ID: 1103586439

View in Genome Browser
Species Human (GRCh38)
Location 12:121959710-121959732
Sequence TTGGCTTTCCACAGACAGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103586439 Original CRISPR TTGGCTTTCCACAGACAGCG AGG Intronic
900344970 1:2206135-2206157 CTGCCTTTCCACAGACAGGTGGG - Intronic
901218018 1:7565503-7565525 TGGGCTTTCCGCAGAGAGCCTGG + Intronic
901783960 1:11612316-11612338 TTGGCTTCACACAAACAGGGTGG - Intergenic
902725078 1:18330103-18330125 AAGGCTTTCCACAGATAGCAGGG - Intronic
903953729 1:27011269-27011291 TTGGCTTCCCACAGAGGGGGAGG - Intronic
904750238 1:32737353-32737375 TGGGCTTTCCCCAAACAGAGGGG + Intergenic
910862849 1:91759649-91759671 CTGGCTTTCCATACAGAGCGGGG + Intronic
914694749 1:150067207-150067229 TTGGTTTTCCCAAGACAGAGGGG - Intergenic
917843785 1:179003673-179003695 TTGGCTTTTCACACACTGAGTGG - Intergenic
918630353 1:186710022-186710044 TTGGATTTCCAGAGATAGCAAGG - Intergenic
1067561862 10:47310065-47310087 TTGGCCTGCCACAGGCCGCGCGG - Exonic
1072064912 10:91858488-91858510 TTCCCTTTCCACAGACAGACAGG - Intronic
1077387438 11:2276880-2276902 GTGGCATGCCACAGGCAGCGGGG - Intergenic
1079246263 11:18754442-18754464 TTGGCTTTCTACAGGGAGAGGGG + Intronic
1084104010 11:66968940-66968962 ATGGCCTACCACAGACACCGAGG - Intergenic
1086462333 11:87018242-87018264 TTGGCCTTCCACTGTCAGCCAGG - Intergenic
1087148627 11:94837495-94837517 TTTGCTTTCCAAAGTCAGTGAGG - Intronic
1089847358 11:121468754-121468776 TTTGCTTTCCACAGAGTGGGTGG + Intronic
1090254025 11:125270656-125270678 TTGGCTTTCCAAACAAAGAGTGG - Intronic
1091448590 12:558975-558997 TTCCCTTTCCACAGGCAGGGAGG - Intronic
1093538246 12:20248323-20248345 TTCCCTTTTCACAGACAGAGGGG - Intergenic
1098142867 12:67468964-67468986 TTCCCTTTCCACAGGCAGAGGGG + Intergenic
1099087613 12:78264673-78264695 CTGTCTTTCCACAGATAGCCTGG + Intergenic
1099601787 12:84748907-84748929 TTGGCAATCCAGAGCCAGCGTGG + Intergenic
1101409198 12:104455384-104455406 TTGGCTTTACAGAGCCAGGGAGG - Intronic
1102919866 12:116783732-116783754 TTGGCTCTCCACAGCCAGCCAGG + Intronic
1103586439 12:121959710-121959732 TTGGCTTTCCACAGACAGCGAGG + Intronic
1105538888 13:21297604-21297626 TTGGCTTTTAAAAGACAGTGGGG + Intergenic
1106514842 13:30444543-30444565 TTGCCCTGCCACACACAGCGGGG - Intergenic
1114491385 14:23104404-23104426 CTGGGTCTCCCCAGACAGCGTGG + Intergenic
1115583254 14:34783886-34783908 GTAGCTTTCCACAGAGAGCATGG + Exonic
1115894180 14:38065671-38065693 ATGGCTGTCCATAGACAGAGCGG - Intergenic
1118640312 14:67786014-67786036 TTTGCTTTCCATAGAGAGTGTGG - Exonic
1120643420 14:87043212-87043234 TTGGCTTTCCACAGTGTGAGAGG - Intergenic
1121339598 14:93097378-93097400 TTGGCTTTCCTCAGGCTGCTGGG - Intronic
1124620701 15:31272367-31272389 TGGGCTTTCCACACAGAGCCTGG + Intergenic
1125312741 15:38398342-38398364 TTAACCTTCCACAGACAGCTTGG + Intergenic
1125432226 15:39607089-39607111 TTAGCTTCCCACGGACAGTGTGG - Intronic
1131292037 15:91114838-91114860 TGGGCTTTTGACAGACAGAGTGG - Intronic
1138973152 16:62170747-62170769 TTGGGTTTCCAAAGTCAGAGTGG + Intergenic
1140041346 16:71410317-71410339 TTGGCTTCCCACAAACACCTGGG - Intergenic
1141598940 16:85113773-85113795 CTGGGGTTCCACAGTCAGCGTGG + Intergenic
1141855177 16:86676419-86676441 TTGGCTTTTCCCAGACAAGGTGG + Intergenic
1146661583 17:34668378-34668400 TTGGCCTTGCACAGAGAGCTGGG - Intergenic
1152029632 17:77834102-77834124 CTGGGATTCCCCAGACAGCGAGG - Intergenic
1152266048 17:79295513-79295535 GGGGCTTCCCACAGACAGCCTGG + Intronic
1160909047 19:1466438-1466460 CTTGCTGGCCACAGACAGCGGGG - Exonic
1161023553 19:2023686-2023708 ATGGCTTTTCACACACAGTGAGG - Intronic
1164612244 19:29640411-29640433 TGGGCTGTCCACAGGCACCGTGG + Intergenic
1165059860 19:33199866-33199888 CTGGCTTTTCCCAGAAAGCGTGG + Intronic
925852786 2:8099098-8099120 CAGGGTTTCCACAGACAGCCAGG + Intergenic
926688810 2:15718597-15718619 TTGGCTTTGTCCAGACAGGGTGG - Intronic
930335614 2:50041621-50041643 GTGGCTCACCACAGACAGCAAGG + Intronic
931164452 2:59731817-59731839 TTTGTTTTCCACAGAAAGGGTGG - Intergenic
931442172 2:62297815-62297837 GTGGCATTCCAGAGAGAGCGTGG + Intergenic
935607191 2:104982998-104983020 TTGGCTTCTCACAGACACCTTGG + Intergenic
936859436 2:116999242-116999264 TTGGTTTTCCACAGGCAGATAGG - Intergenic
937284920 2:120744316-120744338 CTTGATCTCCACAGACAGCGAGG - Intronic
937292524 2:120790319-120790341 TTGGCTTCCCACAGACAGTGAGG - Intronic
937512554 2:122612165-122612187 TTATCTTTCCACAGGCAGAGGGG - Intergenic
938981926 2:136535122-136535144 TTGTCTTTCCACAGAGAACTAGG + Intergenic
943424329 2:187711097-187711119 CTGCCTTTCCACAAACAGTGGGG + Intergenic
945560934 2:211339025-211339047 ATGGCTTTCCAAACACAGCAAGG + Intergenic
946164620 2:217856425-217856447 TTCCCTTCCCACAGACAGCTGGG + Intronic
948348745 2:237321133-237321155 TTGGCTTTCTACAAAAAGCCTGG + Intergenic
948869337 2:240790411-240790433 TTGGTTTTCCTCAGCCAGCGTGG + Intronic
1172765898 20:37350563-37350585 TTGGCTTTGGACAAACAGCAGGG - Intronic
1175337357 20:58205283-58205305 TTGGCTTCCCACCTACAGCCAGG + Intergenic
1177926734 21:27226314-27226336 TGGGATTTCCACAGACACCTGGG - Intergenic
1181463233 22:23097455-23097477 TTGGCTTTCCTCAGGCAGCTGGG + Intronic
1181978407 22:26749013-26749035 TTGGCTTTCCCCAGGAAGGGTGG - Intergenic
1182253090 22:29017472-29017494 TCAACTTTCCACAGACAGCCTGG - Intronic
1183147826 22:36010884-36010906 GGGGCTTTCCACAGACAGAGGGG + Intronic
1183354425 22:37350739-37350761 GTGGCTGCCCACAGCCAGCGTGG - Intergenic
1183388134 22:37526735-37526757 TTGGGTTTCCACAGCCACAGAGG - Intergenic
1183748823 22:39707574-39707596 CTGGCTTTCCACACTCAGCGAGG + Intergenic
1185045839 22:48528370-48528392 TTGGCTATACACAGGCATCGGGG - Intronic
949858104 3:8480665-8480687 CTGGCTTTCCACAGAGAGTGAGG + Intergenic
952855224 3:37764684-37764706 GTAGCTTTCCACAGCCAGAGGGG - Intronic
961114021 3:124313429-124313451 TTGTATCTCCACAGACAGCCTGG + Intronic
974950773 4:68581313-68581335 TTGGGTTTCTACAGCCAGCTTGG - Intronic
986394906 5:7319458-7319480 TTGGCTTTCTACATACAGAATGG + Intergenic
986673283 5:10162126-10162148 CTGCCTTTCCACAGCCAGTGGGG + Intergenic
986917898 5:12646722-12646744 TTGTGTTTCTACAGACAGCCAGG - Intergenic
988819397 5:34866079-34866101 TTATCTTTCCAGAGACAGCAAGG - Intronic
991468305 5:66938547-66938569 TGGGTTTTCAACAGACAGCCTGG - Intronic
997939858 5:138147387-138147409 TTACCTTTCCACAGACAACTGGG + Intronic
998078176 5:139253256-139253278 GTGGCTTGCCAGAGACAGCAAGG - Intronic
999951384 5:156654677-156654699 CTGCCTTTTCACAGACAGCAGGG - Intronic
1001615964 5:173043949-173043971 TTGGCTTTATACACACAGAGAGG + Intergenic
1001804711 5:174573569-174573591 TTGGCTGGCCCCAGACAGCCAGG + Intergenic
1001917499 5:175574046-175574068 TTGTCGTCCCACAGACACCGGGG + Intergenic
1007397325 6:41585295-41585317 CTGGCTTTCCCCAGTCAGCCTGG - Intronic
1011981007 6:93377964-93377986 TTGGCTTTCTACAAACTGAGAGG - Intronic
1012278379 6:97300204-97300226 TTGGCTTCCCACACACAACATGG - Intergenic
1016678949 6:146805618-146805640 TTGCCTTTCCACTAACAGCAAGG + Intronic
1032230460 7:130069800-130069822 TTGGCATTCCACACACTGCCAGG + Intergenic
1033115961 7:138625780-138625802 TTGGCTTTCAATAGACTGAGTGG + Intronic
1037272919 8:17149532-17149554 GTGGGTTTCCACAGACCACGGGG + Intergenic
1049445478 8:142628635-142628657 TGGGCTTGCCCCAGACAGAGAGG + Intergenic
1049879833 8:145054086-145054108 TTGGCTCTCCATATAGAGCGAGG - Exonic
1053412072 9:37922439-37922461 TTGGCTGCCGACAGATAGCGAGG + Intronic
1055170441 9:73251856-73251878 GTGGGTTTCCACAGAAAGGGAGG + Intergenic
1056567278 9:87785284-87785306 TTGACTTTACACAGACATCTCGG + Intergenic
1056762437 9:89425019-89425041 TTGGTGTTCCACAGAAAGAGGGG - Intronic
1057829226 9:98394247-98394269 TTTGCTCCCCACAGACAGCAGGG - Exonic
1057848005 9:98540226-98540248 TTGGATACCCACAGACAGTGGGG + Intronic
1059408687 9:114118416-114118438 TTGACTTTCCCCAAACAGGGAGG - Intergenic
1060186661 9:121567933-121567955 TTGGTTGTCCAGAGACAGCCAGG - Intronic
1060528344 9:124333054-124333076 AGGGGTCTCCACAGACAGCGGGG - Intronic
1060600919 9:124876799-124876821 CTGGCTTGCCAGAGACAGGGGGG - Intronic
1187097100 X:16160767-16160789 TTAGCGTTCCAGAGACAGTGAGG + Intergenic
1187887624 X:23904455-23904477 TTGGGTTTCCACAGTCAGGTTGG - Intronic
1198327095 X:135584773-135584795 TTGGCTTTCCAAAGAAACCCTGG - Intergenic