ID: 1103587706

View in Genome Browser
Species Human (GRCh38)
Location 12:121968428-121968450
Sequence GTGTGGATATGTGGAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 293}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103587706_1103587710 -5 Left 1103587706 12:121968428-121968450 CCCTCTGCTCCACATATCCACAC 0: 1
1: 0
2: 1
3: 21
4: 293
Right 1103587710 12:121968446-121968468 CACACCTGCTAGAAAGATCTAGG 0: 1
1: 0
2: 0
3: 9
4: 123
1103587706_1103587713 21 Left 1103587706 12:121968428-121968450 CCCTCTGCTCCACATATCCACAC 0: 1
1: 0
2: 1
3: 21
4: 293
Right 1103587713 12:121968472-121968494 ACCCTCCAAAGCATATACTACGG 0: 1
1: 0
2: 0
3: 6
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103587706 Original CRISPR GTGTGGATATGTGGAGCAGA GGG (reversed) Intronic
900511077 1:3061503-3061525 TTGTGGATGAGTGGAGCAGGTGG + Intergenic
900670637 1:3852049-3852071 ATGTGCAAATGTGGAGGAGAAGG - Intronic
900718760 1:4161610-4161632 GTGTGGTTCTGTGTTGCAGACGG - Intergenic
900964160 1:5945926-5945948 GTGTGGATATGCGGGACGGAGGG - Intronic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
902236348 1:15060003-15060025 GTGTGGAGCTGTGGAGTAGGGGG + Intronic
903651711 1:24926692-24926714 CTGTGGAGTTGGGGAGCAGAGGG + Intronic
905821912 1:40999222-40999244 GCTTGGAGATGTGGAGCAGTTGG + Intronic
908952707 1:69581049-69581071 GACTGGATATGGGGAGCACAGGG + Intronic
909517922 1:76533317-76533339 TTGTGGGAATGAGGAGCAGATGG - Intronic
910758088 1:90712112-90712134 GTGGGGAGATGGAGAGCAGAGGG + Exonic
912255402 1:108053269-108053291 GTGTGGGTATGTGAAAGAGAAGG + Intergenic
912467678 1:109885272-109885294 ATGTGGACAGGTGGAGAAGAAGG + Intergenic
912556699 1:110521435-110521457 GGGTTTATGTGTGGAGCAGAGGG - Intergenic
913929937 1:124944654-124944676 TTGTGGATATTTGGAGCTGTTGG - Intergenic
913930267 1:124951632-124951654 TTGTGGATATTTGGAGCTGTTGG - Intergenic
914978682 1:152392429-152392451 GTGGGAAGATGTGGTGCAGATGG + Intergenic
916742403 1:167657661-167657683 GTTTTGATATGCTGAGCAGATGG + Intronic
917119041 1:171629722-171629744 GTGTGGACATTTGGGACAGAGGG + Intergenic
917245398 1:172995641-172995663 GTGTGGATGTGTTGAGGAGAAGG - Intergenic
917315483 1:173720390-173720412 GTGAGTATATGTGGAGTATAGGG + Intronic
917857774 1:179115549-179115571 GTGTGGATATGTTGAGTAAAAGG - Intronic
919413610 1:197278267-197278289 GTGAGGACATATGGAGAAGATGG + Intronic
921134400 1:212247348-212247370 GTGTGGAGGTGAGGAGCGGAGGG - Intergenic
923892583 1:238232528-238232550 GTATGAATATCTGAAGCAGATGG - Intergenic
924437130 1:244051288-244051310 GTGCGGATCTGTGGTGGAGAAGG + Exonic
1067161232 10:43826390-43826412 GTGTGGAGCTCTGGGGCAGAAGG - Intergenic
1067205584 10:44209281-44209303 GTCAGGAAATGTGGAGCAGGTGG - Intergenic
1067434529 10:46267464-46267486 GTGTGGATGTGTGGCCCACATGG - Intergenic
1069117086 10:64520898-64520920 GTGTGTGTGTGTGGAACAGAGGG + Intergenic
1069985584 10:72280724-72280746 CTGTGGCTATGTGGAGCTGGCGG + Intergenic
1072033030 10:91539292-91539314 GTGGGGGGATGTGAAGCAGATGG + Intergenic
1073062146 10:100739392-100739414 GTGTGGATGTGAGGAGCAGGCGG - Intronic
1073215497 10:101833971-101833993 GTGTGGAGATGAGGAGGTGAGGG - Intronic
1074032839 10:109705698-109705720 GTTTGGCTATGAGGAGGAGAGGG + Intergenic
1074227330 10:111497563-111497585 GGATGGATAGGTGGAGCATAGGG + Intergenic
1075465524 10:122647730-122647752 GTGTGGAGATGTGGTGTGGATGG - Intergenic
1075743916 10:124713079-124713101 GTGTGGCTGTGTGGGGCACATGG - Intronic
1075826730 10:125363399-125363421 GTTGGGATTTATGGAGCAGAAGG - Intergenic
1076627804 10:131832548-131832570 GCGTGGAGGTGTGGAGAAGATGG + Intergenic
1076751359 10:132545116-132545138 GTGTGGAGTTGTGGGGCAGGTGG + Intronic
1076843491 10:133057876-133057898 GTGAGGATATGTGCAGGTGAGGG + Intergenic
1076917384 10:133431097-133431119 GTGTGGATATGTGCAGGTGGTGG + Intergenic
1076937479 10:133575856-133575878 GTGTGGATATGTGCAGGTGGTGG + Intergenic
1077799644 11:5525095-5525117 GTATGGAAAGGTGGAGAAGAGGG + Intronic
1077928031 11:6701759-6701781 GTGTATATATGTGCACCAGAAGG + Intergenic
1078913551 11:15756342-15756364 GTATACATATGTGGAGGAGAGGG - Intergenic
1079261979 11:18891268-18891290 ATGTGGAAAGGTGGATCAGAAGG + Intergenic
1080448508 11:32359101-32359123 GTGGGGAGATGTGGAGGGGAGGG - Intergenic
1085445461 11:76598059-76598081 GTGTGGACACGTGGACCAGCTGG + Intergenic
1086571357 11:88288157-88288179 TTGTGAAAATGTGGAGAAGAGGG - Intergenic
1087418796 11:97893771-97893793 TTCTGGACATGTGCAGCAGATGG - Intergenic
1087617725 11:100507411-100507433 GTGTGTGTATGTGGAGAAGGGGG - Intergenic
1088245537 11:107814516-107814538 GAATGAATAGGTGGAGCAGAGGG + Intronic
1089038640 11:115424192-115424214 ATGTGTTTATGTGTAGCAGATGG - Intronic
1091423889 12:368934-368956 GTGTGGACAAATGGAGGAGAGGG + Intronic
1092031650 12:5291230-5291252 GGGCGGATATGTGGGGCAGTGGG + Intergenic
1092188417 12:6499075-6499097 GTGTGGATATGTTGGACAAAGGG + Intronic
1095061569 12:37699163-37699185 AAGTGGATATTTGGAGCACATGG - Intergenic
1096403980 12:51329479-51329501 CTGTGGGTATGTGGAGGGGAGGG + Intronic
1096538535 12:52290297-52290319 GTGTGGGAAGGTGGGGCAGATGG + Intronic
1096540244 12:52303067-52303089 GTGTGGGAAGGTGGGGCAGATGG - Intronic
1097081150 12:56432026-56432048 CTGTGGATATGCTGGGCAGAGGG + Intronic
1102337687 12:112095833-112095855 GGATGGATAGGTGGAGCACAGGG + Intronic
1103587706 12:121968428-121968450 GTGTGGATATGTGGAGCAGAGGG - Intronic
1103993265 12:124813264-124813286 GTGGGGCTTTGGGGAGCAGATGG - Intronic
1105840635 13:24251201-24251223 GTAAGGATTTGTGGAGCTGAAGG - Intronic
1106578482 13:30998039-30998061 GTATGGATATAAGGAGCAGGAGG + Intergenic
1106884270 13:34166658-34166680 CTGTGGGTATGTGGAAAAGAAGG + Intergenic
1108694502 13:52891074-52891096 ATGTTGATATGTTTAGCAGAAGG + Intergenic
1109802515 13:67398669-67398691 GTGTGGATATCTGGTGGAGGTGG - Intergenic
1110540886 13:76705548-76705570 GTGTGAATGGGTGGAGGAGAGGG - Intergenic
1111035299 13:82664466-82664488 CTGTGGATATGTGTAGTGGAAGG + Intergenic
1112334079 13:98499590-98499612 GTGTGGATCTGAGAAGGAGAGGG + Intronic
1114567835 14:23645477-23645499 GTGTGGGTCTGGGGAGCTGAAGG + Exonic
1114782526 14:25554375-25554397 GTGTGCATATGTGGGGCAGGAGG - Intergenic
1115003508 14:28451202-28451224 TGGTGGATATGTGGAGAAAAGGG - Intergenic
1115486752 14:33917787-33917809 GTGTGGACAAGGGGAGCAGTAGG - Intergenic
1116551692 14:46247813-46247835 TTGTGGATATCTGCAGCAGATGG + Intergenic
1116654966 14:47640728-47640750 GTGAGGATATTTTGTGCAGAGGG - Intronic
1117265127 14:54078744-54078766 GAGTGGATATGTGTAGCACAAGG - Intergenic
1118676952 14:68196459-68196481 GTGTGAAGATGTGGAGAAGTAGG - Intronic
1121167848 14:91824532-91824554 GTGTGGATTTTGGGAGCAGAAGG - Intronic
1121958950 14:98240773-98240795 GTGTGTATATGTGGGGAAGGAGG + Intergenic
1122159909 14:99775421-99775443 CTGGGGAAATGTGGAGCAGTGGG + Intronic
1122575176 14:102737500-102737522 GGGTGGAAAGGTGGAGGAGACGG - Intergenic
1122808135 14:104271156-104271178 GGTTGGATAGGTGGAGCACAGGG - Intergenic
1123685525 15:22794593-22794615 CTGTGGAGATGTGGAGGGGAAGG + Intronic
1126904429 15:53349165-53349187 GGGTGGACATGAGCAGCAGAAGG + Intergenic
1127338351 15:58013449-58013471 GTTTGGATTTGGGGATCAGATGG - Intronic
1127872686 15:63086628-63086650 GTGGGGATATGAGGTGCAGGGGG - Intergenic
1129626659 15:77207684-77207706 GAATGAATAGGTGGAGCAGAGGG + Intronic
1130939248 15:88494105-88494127 GTTTGGATCTGTGGCTCAGATGG + Intergenic
1131107691 15:89745876-89745898 GTGTGGATGTGTGGAGGTGTTGG - Intergenic
1131107705 15:89745946-89745968 GTGTGGATGTGTGGAGGTGTTGG - Intergenic
1132857110 16:2050979-2051001 GCGTGGAAATGGGGAGCAAAGGG + Intronic
1134001148 16:10783942-10783964 GGATGCATAGGTGGAGCAGAGGG + Intronic
1139722764 16:68870249-68870271 GGCTGGATATGTGGGGAAGAAGG + Intronic
1140245290 16:73242839-73242861 GTGTGGAGGTGTGGGGTAGAGGG + Intergenic
1140621967 16:76746047-76746069 GTGTGTATATGTGGGGGTGAGGG + Intergenic
1147582127 17:41633288-41633310 GTGTGTATATGTGTTGGAGAGGG + Intergenic
1150462420 17:65363890-65363912 GGGTGAATAGGTGGAGCACAGGG - Intergenic
1151884601 17:76916158-76916180 GTGCAGCTATGTGGAGCATAAGG - Intronic
1152184326 17:78844631-78844653 GGGTGGATATTTGGGGGAGATGG - Intergenic
1152235958 17:79138945-79138967 GTGTGCATGTGTGGGGCTGAGGG - Intronic
1153135239 18:1910518-1910540 GTGTGTATGTGTGTTGCAGAGGG - Intergenic
1153770934 18:8416050-8416072 GGATGGATATGGGGAGGAGATGG - Intergenic
1155750606 18:29418318-29418340 TAGTGGATATGAGGAGCAAAGGG + Intergenic
1156490352 18:37492267-37492289 GAGTGGAGATTTGGGGCAGAGGG - Intronic
1157637615 18:49175763-49175785 GTGTTGAAATATGGAGCAGTAGG - Intronic
1157785831 18:50481807-50481829 GTGTGGATATTTAGAGGAAAAGG + Intergenic
1158291743 18:55951879-55951901 GTGTGGATATCTGGTGGAGGTGG - Intergenic
1158875714 18:61732941-61732963 GTGGGGTTATGAGGAGCAGGAGG - Intergenic
1159262164 18:66028204-66028226 GGGTGAATATGTGAAGCAGAGGG + Intergenic
1159366402 18:67470939-67470961 GTGTGAATATGTGGGGATGAGGG + Intergenic
1159754289 18:72344847-72344869 GGCTGAATATATGGAGCAGAGGG - Intergenic
1160146892 18:76372251-76372273 GTGTGGCTTTTTGGATCAGAAGG - Intronic
1160437266 18:78861258-78861280 TTGTGGGTACTTGGAGCAGAAGG - Intergenic
1161116409 19:2499309-2499331 GTGCAGACATCTGGAGCAGAGGG - Intergenic
1161390099 19:4016229-4016251 GTCAGGAAATGTGGGGCAGAAGG + Intronic
1161614572 19:5262887-5262909 GTGAGGAGAAGGGGAGCAGAAGG + Intronic
1161834761 19:6638279-6638301 GAGTGGAGATCTGGATCAGAAGG + Intergenic
1165251589 19:34541007-34541029 GTGTGTGTATGTGGTGCACAGGG - Intergenic
1167643476 19:50694405-50694427 GTGGGGATGTGGGGATCAGAGGG + Intronic
926404600 2:12538315-12538337 CTGAGGATATATAGAGCAGAAGG - Intergenic
930095521 2:47563213-47563235 GTGGGTATCTGAGGAGCAGAAGG - Intronic
930255736 2:49088178-49088200 GCGTGTGTATGTGGTGCAGAGGG + Intronic
931234612 2:60402697-60402719 GTGTGTGTATGTGGAGCAGGGGG - Intergenic
931247463 2:60503467-60503489 CTGTGAATAGGTGGAGGAGAGGG - Intronic
931391415 2:61847234-61847256 ATGTGGATATCTGGAGGAAAAGG - Intronic
933377790 2:81502182-81502204 GTGTGGATAGGTGGAGCACGAGG + Intergenic
934753834 2:96811378-96811400 GTGGGGGTATGTGAAGCAAAAGG + Exonic
935913896 2:107927867-107927889 GTGAGGCTATGGGGAGAAGATGG - Intergenic
937028028 2:118715250-118715272 GGGTGCATATGCGGAGGAGAGGG - Intergenic
939246582 2:139632751-139632773 GTTGGGATATGAGTAGCAGACGG + Intergenic
940736109 2:157454147-157454169 GTGTGTGTGTGTGTAGCAGAAGG + Intronic
942616193 2:177794256-177794278 GTGTGGATATCAGGATGAGAGGG + Intronic
944086070 2:195849492-195849514 TTGTTGATATGAGGAACAGATGG + Intronic
944408924 2:199417368-199417390 CTGGGACTATGTGGAGCAGAAGG - Intronic
944580124 2:201125219-201125241 GTGTGGCTGTGTAGAGGAGATGG + Intronic
944594329 2:201247421-201247443 CTGGGGAAATGTGGAGCTGAGGG - Intronic
945396560 2:209325337-209325359 GTGTGGAAATGGGGAGAGGAGGG - Intergenic
945983875 2:216339306-216339328 GGGTGGAGATGAGGAGCAGAGGG - Intronic
946896140 2:224326383-224326405 TTTTTGATATGAGGAGCAGAAGG - Intergenic
948278851 2:236731039-236731061 GTTTGGATTTGTGGTGCACAGGG - Intergenic
948829093 2:240588917-240588939 GTGTGGATGTTTTGAGTAGACGG + Intronic
1168798690 20:629872-629894 GTGTGGTGATGTGAAGCACAAGG - Intergenic
1168943822 20:1735303-1735325 GGCTGGATAGGTGGAGCACAGGG + Intergenic
1169276566 20:4237088-4237110 GTCTGGAAATGTGGATCTGAAGG + Intronic
1171846926 20:30283072-30283094 GAGGGGAAATGTGGAGAAGAAGG - Intergenic
1171933904 20:31255521-31255543 GTGTGGCTATTTTGAGCAGGAGG - Intergenic
1172697961 20:36835369-36835391 CTGTGGTTTTATGGAGCAGAGGG - Intronic
1173922325 20:46755610-46755632 ATGTGGATACCTGGAGAAGATGG - Intergenic
1173946047 20:46951773-46951795 GTGTGGATTTCAGGATCAGATGG + Intronic
1174894704 20:54436256-54436278 TTGGGGATATGTGGAGTTGAAGG + Intergenic
1175426564 20:58871025-58871047 GTGTGTGTTTGTGGAGCAGGGGG - Intronic
1175529779 20:59666479-59666501 CTGTGGGCAGGTGGAGCAGAAGG + Intronic
1176217290 20:63954235-63954257 CTGTGGAAGTGGGGAGCAGAGGG - Intronic
1177004794 21:15658155-15658177 GTGTGGATATGTTGAGTAGCAGG - Intergenic
1177012687 21:15747685-15747707 GTGTGGATATGTTGGACAAAGGG + Intronic
1178027452 21:28484390-28484412 GTCTGTATATGTGTAGGAGAGGG - Intergenic
1178093337 21:29187735-29187757 GTGTGGCTATTTGCAGCTGATGG + Intergenic
1179314772 21:40233596-40233618 GTGTGTCCATGTGGAGGAGAAGG - Intronic
1179536729 21:42057673-42057695 GCCTGGAAATGTGGAGCAGCCGG + Intergenic
1179546040 21:42112813-42112835 CTCTGGATGTGTAGAGCAGATGG - Intronic
1181442025 22:22941669-22941691 GTGTGCACATGTGGGGCTGAGGG + Intergenic
1181916834 22:26288170-26288192 GTGTGGGTTTGTGCAGCAGATGG - Intronic
1182900666 22:33895624-33895646 GGGTGGCTTTGAGGAGCAGAGGG - Intronic
1183229843 22:36574923-36574945 GTGTGCAGATGTGGAGCACAGGG + Intronic
1184789827 22:46693225-46693247 GTGTGGCTGTGTGGAGCAGTGGG - Intronic
950325648 3:12107229-12107251 GTCTGGATATCTGGAGGAAATGG - Intronic
950336068 3:12194319-12194341 GTGAGGATATGAGAAGCAGAAGG + Intergenic
951336690 3:21431627-21431649 GTATGGCCATGTGGAGCACAGGG + Intronic
952161788 3:30701112-30701134 GTGGGGATCTCTGGAGCAGAGGG - Intergenic
952263582 3:31764393-31764415 GGGTGGATAAATGGAGGAGAGGG + Intronic
952607310 3:35164608-35164630 GGGTGGATATTTTAAGCAGAAGG + Intergenic
952712440 3:36444825-36444847 GTATGGAGATGTGAAGTAGAAGG - Intronic
954303164 3:49711921-49711943 GTGTGGAAAAGTGGAGTACAAGG - Intronic
955264548 3:57428929-57428951 GTGAAGCTATGTGAAGCAGATGG - Intronic
956736730 3:72244208-72244230 GGGTGCTTATGTGGAGGAGAGGG - Intergenic
957405799 3:79774372-79774394 GTGTGGATATCTGGTGGAGATGG - Intergenic
957943175 3:87030928-87030950 GTCTGGCTATCTGAAGCAGAAGG + Intergenic
959787135 3:110313234-110313256 TTGCAGATATCTGGAGCAGAGGG - Intergenic
960532685 3:118782686-118782708 GTGTGGATGCTTGGGGCAGAGGG + Intergenic
961448224 3:126991047-126991069 GTGGGGAGAAGTGGGGCAGATGG - Intronic
962531523 3:136285276-136285298 ATGTGGATGTGTGTAGCAGGAGG - Intronic
963537624 3:146547641-146547663 GTGTGGAAAAGAGGTGCAGATGG + Intergenic
964152068 3:153538214-153538236 ATGTGGATAGATGTAGCAGATGG - Intergenic
964675751 3:159278049-159278071 GTGTGTGCATGTGTAGCAGAAGG + Intronic
964812903 3:160684720-160684742 GTGTGTACATGTGTAGCAGGAGG - Intergenic
967838978 3:193988934-193988956 GTGTGCATGTGTGGAGGAGAGGG + Intergenic
968062403 3:195735605-195735627 AAGTGGATATGTAGAGGAGAAGG - Intronic
968621205 4:1604203-1604225 GTGTGGATGGGTGGGGAAGAAGG + Intergenic
968704275 4:2070802-2070824 GTGAGTATATGGGGTGCAGATGG - Intergenic
968936848 4:3615669-3615691 GTGAGGACACGTGGAGAAGACGG - Intergenic
969184208 4:5463435-5463457 GTGTGGGTGTGTGCAGGAGAGGG - Intronic
969275854 4:6135335-6135357 GTGAGGACATGGGGAGAAGACGG + Intronic
970709670 4:18847170-18847192 GTGTGGCTAGATGGAGGAGAAGG - Intergenic
971931718 4:33092230-33092252 GTATTGTTATGTGGATCAGAGGG + Intergenic
972181476 4:36472150-36472172 GTGTGGGTGTGTGGAGGAAAGGG + Intergenic
973638857 4:52884306-52884328 GTGTGGATATGTACAGTAGTGGG + Intronic
974026736 4:56739432-56739454 GTGGGGTAATGGGGAGCAGATGG - Intergenic
975530478 4:75394892-75394914 GTGGGGACATGTGGGGGAGAAGG - Intergenic
976388542 4:84485793-84485815 GTGTGCAAAAGTGGAGTAGATGG + Intergenic
977193704 4:94032387-94032409 GTCTGGGTCTGTGGAGCTGATGG - Intergenic
979268415 4:118731323-118731345 GTGTTGATATGTGCAAAAGATGG + Exonic
980655976 4:135786916-135786938 GTGTGAATATGTGTACTAGAGGG + Intergenic
980967779 4:139539854-139539876 GTGAGGATATCAGGAGAAGATGG + Intronic
982271112 4:153589454-153589476 ATGTGGATATGCTGGGCAGAGGG + Intronic
984141549 4:176010384-176010406 GTATGGAGCTTTGGAGCAGAGGG + Intergenic
984439785 4:179752091-179752113 GTTTACATATGTGCAGCAGAAGG + Intergenic
985836298 5:2274632-2274654 ATATGGATTTGTAGAGCAGATGG - Intergenic
988973963 5:36496881-36496903 GTGTGGATGTCTGGAGCACCAGG - Intergenic
989150192 5:38291354-38291376 GTCTGGATTTGGGGAGGAGAAGG + Intronic
989897429 5:47109992-47110014 TTGTGGATATTTGGAGCTGTTGG + Intergenic
989898173 5:47123794-47123816 TTGTGGATATTTGGAGCTGTTGG + Intergenic
989899268 5:47144068-47144090 TTGTGGATATTTGGAGCTGTTGG + Intergenic
989899491 5:47148157-47148179 TTGTGGATATTTGGAGCTGTTGG + Intergenic
989899715 5:47152248-47152270 TTGTGGATATTTGGAGCTGTTGG + Intergenic
991606818 5:68410782-68410804 GTGTGGAGATATGGAGTATATGG - Intergenic
992414827 5:76542355-76542377 TTGTGGAAATGTGGACCACAAGG - Intronic
993008062 5:82449473-82449495 GTGTGGATGTGTGTATCAGTTGG + Intergenic
993339757 5:86709005-86709027 GTGTGGATAAGTGAGGTAGAGGG - Intergenic
996007478 5:118440317-118440339 GTTTGGTTATTTGGAGAAGAGGG - Intergenic
998979490 5:147685966-147685988 GTGAGGACAAGTGGAGCAAAGGG + Intronic
999481218 5:151949793-151949815 GGGGGGAAATGTGGAGCAGGAGG + Intergenic
1003006653 6:2389057-2389079 GTGTGCATATGTGGAGGTGTAGG - Intergenic
1003175361 6:3750030-3750052 GTGAGGCTCTGGGGAGCAGAGGG + Intronic
1005805282 6:29468538-29468560 GTGTGGATGTGGGGAGAGGAGGG + Intergenic
1006299474 6:33185952-33185974 GTGGGGAGAGGTGGAACAGAGGG + Intronic
1007249623 6:40486980-40487002 GTGAGGAAATGTGGTTCAGAGGG + Intronic
1008090390 6:47288072-47288094 GTGTATATATGTGCACCAGAAGG + Intronic
1008321932 6:50125011-50125033 GTGTGGCAATGTGGAGGAAAGGG - Intergenic
1012043905 6:94244704-94244726 GTGTGGGGATGGGGAGCAAATGG - Intergenic
1012172149 6:96030484-96030506 GAGTGAAAATGTGGAGCAGTTGG + Intronic
1012269580 6:97192129-97192151 CTGTGCATATGTGGAGGAGGGGG + Intronic
1012953688 6:105545659-105545681 GTGTGGATGAGGAGAGCAGAAGG - Intergenic
1015085210 6:129282555-129282577 GTGTGTATATGTTGAGCAAGGGG + Intronic
1015217992 6:130772246-130772268 GGATGAATAGGTGGAGCAGAGGG + Intergenic
1017479533 6:154837773-154837795 GTGGGGGTATGGGGAGTAGAGGG + Intronic
1019807960 7:3142555-3142577 GTTGGAGTATGTGGAGCAGAGGG + Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022557518 7:31313548-31313570 ATCTGGAAATGTGGAGTAGATGG - Intergenic
1022788995 7:33667990-33668012 GTGTGTGTGTGTGGAGCAGGGGG + Intergenic
1023877432 7:44294654-44294676 TTGGGGAGATGAGGAGCAGAGGG - Intronic
1024054448 7:45651014-45651036 GGGTAGAGATGTGGAGCTGAAGG - Intronic
1026281919 7:68929568-68929590 GGGAGGACATGGGGAGCAGAGGG + Intergenic
1027318378 7:76997980-76998002 GTGTGGGTATGTGGAGGTGTGGG + Intergenic
1027505501 7:79012885-79012907 GTGTGGATATAATGAGAAGATGG - Intronic
1029342318 7:99955274-99955296 GTGTGGAGATGCGGAGCGGCTGG - Intergenic
1029347369 7:99988146-99988168 GTGTGGAGATGTGGAGCAGCTGG - Intergenic
1029897507 7:104000060-104000082 GAGTGGATCTGGGGAGGAGAGGG - Intergenic
1030640564 7:112001378-112001400 GTGTGGATATGCTGAACAAAAGG - Intronic
1032022992 7:128420468-128420490 GTGTGGATACGCTGAGCAAAGGG - Intergenic
1033197387 7:139339592-139339614 GTGGAGATACCTGGAGCAGAGGG + Intronic
1033247131 7:139727050-139727072 GGGTGGAGATGTGGACCTGAAGG + Intronic
1033342906 7:140505889-140505911 GTGAGGATATGGGGAGAAGGTGG - Intergenic
1034982375 7:155487406-155487428 CTGTGGAAATGTGGACCATATGG + Intronic
1035823935 8:2624263-2624285 TTGTGGAGATGTGGAGAAAAGGG + Intergenic
1037683512 8:21118286-21118308 GTGTGGAAATTTGGGGCAGGAGG - Intergenic
1038033623 8:23666531-23666553 GTATGAATAGGTGGAGCACAGGG - Intergenic
1038224974 8:25647195-25647217 GTGTGGATCTGTAGAGGGGAGGG - Intergenic
1039641208 8:39225314-39225336 GTGGGTGTTTGTGGAGCAGATGG - Intronic
1040040229 8:42909161-42909183 TGGTGAAGATGTGGAGCAGAGGG + Intronic
1040141654 8:43924332-43924354 AAGTGGATATTTGGAGCAGTTGG + Intergenic
1041146518 8:54881715-54881737 GGGTGGAAAGGTGGAGAAGAGGG + Intergenic
1041602676 8:59738712-59738734 GTCTGAACATGTGGAGAAGACGG + Intergenic
1041618316 8:59934358-59934380 CTGTGGATATCTGGGGAAGAGGG + Intergenic
1042280594 8:67052230-67052252 GTATGGATATGTGGAGAGCAAGG + Intronic
1042506170 8:69563176-69563198 GTTTGCATGTGGGGAGCAGATGG - Intronic
1043007230 8:74834640-74834662 GCGTGCATATGTGGAGTAAAAGG - Intronic
1043743968 8:83850037-83850059 GTGTGAATATTTGTAACAGATGG - Intergenic
1044594271 8:93942813-93942835 GTGTGGACAAGTGTACCAGATGG + Intergenic
1046290873 8:112159158-112159180 ATGTAGATTTGTGAAGCAGAGGG + Intergenic
1048194677 8:132322533-132322555 GTGTGCATATGTGGAATAGAGGG + Intronic
1048318429 8:133379370-133379392 GAGAGGATGTGTGGAGCAAAAGG + Intergenic
1048446004 8:134493786-134493808 GAGGGGATATGTGAAGCACACGG - Intronic
1049112773 8:140658840-140658862 GTGTGGATATGTGAAGCATTGGG - Exonic
1049204072 8:141355229-141355251 CTGTGGCCATGTGGAGCAGCTGG - Intergenic
1049244194 8:141552882-141552904 GAGTGAATATCTGGAGCATATGG - Intergenic
1050246842 9:3699116-3699138 GTGCGGATGTGTTGAGCAAAAGG - Intergenic
1052114409 9:24632286-24632308 TGGTGGGTATGTGGAGAAGAGGG - Intergenic
1052777465 9:32746976-32746998 GAAGGGATATGTGGAGCAGCAGG + Intergenic
1053546847 9:39032198-39032220 GGATGGATAGGTGGAGCATAAGG - Intergenic
1053804495 9:41787412-41787434 GTGTGGAGATGAGGGGCACATGG - Intergenic
1053811165 9:41853851-41853873 GGATGGATAGGTGGAGCATAAGG - Intergenic
1054140788 9:61528050-61528072 GTGTGGAGATGAGGGGCACATGG + Intergenic
1054619429 9:67333588-67333610 GGATGGATAGGTGGAGCATAAGG + Intergenic
1054625995 9:67398669-67398691 GTGTGGAGATGAGGGGCACATGG + Intergenic
1054747099 9:68865592-68865614 GTGAGGATAGGGGGAGCACATGG - Intronic
1055613751 9:78049975-78049997 GGATGAATATGTGGAGCACAGGG + Intergenic
1056061874 9:82891635-82891657 ATGGGGATAAGTAGAGCAGATGG - Intergenic
1056432525 9:86542242-86542264 GTGAGGATGTGTGAAGCAGGTGG + Intergenic
1056911783 9:90707713-90707735 GGGTGGATGTGTGGGGAAGATGG - Intergenic
1057108092 9:92440117-92440139 GTGTGGATATGTTGCACACAGGG - Intronic
1057745633 9:97748728-97748750 GTGTGACAAAGTGGAGCAGAAGG + Intergenic
1058077337 9:100664408-100664430 GGGTGGGTTTGTGGAGCGGAGGG + Intergenic
1058426087 9:104876284-104876306 GTGTGGAAACGGGGAACAGAGGG + Intronic
1059130524 9:111743460-111743482 GTGTGGATATGCTGGGCAAAGGG - Intronic
1060052578 9:120387795-120387817 GTGTGGCGCTGTGGAGCAGGAGG - Intergenic
1060235856 9:121862190-121862212 GTCTGGAAATGTGGAGGGGAGGG + Intronic
1060616420 9:125019017-125019039 GTGTGTATATGTCAAGAAGAAGG - Intronic
1061221239 9:129253416-129253438 GTGGGTATTTGTGGAGCTGATGG + Intergenic
1062011719 9:134270782-134270804 GTGTGCATCTGAGGAACAGAGGG + Intergenic
1186310297 X:8310301-8310323 GTGTGTTTATGTGGGGAAGAAGG + Intergenic
1187754219 X:22502389-22502411 GTGTGTATATGTGGAGGGAAGGG + Intergenic
1191183865 X:57589952-57589974 GGGTGAAGATGTGGAGCAGTAGG + Intergenic
1192448054 X:71224943-71224965 ATGTGGGTAAGAGGAGCAGAGGG + Exonic
1194953290 X:100152354-100152376 TTGTGGTCATTTGGAGCAGAGGG + Intergenic
1195247084 X:103004606-103004628 GTGAGTAGATGTGGAGCTGATGG + Intergenic
1198256405 X:134927562-134927584 GGGTGGCTGTGTGGAGGAGAAGG - Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198571131 X:137958447-137958469 GTTTGGATTTGGGGAGCATATGG - Intergenic
1201554691 Y:15255884-15255906 GTGTGGATATCTGGTGGACATGG - Intergenic
1201770899 Y:17615737-17615759 GGGTTGATAGGTGCAGCAGAGGG - Intergenic
1201830656 Y:18290249-18290271 GGGTTGATAGGTGCAGCAGAGGG + Intergenic