ID: 1103585218

View in Genome Browser
Species Human (GRCh38)
Location 12:121948156-121948178
Sequence TCACTTCCATAGTTTCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 220}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103585218 Original CRISPR TCACTTCCATAGTTTCTGCA GGG Intronic
905718118 1:40170698-40170720 TCACCTCCAAAGGTTTTGCAGGG + Intronic
909594011 1:77384731-77384753 TCACTTCCATAGTGACTGTTGGG - Intronic
914001032 1:143694546-143694568 TCACTGTCATAATTTTTGCAAGG - Intergenic
914511002 1:148331921-148331943 TCACTGTCATAATTTTTGCAAGG - Intergenic
916105199 1:161424575-161424597 TCACTTATATAGTTTCCCCACGG + Intergenic
916618269 1:166467768-166467790 TCACTTCCACAGTGTCTTGAGGG - Intergenic
918058278 1:181041529-181041551 TCACTTCCATAGTTTTTCATGGG - Intronic
921777970 1:219125077-219125099 TCACTTCCAAAAATTCTTCAAGG + Intergenic
921994161 1:221398460-221398482 TCAGTTCCAAAATTTCTGCTTGG - Intergenic
922534518 1:226370043-226370065 TCTCCTCCATGGGTTCTGCAGGG + Intronic
1062853167 10:760772-760794 TCACCTCCATAATTTCTGTTTGG - Intergenic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1063001501 10:1928513-1928535 ACGCTTCCAGAGTATCTGCATGG - Intergenic
1063811940 10:9721637-9721659 TCACTTACATTGTTTCTGGTAGG - Intergenic
1064021504 10:11813046-11813068 TCACTTCCCAAGTCTCTACATGG - Intergenic
1066497911 10:35960166-35960188 TCACTTACATATTTCCTACAGGG - Intergenic
1068002927 10:51357574-51357596 TCTCGTCAATAGTTTCTGAAAGG - Intronic
1069609252 10:69761633-69761655 TCTCCTCCATAGTTGCTGCCAGG - Intergenic
1070543816 10:77437193-77437215 TTACATCCAGAGTTTCTGGAGGG - Intronic
1070737426 10:78873044-78873066 TAACTTCCAGAGTTTCTTTAGGG + Intergenic
1071096556 10:81981938-81981960 TCACATCCATAATTTCTTTATGG + Intronic
1071175214 10:82918222-82918244 TCATTTCCATATTTTATACATGG + Intronic
1072877439 10:99188031-99188053 TCATATCCATGGTTTCTGCAAGG + Intronic
1073148270 10:101294552-101294574 TCACATCCAAAGTGTTTGCAAGG + Intergenic
1073590202 10:104749915-104749937 TCATTTTCATTGTTTTTGCAAGG - Intronic
1073809800 10:107140224-107140246 TCAACTTCATAGATTCTGCAAGG - Intronic
1074229400 10:111518555-111518577 TCTCTCTCATAGTTTCTTCATGG + Intergenic
1074848860 10:117422421-117422443 ACCCGTCCATAGTTTCTGGATGG - Intergenic
1074965651 10:118488742-118488764 TCACTCCCATAGTTTTTGGCAGG + Intergenic
1076290487 10:129342128-129342150 TCAAGTCCATAGCTTTTGCAAGG - Intergenic
1076771510 10:132668369-132668391 TCATTTCCATATTTTTTCCATGG - Intronic
1076890243 10:133279876-133279898 TGACTTCAATGGTTTCTACACGG - Exonic
1078135360 11:8647653-8647675 TCTCTTCCCTAGTGTCTGCTTGG + Intronic
1078913450 11:15755464-15755486 TCACTTCCATCCTTTCCGTAAGG - Intergenic
1081104169 11:39044121-39044143 TCACTTCTCTAATTTTTGCAGGG + Intergenic
1081556867 11:44172349-44172371 CCACTGCCACAGTTTCTACAAGG - Intronic
1083529273 11:63403930-63403952 TAACCTCCATAGTGTCTTCATGG - Intronic
1084950126 11:72660325-72660347 GCCCCTCCTTAGTTTCTGCATGG - Intronic
1087017352 11:93566894-93566916 TTACTTCAATAGTTTCTTGAGGG - Intergenic
1088523140 11:110721062-110721084 TCACTGCCATATTTGCTGCAAGG + Intergenic
1090288246 11:125518974-125518996 TCACTTCCATAATGTTTTCAAGG - Intergenic
1090291279 11:125547285-125547307 ACATTTCCATACTTTCTACATGG - Intergenic
1091102351 11:132886768-132886790 TCATTTCCAAAGATGCTGCAGGG - Intronic
1092363767 12:7860150-7860172 TCACTTCCAGTTTTTCTCCAGGG - Intronic
1092380782 12:7995343-7995365 TCACTTCCAGTTTTTCTCCAAGG + Intergenic
1093876311 12:24353327-24353349 GCCCTTCCATAGTTTCTTTACGG - Intergenic
1094770702 12:33655165-33655187 TCACTTCAATAGATCATGCATGG - Intergenic
1095147235 12:38745470-38745492 TCACTACACTAGTTACTGCAGGG - Intronic
1095198335 12:39351293-39351315 TCTCTTAAATATTTTCTGCAGGG - Intronic
1096892344 12:54784913-54784935 TCAGTTCCAGAATTTCTGCTTGG + Intergenic
1098208918 12:68141971-68141993 ACACTAACATAGTTTCTGGAAGG - Intergenic
1098427467 12:70381407-70381429 TCATGTACAAAGTTTCTGCATGG - Intronic
1100305116 12:93343092-93343114 TAATTTCTATATTTTCTGCAGGG - Intergenic
1103585218 12:121948156-121948178 TCACTTCCATAGTTTCTGCAGGG + Intronic
1105663025 13:22520257-22520279 TGACTTCCATAGTTTCTTTAAGG - Intergenic
1105917494 13:24930244-24930266 TCAGTTCCATAATTTCTGTTTGG + Intergenic
1106759847 13:32857883-32857905 TCACTTCCTTGGTGTCTACACGG - Intergenic
1107052839 13:36070534-36070556 TTACTTGCAAAGTTTCTGCAAGG + Intronic
1107690067 13:42944844-42944866 TCACTATTATAGTTTCTACAAGG - Intronic
1107877412 13:44802955-44802977 TCACTTCCATCATTTATGCTGGG - Intergenic
1111239426 13:85455727-85455749 TGACTGCCTTAGTTTTTGCATGG - Intergenic
1111571600 13:90094677-90094699 TCAAATCCATGGTTTCTTCATGG - Intergenic
1112797406 13:103071361-103071383 TCACTTTCATCGTTTTAGCAAGG + Intergenic
1113217774 13:108062172-108062194 TCAGTTCCAAAATTTCTGCTTGG - Intergenic
1114473161 14:22977636-22977658 TCACTCCCCCAGTTTCTGCCTGG - Intronic
1114754579 14:25245219-25245241 TCACTTCAGTAGCTTCTGCCTGG - Intergenic
1115274260 14:31589742-31589764 CCCCTGCCATATTTTCTGCATGG + Intronic
1117559912 14:56926741-56926763 TCACTTGCATAGTGTCATCAGGG + Intergenic
1117591616 14:57275119-57275141 TTATTTTCATAGTTTCTGTAGGG + Intronic
1119603018 14:75990084-75990106 TCACTCCCCTAGTTTCTTCCAGG - Intronic
1119847467 14:77841071-77841093 TGACTTCCACAGTGACTGCAGGG + Intronic
1120020252 14:79522105-79522127 TCAATTCCATTGATTCTGCCTGG - Intronic
1120515849 14:85469075-85469097 TCACTTCCTTAGTGTCTGCAGGG + Intergenic
1124048180 15:26170425-26170447 TCACTACCATCTTTTCTTCAGGG - Intergenic
1124242051 15:28037003-28037025 TCACATCCACAGATTCTCCAAGG + Intronic
1124259874 15:28179016-28179038 TCCCTTCCACAGTCACTGCAAGG + Exonic
1124822784 15:33063994-33064016 TCATTTACACAGTTTCTGCAGGG - Intronic
1124900886 15:33821371-33821393 TGATTTCCCTAGTTTCTGGATGG + Intronic
1130079813 15:80723015-80723037 TCACATCCTTAGGTTCTGCGGGG + Intronic
1132079995 15:98855407-98855429 TCACTTCCTAAGTACCTGCAAGG - Intronic
1132805174 16:1771913-1771935 TCCCTTTCATAGCTTCTGCCGGG + Exonic
1137703449 16:50517121-50517143 TCAGTTCCATAATTTCTGTTTGG + Intergenic
1138850206 16:60619674-60619696 TTGCATCCATAGTTACTGCACGG - Intergenic
1140502551 16:75446624-75446646 GCACTTCTATAGTTTCTCAAGGG + Intronic
1143574123 17:7779937-7779959 TCCTTTCCTTACTTTCTGCATGG - Intronic
1144760151 17:17702528-17702550 TCACCTCCATTTTGTCTGCAAGG - Intronic
1147285556 17:39400896-39400918 CCACTTCCCTAGTTTCACCAAGG + Intronic
1150265833 17:63831947-63831969 TCACTTCCATAATTTCTTGATGG - Exonic
1151104103 17:71592300-71592322 TTACTTCCAGCATTTCTGCAAGG + Intergenic
1152114390 17:78376458-78376480 CCACTTCCACAGATTATGCAGGG - Intergenic
1152355267 17:79803765-79803787 TCACTTCAATTCCTTCTGCATGG - Intergenic
1153414472 18:4831418-4831440 TCCCTTCCATCCTGTCTGCAAGG - Intergenic
1156475228 18:37401808-37401830 TCACTTCCCTAGGGGCTGCAAGG + Intronic
1156678023 18:39554409-39554431 TCACTTCCATTAATGCTGCATGG + Intergenic
1157553972 18:48600556-48600578 TCACTTCCTCAGTGTCTGCCAGG - Intronic
1157680982 18:49606176-49606198 TCAGTTCCAGAATTTCTGCTTGG - Intergenic
1158186157 18:54774079-54774101 TCAGTTGCATAGTTTCTTGAAGG - Intronic
1158463828 18:57671438-57671460 TCACTTTTATTCTTTCTGCAAGG - Intronic
1159050270 18:63415314-63415336 GCACTTCCATAGTTTCTTGATGG + Intronic
1160282255 18:77502469-77502491 TCTCTTCAAGAGTTTCTGGAAGG + Intergenic
1162831997 19:13291045-13291067 TCATTTCCAAAGTGTCTCCAAGG + Intronic
1165728648 19:38130249-38130271 TGACTGCCATGGTCTCTGCAAGG + Intronic
925657292 2:6164037-6164059 TCACATCCATGGTTACTGCTTGG - Intergenic
926472515 2:13278856-13278878 TCACTGCAAAATTTTCTGCATGG + Intergenic
928188215 2:29135040-29135062 TCAGTTCCATAGTTGTAGCATGG + Intronic
929236459 2:39610346-39610368 TTACTTCCCTGGTTTGTGCAGGG + Intergenic
929320147 2:40533231-40533253 TCATCTCCATGGTTTCTGCCAGG - Intronic
930617180 2:53605845-53605867 TCACATCCATATTCTCTGGAAGG - Intronic
931733117 2:65170610-65170632 TCACTTCCTTTGTTTCCTCAGGG + Intergenic
933063033 2:77761776-77761798 TAACTTCCATTTTTTCTGAAAGG - Intergenic
938944614 2:136200416-136200438 CCTCTTCCATATCTTCTGCAGGG + Intergenic
940602008 2:155874700-155874722 TCACTTCCAGAATTTCTGTTTGG - Intergenic
940657103 2:156501029-156501051 TCACTCCCACAGGTTCTTCAAGG + Intronic
943002035 2:182340284-182340306 TCACCACCATAACTTCTGCATGG + Intronic
945280165 2:208028340-208028362 TGAATTCCATAATTTCTACAAGG + Intergenic
945884219 2:215357744-215357766 AAACTTCCTTAGTTTCTGCAAGG + Intergenic
945959451 2:216117043-216117065 TCACTTCCCTGTTCTCTGCATGG + Intronic
947390429 2:229634087-229634109 TCATTTCCATAGGCTGTGCATGG - Intronic
1168899835 20:1354183-1354205 TCAGCTCCAGAGTTTCTGCTTGG + Intronic
1169176238 20:3517450-3517472 TCATTGCAATGGTTTCTGCATGG - Intronic
1170756265 20:19209945-19209967 TCAGGTCCAAAGTCTCTGCAGGG + Intergenic
1171395543 20:24830541-24830563 TGACTTCCATAGGCTCTACATGG - Intergenic
1173691466 20:44964432-44964454 TCGTTTCCATAGGTTCTGCAGGG - Intergenic
1176313529 21:5219611-5219633 TCCCTTCCAGGGTCTCTGCAAGG - Intergenic
1177965127 21:27718298-27718320 ACAAATGCATAGTTTCTGCAGGG - Intergenic
1179838352 21:44052891-44052913 TCCCTTTCACAGTTTCTGAAGGG - Intronic
1184801686 22:46764575-46764597 TCACATCCATAGTTTCCAGATGG - Intronic
951943633 3:28110059-28110081 TCACTTCCAGAGTTGAAGCATGG - Intergenic
953342867 3:42150213-42150235 TCACTACCTTGGTTTGTGCAGGG + Intronic
953618252 3:44510881-44510903 TCCCTCCCATCGGTTCTGCACGG + Intergenic
955708856 3:61757559-61757581 TCAGTTCATTAATTTCTGCAAGG - Intronic
955956447 3:64294613-64294635 GCGTTTCCATAGTTTCTGAATGG - Intronic
956275715 3:67498971-67498993 TCACATACATGGGTTCTGCAAGG + Intronic
956377745 3:68634006-68634028 TCTCTTCCAGGGTGTCTGCATGG - Intergenic
957544920 3:81624801-81624823 TCTTTTCCATTCTTTCTGCAGGG - Intronic
958180663 3:90056140-90056162 TCACTGCCATATTTTCTTCTTGG + Intergenic
958605174 3:96349619-96349641 ACTCTTCCATATCTTCTGCAGGG - Intergenic
959076610 3:101755720-101755742 TCACTGCAACAGTTCCTGCAGGG + Intronic
961115736 3:124328308-124328330 TCACTTACATACTTTATTCAAGG + Intronic
962114981 3:132495305-132495327 ACATGCCCATAGTTTCTGCATGG + Intronic
965699868 3:171449715-171449737 TCATTGCAATGGTTTCTGCATGG - Intronic
965968580 3:174526560-174526582 TCACTTTCATAATTTTTCCATGG + Intronic
969169669 4:5349799-5349821 TCAGTTCCAGAATTTCTGCTTGG - Intronic
969275402 4:6131758-6131780 TTGCTTGCATGGTTTCTGCAGGG - Intronic
971939350 4:33194389-33194411 TCACTTCTATAGTTTTAGAAAGG - Intergenic
972073282 4:35051388-35051410 TCACTTAAATACTGTCTGCATGG + Intergenic
972905405 4:43740364-43740386 TCACTTCCTTAATATTTGCATGG + Intergenic
975844686 4:78512606-78512628 TCACTTCTTTTGTTTCTCCAGGG - Intronic
976015055 4:80542651-80542673 TCCCTTCCAGAGTCTCTGCCTGG + Intronic
976378998 4:84378468-84378490 TCACTGCCATAGGCTCTGCTGGG - Intergenic
976889075 4:90022933-90022955 TCACTTGCATATTTTCTTAATGG - Intergenic
977072560 4:92409775-92409797 TCTCTCCCAGAATTTCTGCAGGG - Intronic
977585260 4:98769183-98769205 TCACTGTCATACTTTTTGCAAGG - Intergenic
978344372 4:107751754-107751776 TCATATCTATAGTTTCTTCAGGG - Intergenic
978422511 4:108547702-108547724 TCACTTCCAGAATTTCTGTTTGG - Intergenic
978961815 4:114688767-114688789 TCACTGACATGGTTTCTTCATGG - Intergenic
979085448 4:116404542-116404564 TAAATTACATAGTTTCTGAAGGG - Intergenic
979220888 4:118222946-118222968 TCACTTGAATAATATCTGCATGG - Intronic
979388487 4:120098846-120098868 TCAGTTCTATAGTTTGTGTATGG + Intergenic
979885842 4:126026247-126026269 TCACTTCCAGAGTTTCTGAATGG + Intergenic
980205199 4:129710005-129710027 TCACATCCTTAGATTCTACATGG - Intergenic
980484722 4:133440715-133440737 TGACTTCTGTAGTTTCTCCAGGG + Intergenic
980812584 4:137901869-137901891 TCACTTACGTTGTTCCTGCAGGG + Intergenic
980959515 4:139461161-139461183 TCACTACCATAGTTTAGGAATGG - Intronic
981137826 4:141232649-141232671 TCACTTCCTTAGTATCTTAAGGG - Intronic
982596544 4:157392837-157392859 TAATTCCCATACTTTCTGCATGG + Intergenic
983100362 4:163618444-163618466 TAACTTCCAGAGTTTCTGAAAGG + Intronic
983155585 4:164343367-164343389 TCAGTTAAAGAGTTTCTGCAGGG + Intronic
984264652 4:177483272-177483294 TCATTTCCATATTTTCTATAGGG + Intergenic
984323919 4:178227584-178227606 TCAAATCCATTGTTTCTGCCAGG - Intergenic
984351588 4:178601212-178601234 TCACTTTAATAGTTTTTGCAAGG + Intergenic
986489837 5:8278070-8278092 TCACCTCAATTGTTTCTTCACGG - Intergenic
988193896 5:27975884-27975906 TCTCTCCCATAGATTCTGGAGGG - Intergenic
990783531 5:59394282-59394304 TCACTGTCATAGTTTGTGAAAGG + Intronic
993342101 5:86737784-86737806 TCACTTCCAGAATTTCTGTTTGG + Intergenic
993541806 5:89160982-89161004 TCACTTGTAGGGTTTCTGCAGGG - Intergenic
994952164 5:106477519-106477541 TCACTACCACAGTTTATGCATGG - Intergenic
996561893 5:124839216-124839238 TCATTTCCATCATTTCTTCAAGG + Intergenic
996744181 5:126831861-126831883 TACCTTCCATATTTCCTGCAGGG - Intronic
996810608 5:127512753-127512775 CCTCTTCCATATCTTCTGCAGGG + Intergenic
997436491 5:133879522-133879544 TCACGTTCTGAGTTTCTGCATGG + Intergenic
998953115 5:147411812-147411834 TCACTTCAATAGCTACTGCCTGG + Intronic
999441619 5:151605708-151605730 TCACTACCAGAGCTTCTGCTGGG + Intergenic
1002434539 5:179222567-179222589 TGATTTCTATAGTTTCTGCCCGG - Intronic
1002862964 6:1096117-1096139 TCTCCTCCACAGATTCTGCAGGG - Intergenic
1003143959 6:3494123-3494145 TTTCTTCCATAGTTTCAGGAGGG - Intergenic
1003230533 6:4248607-4248629 TCACTTCCATGGTTGCTACAAGG + Intergenic
1003997127 6:11553155-11553177 TCACATACATGGGTTCTGCAGGG - Intronic
1005266799 6:24120637-24120659 TCACTTTCATAGTTGCTAGATGG - Intergenic
1005922992 6:30417379-30417401 TCTCATCCATATTATCTGCAAGG - Intergenic
1007415359 6:41688328-41688350 TCAATTCTAGAGTTTCTGGACGG + Intronic
1008501869 6:52191342-52191364 TCACTTCCAAAAGTTCTCCAAGG + Intergenic
1008981589 6:57489748-57489770 TTACTTCTGTAGTTTCTCCATGG - Intronic
1009169658 6:60382579-60382601 TTACTTCTGTAGTTTCTCCATGG - Intergenic
1011724006 6:90189851-90189873 TCACTGCCATAGTCTCTGTTTGG - Intronic
1012009658 6:93767185-93767207 TCAGCTCCATAATTTCTTCAGGG - Intergenic
1014026377 6:116651354-116651376 TCACTTCCATTGTTTTTAAATGG - Intronic
1014945129 6:127488211-127488233 CCACTTCCATAGTCTCTTCAGGG + Intronic
1015310216 6:131758656-131758678 TCCCTCCCATATTTTCTGCAGGG + Intergenic
1017669821 6:156759679-156759701 TAACTTCTAAAGTTTCTGTAGGG + Intergenic
1019083994 6:169457048-169457070 CCTCTTCCCTAGGTTCTGCATGG - Intergenic
1019353629 7:567738-567760 TCACTTGCATAGTGTCCTCAAGG - Intronic
1020724038 7:11786411-11786433 CCACTTCCACATTTTCTGCCTGG + Intronic
1021880780 7:25093528-25093550 TGACCTCTTTAGTTTCTGCATGG + Intergenic
1022039421 7:26566027-26566049 TCACTTACATAGTTGCTGGCGGG + Intergenic
1022434811 7:30372721-30372743 TCAATTCCATAGTTTCTTGATGG - Intronic
1023673797 7:42608236-42608258 TCAATTCCATAGTATTTGGATGG + Intergenic
1027607052 7:80313466-80313488 TAACTTCAATAGTCCCTGCAGGG - Intergenic
1028005760 7:85565090-85565112 TCAGTTGCAAAGTTTCTCCAAGG - Intergenic
1028970750 7:96856386-96856408 TTGCTTGCATAGTTTCTGAAGGG - Intergenic
1030973141 7:116086900-116086922 TCACATCCATAGTTCCAGTAGGG - Intronic
1031009392 7:116509763-116509785 TCACCTCCTTGGGTTCTGCAGGG + Intergenic
1032099238 7:128959489-128959511 TCATTTCCAAAGTCTCTGCTGGG - Intronic
1033289654 7:140072485-140072507 TCACATTCATAGGTTCTGGATGG - Intergenic
1036069905 8:5429846-5429868 TCATATCCATTGATTCTGCAGGG - Intergenic
1036701877 8:11018395-11018417 TCCCTTCCTGAGTTTGTGCAGGG - Intronic
1037832946 8:22199754-22199776 TCACCCCCACATTTTCTGCAGGG + Intronic
1038988283 8:32837325-32837347 TTACTTGCATAGGTCCTGCAAGG + Intergenic
1039195591 8:35027834-35027856 TCACTTACATAGTTGCTGTGAGG + Intergenic
1042296951 8:67230086-67230108 TCACTGCCATAGTCTCTGAGGGG + Intronic
1044289701 8:90453394-90453416 TCACTCCACTAGTTCCTGCAGGG + Intergenic
1045018012 8:98015574-98015596 TCACTTCCTGTCTTTCTGCAGGG + Intronic
1045339507 8:101240458-101240480 TCACTTCTATACTGTCTGAATGG - Intergenic
1046039541 8:108885698-108885720 TGACTACCATATTTTCAGCATGG - Intergenic
1046250313 8:111622994-111623016 TCAGTTCCATAGTTTTTGGATGG + Intergenic
1046357507 8:113107509-113107531 TCATTTCCATGGGTTCTGCAGGG - Intronic
1054736154 9:68752366-68752388 TCACTTACATAGTTAGTGCAAGG + Intronic
1056170144 9:83977757-83977779 CCTCTTCCATATCTTCTGCAGGG + Exonic
1056338997 9:85604801-85604823 TCAGTGCCATAATTTCTGCTTGG - Intronic
1057163300 9:92906584-92906606 TCATTTCCATACTTTCTAGATGG + Intergenic
1058128341 9:101222132-101222154 TCAATTCCCAAGTTGCTGCAGGG - Intronic
1059363407 9:113766138-113766160 TAACTTACAGAGTTTCTTCATGG + Intergenic
1059656257 9:116360320-116360342 TCACTCCCAGAGGTTCTGTAGGG - Intronic
1059684752 9:116624351-116624373 TCCCTTTCTTAGTTTCTGGAAGG - Intronic
1060098970 9:120820808-120820830 TCACTTCCATAGGTCCTTCTGGG - Intronic
1189513195 X:41684244-41684266 TAACTTCGCTAGTTTCTGCTGGG - Intronic
1189963218 X:46344737-46344759 TCACTCCCTTGGTGTCTGCAGGG + Intergenic
1198083176 X:133258781-133258803 TCACTTACATAATGTCTTCAGGG - Intergenic
1200847533 Y:7846904-7846926 TCACTTTCATAATTTCTGAGGGG + Intergenic
1202269531 Y:23057571-23057593 TCACTTTCATAATTTCTGAGGGG - Intergenic
1202422525 Y:24691317-24691339 TCACTTTCATAATTTCTGAGGGG - Intergenic
1202448264 Y:24978769-24978791 TCACTTTCATAATTTCTGAGGGG + Intergenic