGAGCTCGGCTGG - Intergenic
904045446 1:27605616-27605638 CCATAGAGAAGGAGCTTGGAAGG - Intergenic
904471402 1:30738822-30738844 CCCTGGAGTTGGAGCTTGGGAGG - Intronic
906108254 1:43307338-43307360 CCATGTGGGTGGAGCTTGGAGGG + Intronic
907443329 1:54491425-54491447 CCAGGGAGAGGGAGCTTGGTGGG + Intergenic
908587594 1:65588595-65588617 CCCTGGGGACAGAGGTGGGGTGG - Intronic
912800194 1:112715340-112715362 CCATGGGGGCGGGGCCTGGGCGG - Exonic
915602398 1:156930460-156930482 CTCTGGGGAGGGAGCCTGGGTGG + Intronic
920268215 1:204742901-204742923 CCATGGGGAGGAAGACTGGGAGG + Intergenic
920870879 1:209793715-209793737 CCTTGAGGACGGAGGGTGGGAGG - Intronic
924739321 1:246785722-246785744 CCATGGGGACGGGACTCAGGAGG - Intergenic
924739346 1:246785812-246785834 CCATGGGGACGGGACTCAGGAGG - Intergenic
924739363 1:246785872-246785894 CCATGGGGACGGGACTCAGGAGG - Intergenic
1066437360 10:35406865-35406887 CGACGGGGACGGAGGTGGGGGGG - Intronic
1067139908 10:43648482-43648504 CCATGGCGTCGGGGCGTGGGAGG - Intronic
1067920718 10:50454198-50454220 CAATGGGGACAGATCATGGGGGG + Intronic
1069656881 10:70096559-70096581 CCAGGGTGGAGGAGCTTGGGAGG + Intronic
1070074896 10:73125451-73125473 CCTTGGGAAAGGAGCTTTGGCGG - Exonic
1071277135 10:84065601-84065623 GCCTGTGGAGGGAGCTTGGGTGG - Intergenic
1074235255 10:111578380-111578402 CCATGGGGATGGACGGTGGGAGG - Intergenic
1076715925 10:132363680-132363702 CCGTGGGGCCTGAGCTTGGAAGG + Intronic
1077185611 11:1234184-1234206 CCCTGGGGACAGAGCTTGGTGGG - Exonic
1077284354 11:1759183-1759205 CCCTGGGGAGGCAGCTTGGGGGG - Intronic
1077353273 11:2102868-2102890 AGATGTGGAGGGAGCTTGGGTGG - Intergenic
1078822081 11:14892302-14892324 CAATGGCCACGGAGCTAGGGCGG - Intergenic
1079237024 11:18698583-18698605 CCAAGGGGGCGGGGCCTGGGGGG + Intronic
1082128266 11:48456948-48456970 CCATGGGGTTGGAGGTTTGGGGG - Intergenic
1082561816 11:54627873-54627895 CCATGGGGTTGGAGGTTTGGGGG - Intergenic
1084473919 11:69378165-69378187 CCATGGGCAGGGCGTTTGGGAGG - Intergenic
1084632069 11:70359407-70359429 CCATGGCAATGGAGCATGGGAGG + Intronic
1089375859 11:117994173-117994195 GCATGGGGAGGGAGACTGGGAGG + Intronic
1090409595 11:126498697-126498719 CCATGGGGACAGAGCTGGCCTGG + Intronic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1091218574 11:133918037-133918059 ACATGGGGACGGGGGGTGGGGGG + Intronic
1096156604 12:49344977-49344999 CCAGGCGGAGGGAGGTTGGGAGG - Intergenic
1096677461 12:53233338-53233360 CCATGGGGACTGGAGTTGGGAGG + Intergenic
1101246907 12:102892006-102892028 CATTGGGGAAGCAGCTTGGGAGG + Intronic
1101249121 12:102914993-102915015 CCATGGGGATGGAGCGTTTGAGG - Intronic
1101685636 12:107017338-107017360 ACATGGGGAAGGAGCATGGAAGG - Intronic
1102553509 12:113710514-113710536 CCATGTGAATCGAGCTTGGGGGG - Intergenic
1103581449 12:121918564-121918586 CCATGGGGACGGAGCTTGGGTGG + Exonic
1104631578 12:130407497-130407519 CCATGGGGACAGGGCTTGTCAGG + Intronic
1107943226 13:45393118-45393140 ACATGGGGAGGGGGGTTGGGGGG + Intergenic
1112926264 13:104678924-104678946 CAATGGGGACACTGCTTGGGTGG - Intergenic
1122312464 14:100805836-100805858 CCATGGAGACAGGGCTGGGGAGG - Intergenic
1122692804 14:103539152-103539174 GCATGGGGTGGGAGCATGGGAGG - Intergenic
1122707304 14:103629305-103629327 CCAAGGGGACAGCGCGTGGGTGG + Intronic
1124576068 15:30909625-30909647 CCATGGGGCTGGAGCATGGATGG - Intronic
1128893599 15:71352863-71352885 CCATAGGGACGGGACATGGGTGG + Intronic
1130783298 15:87068523-87068545 CCCTGGAGACAGAGCTTTGGAGG + Intergenic
1132175244 15:99708893-99708915 GAATGGGGACAGAGCGTGGGTGG + Intronic
1132505885 16:308501-308523 CCATGAGGACGGGGCTTGAGTGG - Intronic
1132670881 16:1101930-1101952 CTCTGGGGCTGGAGCTTGGGGGG - Intergenic
1132677719 16:1127525-1127547 CCGTGTGGATGGAGCTGGGGCGG + Intergenic
1135970209 16:27066857-27066879 CCATGGTGATGGGGCTTGTGAGG - Intergenic
1136118225 16:28109435-28109457 CCATTGGGAAGGTGCTTGGCAGG - Intronic
1136276131 16:29180452-29180474 CCATGGGGGCTGAGACTGGGGGG - Intergenic
1136558754 16:31025781-31025803 CCATGGGGAGAGAGCTATGGGGG + Intergenic
1139484164 16:67246852-67246874 CCCTGGAGGCGGAGCTGGGGAGG - Intronic
1141132226 16:81444576-81444598 CCCTGGGGAGGGGGCTGGGGCGG - Intergenic
1141375800 16:83529058-83529080 TCATGGGGAGGGGGTTTGGGTGG - Intronic
1142271045 16:89089403-89089425 CCCTGGGGAGGGGCCTTGGGCGG - Intronic
1142597759 17:1037810-1037832 CCATGAGCTCGGAGCTTGGGTGG - Intronic
1143583009 17:7837142-7837164 CTATGGGGGCGGAGCCTTGGAGG - Intergenic
1145396164 17:22496661-22496683 CCATGGGGCAGGGGGTTGGGGGG + Intergenic
1148187644 17:45656137-45656159 GCATGGGGATGGACCTTGTGAGG - Intergenic
1151674522 17:75590700-75590722 CCACGGGGACGGACAGTGGGCGG + Intergenic
1151851093 17:76690228-76690250 TCTTGGGAAAGGAGCTTGGGGGG + Intronic
1151964748 17:77425485-77425507 TCATGGGGACGCTGCCTGGGGGG + Intronic
1152628725 17:81400076-81400098 CCGCGGCGACGCAGCTTGGGGGG - Intronic
1153355842 18:4134325-4134347 CCCTGGGGCGGGAGGTTGGGGGG + Intronic
1153679032 18:7483073-7483095 CAGTGGAGACGGAGCTTAGGAGG - Intergenic
1158571334 18:58599103-58599125 TCCTGGGGACGGGACTTGGGTGG - Intronic
1159053164 18:63440547-63440569 CCTTGGGGTCTGAGGTTGGGTGG + Intergenic
1160865239 19:1253278-1253300 CCATGGGGAGGGAGGCAGGGAGG - Intronic
1161957802 19:7506220-7506242 CCATGGGGGCGGGGCTTTCGGGG - Intronic
1162079349 19:8209286-8209308 CCGTGGGGGCGGGGCCTGGGCGG - Intronic
1162094524 19:8302661-8302683 CCATGTGTATGGAGCTTGGTGGG - Intronic
1164179348 19:22806336-22806358 CACTGGGGAGGGAGTTTGGGAGG - Intergenic
1166310230 19:41958591-41958613 CCTTGGGGGCGGGGCCTGGGCGG + Intronic
1167359957 19:49024639-49024661 CCATGGGGCCGAAGCCTCGGAGG + Intronic
1167621700 19:50564370-50564392 CCACGGGGAAGGAGCAGGGGAGG + Intronic
925388613 2:3480867-3480889 GCATGGGGGTGGGGCTTGGGAGG - Intronic
925717688 2:6799647-6799669 CCATGGGGACATGGCTTGGGTGG - Intergenic
926202498 2:10812279-10812301 GCGTGGGGACGGAGGTTGGCGGG - Intronic
926622566 2:15060292-15060314 GCATGGGGACGCAGGTGGGGAGG - Intergenic
929594788 2:43169353-43169375 CCAAGGGGACAGGGCGTGGGTGG + Intergenic
932118169 2:69072829-69072851 CCATGGGGACAGACTTTAGGGGG - Intronic
933089684 2:78105250-78105272 CCATGGGATTGGAGATTGGGGGG + Intergenic
935054649 2:99554697-99554719 CCACGGAGATGGGGCTTGGGCGG + Exonic
935175077 2:100642289-100642311 CCTGGGGGATGGAGGTTGGGGGG + Intergenic
937183011 2:120013022-120013044 CCCTGGGGGCGGAGCTGGGAGGG + Exonic
937580953 2:123487460-123487482 CCACAAGGACGGAGCTTGGAAGG - Intergenic
942541275 2:177017771-177017793 CCCTGGGGACAGAGGGTGGGAGG + Intergenic
946155525 2:217804410-217804432 CCATGGGGAAGGGGCTTGTGGGG - Exonic
948910478 2:240999935-240999957 CCGTGGTGACGGAGCTGGAGGGG - Intronic
948948986 2:241236719-241236741 GAATGGGGACGAAGCTGGGGAGG - Exonic
1169394050 20:5214297-5214319 TCCTGGGGGCAGAGCTTGGGAGG + Intergenic
1174521302 20:51132682-51132704 CCACGGGGACCCGGCTTGGGAGG + Intergenic
1175790897 20:61739220-61739242 CCATGGGGAGGGAGTTGCGGGGG + Intronic
1176090774 20:63317743-63317765 CCATGGGGGCGGAGCACAGGGGG - Intronic
1176150076 20:63586189-63586211 CGATGGGGACAGAGCATGGGAGG + Intergenic
1179897080 21:44369156-44369178 CCCTGGGGAAGGAGCACGGGTGG - Exonic
1180087425 21:45514261-45514283 CCCTGGGGACCCTGCTTGGGGGG - Exonic
1181986473 22:26803450-26803472 CCATGGGGAAGGAGGTGGGGCGG - Intergenic
1183038632 22:35159511-35159533 CCCTGGGGATGGAGCTTTTGGGG + Intergenic
1183669382 22:39263465-39263487 CCATGGTGAGGGAGCTGGGCGGG + Intergenic
1183903418 22:41022424-41022446 CCTTGGCCCCGGAGCTTGGGAGG - Intergenic
1184028911 22:41879396-41879418 CCATGGGGACTGAGCAGGGGCGG + Intronic
1184500370 22:44867948-44867970 GCATGGGGACAGAGATAGGGAGG + Intergenic
1184684057 22:46088084-46088106 CCATGGGGACGGAGCCCGGGAGG - Intronic
1185195983 22:49469865-49469887 CCCTGGGGGAGGAGCTGGGGTGG + Intronic
949104982 3:192796-192818 CCCGGGGGGCGGAGCTTGCGGGG + Intergenic
950535307 3:13574886-13574908 CCATGTGCACGCAGCATGGGAGG - Intronic
953911388 3:46894780-46894802 CCAGGGGGGCCTAGCTTGGGCGG + Intronic
961645198 3:128389115-128389137 CCATGGGGATGGAGGCTGGAGGG + Intronic
961831740 3:129626726-129626748 GCCTGGGGACAGAGCTGGGGCGG + Intergenic
962282193 3:134060438-134060460 CCATGCTGACTGAGCTTGGGTGG + Intergenic
966877607 3:184332099-184332121 CCATGGGGACAGGGGTGGGGTGG + Intronic
968177834 3:196566789-196566811 ACATGGGGAAGGGGCTTGGTGGG + Intronic
968479911 4:828733-828755 CCACTGGAACGGAGCCTGGGTGG - Intergenic
968884162 4:3318381-3318403 CCACAGGGACAGAGCTAGGGAGG - Intronic
969926466 4:10590364-10590386 CCATGGGAACAGAGTTTGGATGG + Intronic
972161800 4:36236259-36236281 TAATGGGGAGGGAGTTTGGGAGG - Intronic
973774547 4:54231980-54232002 TCCTGGGGACGGACCGTGGGCGG + Intronic
981106999 4:140892711-140892733 CCAGGGGGAAGGAACTTGTGAGG - Intronic
988801522 5:34700387-34700409 CCATGGGGAAAGGGCTTAGGTGG - Intronic
995366088 5:111362778-111362800 CCATGGGCACAGAGCCTGGCTGG - Intronic
997228843 5:132228436-132228458 CCCTGGAGACCGAGATTGGGAGG + Intronic
997586660 5:135047622-135047644 CCAGGGAGATGGAGCTTGTGGGG - Intronic
1006463046 6:34174989-34175011 GCATGGGGCCGGAGGATGGGTGG + Intergenic
1006665247 6:35688772-35688794 CCATGGCCACGGAGATGGGGCGG - Intronic
1008572736 6:52830659-52830681 CCACGGGGAAGGAGCTTGCCAGG + Intergenic
1011627640 6:89296471-89296493 CCATGGGGAGGAGGCTTGGAAGG + Intronic
1015749886 6:136549763-136549785 CCGAGGGGACCGAGCTCGGGAGG - Intronic
1018621862 6:165736530-165736552 GCCTGGGGCTGGAGCTTGGGAGG - Intronic
1018972854 6:168540548-168540570 CCAGGGGCACGGAGCTAGGAGGG + Intronic
1019008856 6:168825746-168825768 TCAGGGGGACGGAGCGTGGGGGG + Intergenic
1022468468 7:30666816-30666838 TCATGGGGACAGCCCTTGGGGGG + Intronic
1023256589 7:38318641-38318663 CCATGGGGAAGGTGGGTGGGAGG - Intergenic
1023955526 7:44884362-44884384 CCAAGGGGATGGTGGTTGGGTGG + Exonic
1025078797 7:55964829-55964851 CAGTGGGGCCGGAGCTGGGGTGG + Intronic
1029536222 7:101159367-101159389 CCATGGGGTGGGAGGTAGGGTGG + Intronic
1034491446 7:151395174-151395196 CCATGAGGACGGAGCCCAGGAGG + Intronic
1034944858 7:155255338-155255360 CCAGAGGGACGGGGCTGGGGAGG - Intergenic
1036072238 8:5453956-5453978 CAATGGTGAGGGAGCTTGGCAGG - Intergenic
1039465316 8:37781291-37781313 TCATGAGGAATGAGCTTGGGAGG - Intergenic
1040530303 8:48261286-48261308 CCATGGGGACAGAGCTTCCTGGG - Intergenic
1041201607 8:55455136-55455158 CCATGGGGAGGGACGCTGGGCGG + Intronic
1043118551 8:76291091-76291113 CAAAGGGGACTCAGCTTGGGAGG - Intergenic
1043646502 8:82527223-82527245 TCACGGGGAGAGAGCTTGGGGGG - Intergenic
1045984931 8:108239057-108239079 CCTTGGGCATGGAGCTTGGAAGG + Intronic
1048881303 8:138874888-138874910 CCATGAGGGCTGAGATTGGGTGG - Intronic
1052819636 9:33128662-33128684 GTGTGGGAACGGAGCTTGGGAGG - Intronic
1053477459 9:38392733-38392755 CCATGTGGACAGAGCTGGGAGGG + Exonic
1058901894 9:109449281-109449303 TCATGCAGATGGAGCTTGGGTGG - Intronic
1059671883 9:116499707-116499729 CCATGGGGTGGAAGATTGGGGGG + Intronic
1060859740 9:126944564-126944586 CTATGGGGAGGGAAATTGGGTGG + Intronic
1062348849 9:136128904-136128926 CCATGAGGACAGAGCTTCAGTGG + Intergenic
1062596565 9:137302374-137302396 ACATGGGGGCGGGGCGTGGGCGG + Intergenic
1185641581 X:1591838-1591860 CCGGGGGGCCGGGGCTTGGGAGG + Intronic
1186309444 X:8301990-8302012 CCTTGGGGAAGGAGGTTGGAAGG - Intergenic
1187822434 X:23302412-23302434 CCATGGGGAGGGTGCTGAGGAGG - Intergenic
1190248371 X:48705445-48705467 CCATGGGGCCGGAGATTTGTTGG + Intronic
1190887350 X:54541517-54541539 CCATGGGGACGGACGAAGGGAGG + Intronic
1192436377 X:71145865-71145887 CCATGGAGACGGTGAATGGGGGG + Intronic
1197950058 X:131885041-131885063 CCTTGGGGGTGGAGCATGGGAGG - Intergenic
1197965079 X:132051739-132051761 CCAGGGGGTGGGGGCTTGGGGGG - Intergenic
1198935225 X:141896953-141896975 CCCTGGGGAGAGATCTTGGGAGG - Exonic
1199992077 X:152993080-152993102 CTGTAGGGGCGGAGCTTGGGAGG - Intronic