ID: 1103589234

View in Genome Browser
Species Human (GRCh38)
Location 12:121979471-121979493
Sequence TCTCCTGGGGGTGCTCACTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 216}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103589222_1103589234 28 Left 1103589222 12:121979420-121979442 CCCAGGTCCAGCCAATCGGAATC 0: 1
1: 0
2: 0
3: 10
4: 87
Right 1103589234 12:121979471-121979493 TCTCCTGGGGGTGCTCACTGCGG 0: 1
1: 0
2: 1
3: 18
4: 216
1103589224_1103589234 21 Left 1103589224 12:121979427-121979449 CCAGCCAATCGGAATCTCCAAGC 0: 1
1: 0
2: 1
3: 2
4: 43
Right 1103589234 12:121979471-121979493 TCTCCTGGGGGTGCTCACTGCGG 0: 1
1: 0
2: 1
3: 18
4: 216
1103589229_1103589234 4 Left 1103589229 12:121979444-121979466 CCAAGCACAGGCTTGGGATTCTC 0: 1
1: 0
2: 1
3: 9
4: 166
Right 1103589234 12:121979471-121979493 TCTCCTGGGGGTGCTCACTGCGG 0: 1
1: 0
2: 1
3: 18
4: 216
1103589225_1103589234 17 Left 1103589225 12:121979431-121979453 CCAATCGGAATCTCCAAGCACAG 0: 1
1: 0
2: 1
3: 2
4: 62
Right 1103589234 12:121979471-121979493 TCTCCTGGGGGTGCTCACTGCGG 0: 1
1: 0
2: 1
3: 18
4: 216
1103589223_1103589234 27 Left 1103589223 12:121979421-121979443 CCAGGTCCAGCCAATCGGAATCT 0: 1
1: 0
2: 1
3: 8
4: 89
Right 1103589234 12:121979471-121979493 TCTCCTGGGGGTGCTCACTGCGG 0: 1
1: 0
2: 1
3: 18
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103589234 Original CRISPR TCTCCTGGGGGTGCTCACTG CGG Intronic
900531355 1:3155045-3155067 ACTCCAGGGGGTGCTCCATGTGG + Intronic
900659448 1:3775367-3775389 TCTCCTGGGGCTGCATGCTGTGG - Exonic
900910844 1:5596104-5596126 CCTGCTGGGGGAGCTCTCTGGGG - Intergenic
904269983 1:29343649-29343671 TTTCCTGGGGTTGCTCACATTGG + Intergenic
905954205 1:41978499-41978521 TCTCCTGTGGCTGCTCTCTTTGG - Intronic
907537049 1:55172376-55172398 TCTCCTGGGTGTGCTTACAATGG - Exonic
907673164 1:56494397-56494419 TATGCTGGGGGAGCTTACTGAGG - Intergenic
911324192 1:96450123-96450145 TGTCCTGGGGCTGGGCACTGTGG - Intergenic
915328618 1:155094357-155094379 TCAACTCTGGGTGCTCACTGTGG - Intergenic
915477736 1:156162852-156162874 CCTCCTGGGTTTTCTCACTGAGG + Intronic
916481485 1:165218551-165218573 TGCTCTTGGGGTGCTCACTGAGG + Intronic
916839243 1:168583179-168583201 TCTTCTGGGGGTTTACACTGGGG + Intergenic
919818079 1:201454461-201454483 TTTCCTTGGGCTGCTCTCTGTGG - Intergenic
920203862 1:204277345-204277367 TCTCCTTGGGGTGCTGAATGGGG - Intronic
920948073 1:210548144-210548166 TCTGCTGTCAGTGCTCACTGTGG + Intronic
922524726 1:226291895-226291917 TCTCCTGAGAATGGTCACTGAGG - Intronic
922884965 1:229012325-229012347 CCTCCTGGGGCTGCTGACTGGGG + Intergenic
923525952 1:234772928-234772950 TGTCCTCGGGCGGCTCACTGGGG + Intergenic
923992434 1:239454071-239454093 TCTCCAGAGGATGCTGACTGGGG + Intronic
924548839 1:245055143-245055165 TCTCTCGAGGCTGCTCACTGCGG + Intronic
1063160598 10:3415612-3415634 TCTCCTGCGGCTTCTCCCTGTGG + Intergenic
1063515349 10:6689716-6689738 TCTCCTGAGGGTTCTTTCTGTGG + Intergenic
1064681911 10:17818839-17818861 TCTTCTTGGGATGCTCACTAAGG - Intronic
1067937472 10:50624015-50624037 GCTCCTCCGGGTGTTCACTGCGG + Intronic
1070680786 10:78447733-78447755 TTTCCTGGGGATGCTAATTGAGG - Intergenic
1070898416 10:80005877-80005899 CCTCCACCGGGTGCTCACTGTGG + Intergenic
1076053183 10:127351482-127351504 TGTCCTGGGGGTGCGTGCTGTGG + Intronic
1076276546 10:129204329-129204351 CCTCCTTGGGGTCCTCCCTGGGG - Intergenic
1076323120 10:129598441-129598463 CATCCTGGGGGTGCTGCCTGAGG + Intronic
1076723226 10:132401802-132401824 TCTCATGGGGTTGCTCAAGGAGG + Intronic
1077078165 11:710516-710538 TGTCCTGAGGGTGCTCCCTGGGG - Intronic
1078425176 11:11243887-11243909 TCTCCTGGGGTTGCAGGCTGAGG - Intergenic
1078636051 11:13051347-13051369 TCTTCTGGGAGTACTCCCTGCGG - Intergenic
1083689897 11:64401153-64401175 TCTGCCGGGGGTGCCCTCTGCGG - Intergenic
1084328549 11:68416161-68416183 TCTCTTGGGGGTGCGCTATGGGG - Intronic
1084455592 11:69266330-69266352 TCTCGTGGAGGTGCTGCCTGGGG + Intergenic
1085462420 11:76702131-76702153 AGTCCTGGGGGTGTTCACGGAGG - Intergenic
1088550247 11:111005465-111005487 TCCCCTGGGGGTGCTTGGTGAGG - Intergenic
1088819776 11:113447321-113447343 TTTCCTGGGGGAGCTCTCTCGGG + Intronic
1092287768 12:7139293-7139315 GCTCCTGGGGGACCTGACTGAGG + Intronic
1097021641 12:56025105-56025127 GCTGTTGGGGGTGCTCACCGAGG - Exonic
1099459312 12:82903113-82903135 TCTCCTGGTTATTCTCACTGGGG + Intronic
1101447785 12:104749899-104749921 ACTCCTGGGGGTTCTATCTGTGG - Intronic
1101496478 12:105259284-105259306 TCTCCTGGGGGTGTACACAGTGG + Intronic
1101873905 12:108586467-108586489 TCTCCCGGGGGTGTTGACTGTGG - Intergenic
1102348576 12:112175378-112175400 TCTCCTGGGGCTGCTCTCCTTGG - Intronic
1103589234 12:121979471-121979493 TCTCCTGGGGGTGCTCACTGCGG + Intronic
1103700830 12:122847978-122848000 TCTCCTGGGGTGGCTGCCTGGGG + Intronic
1104440500 12:128789739-128789761 TCACCTGCGGGTGCTCGGTGAGG - Intergenic
1106465701 13:30012797-30012819 ACTCATGTGAGTGCTCACTGTGG - Intergenic
1106465721 13:30012971-30012993 ACTCGTGTGAGTGCTCACTGTGG - Intergenic
1108149636 13:47520160-47520182 TCTCCTGGGAGTGCTCTTTAAGG - Intergenic
1109019311 13:57065201-57065223 TCTCCAGGGTGTGCTCTATGAGG + Intergenic
1112002137 13:95220768-95220790 TCTCCTGGGGGTAATAGCTGTGG - Intronic
1114666716 14:24381842-24381864 TCTCCTGGGCGTGAACCCTGAGG + Intergenic
1118234341 14:63987443-63987465 TCTCCTGGGAGTTATCATTGAGG + Intronic
1118852332 14:69593511-69593533 TCTCTTGGGGGGGCTGACGGGGG - Intergenic
1119804479 14:77473993-77474015 TCTAGTTGGGGTGCCCACTGAGG + Intergenic
1120942734 14:89964294-89964316 CCTCCTGCAGGTGCTCCCTGAGG - Intronic
1121698866 14:95936508-95936530 TCTCCTTGGGAAGCTCATTGGGG - Intergenic
1122415831 14:101549074-101549096 CCTCCTGGGGGTCCCTACTGGGG - Intergenic
1122632383 14:103112917-103112939 CATCCTGGGGGTGCTGACAGGGG - Intergenic
1122908128 14:104812146-104812168 TCTCCTGTGGGTGGGCACAGGGG - Intergenic
1122913602 14:104845532-104845554 ACACCAGGGGGTCCTCACTGTGG - Intergenic
1122938266 14:104969914-104969936 TCTCCTGGGGGTGCCCGAGGTGG - Intronic
1123098364 14:105776999-105777021 TCTCCTGGACGTTCTCTCTGAGG - Intergenic
1129243093 15:74263222-74263244 TCTCCTGGGGGAGCTCAGGCTGG + Intronic
1129341682 15:74890432-74890454 AGAGCTGGGGGTGCTCACTGGGG - Intronic
1129858018 15:78838835-78838857 TCTCCTGGAGGAGCAAACTGAGG + Intronic
1129951766 15:79598240-79598262 TCTTCTGGGAGGGTTCACTGTGG - Intergenic
1130011668 15:80157246-80157268 TCTCCATTGGCTGCTCACTGGGG - Intronic
1131332537 15:91515075-91515097 TCTCCTGCTGGGGCTCCCTGTGG + Intergenic
1132196260 15:99916716-99916738 CCTCCTGGGGGCCCTGACTGGGG - Intergenic
1133316856 16:4890228-4890250 TCTCCTGGGGCTCGTAACTGGGG + Exonic
1135285252 16:21187631-21187653 TCCCCTGGGGGTGCTGGTTGAGG - Intergenic
1136778078 16:32882138-32882160 ACTCCTGGGGGTGGACCCTGTGG - Intergenic
1136892543 16:33979376-33979398 ACTCCTGGGGGTGGACCCTGTGG + Intergenic
1139526636 16:67520838-67520860 GCTCCTGGAGGAGCTCACTGAGG + Intronic
1141174094 16:81707977-81707999 CCGCCAGGGCGTGCTCACTGGGG + Intronic
1141194854 16:81852798-81852820 TCAGCTGGGGCAGCTCACTGGGG + Intronic
1203080497 16_KI270728v1_random:1144247-1144269 ACTCCTGGGGGTGGACCCTGTGG - Intergenic
1142873420 17:2836108-2836130 CCTTCGGGGGGTGCTCCCTGTGG + Intronic
1144380557 17:14693291-14693313 TCTCCTAAGGCTGCTCACCGAGG - Intergenic
1144853250 17:18254603-18254625 TCTCCAGGCGGTTCTCGCTGAGG + Exonic
1146790183 17:35746505-35746527 CCTCCTGGGTGTTCTCACTGGGG - Intronic
1148214130 17:45825251-45825273 TCCCCTGGTGGTGCTGGCTGCGG - Intronic
1148548085 17:48531956-48531978 TCACCTGGCTGTGCTCATTGTGG - Intergenic
1148887063 17:50781483-50781505 TCTCCGGGTGGTTCCCACTGGGG + Intergenic
1149570876 17:57671556-57671578 TCACCTGAGGGTGCTTTCTGTGG - Intronic
1151205175 17:72501545-72501567 TCTCCTGGGGGTGCTGAGCTGGG - Intergenic
1151961474 17:77408081-77408103 CCTTCTTGGGATGCTCACTGGGG + Intronic
1152613770 17:81328755-81328777 GCTCCCAGGGGTGCTCAGTGTGG - Intronic
1152765812 17:82137957-82137979 TCTCCTGGGGCTGGGCACAGTGG - Intronic
1152822576 17:82444837-82444859 TCTCCTGGGAGTGCCGACTGCGG + Intronic
1152868220 17:82736670-82736692 TCTGGTGGGGGAGCTCTCTGAGG + Intronic
1152889224 17:82870764-82870786 TCGCCTGTGCGTGCTCCCTGCGG + Intronic
1152918382 17:83053008-83053030 TCTCCTGGGGGACCTCACGGTGG - Intergenic
1153819912 18:8824364-8824386 TCTCCTGAGAATTCTCACTGAGG + Intronic
1154155533 18:11941474-11941496 GCTCCTGGGGAGGCTGACTGGGG - Intergenic
1155376583 18:25164738-25164760 CCTCCTGGGGGTGCCCAGGGAGG - Intronic
1157495895 18:48157157-48157179 TAACCTGGGGGTACTCTCTGAGG + Intronic
1157721828 18:49931318-49931340 CCTCCAGGCTGTGCTCACTGTGG + Intronic
1159943170 18:74424700-74424722 TCTCCTGCTGGTTCTCACTCTGG - Intergenic
1161085381 19:2332764-2332786 TCCCCTGGGGGCCCACACTGAGG + Intronic
1163263185 19:16203623-16203645 TTTGCTGGGGGTGCTCCCAGGGG + Intronic
1163478198 19:17539337-17539359 TCTCCTGCAGGTGCTGACCGCGG + Exonic
1164399068 19:27890440-27890462 TCTCCCTGGGGTGCCCATTGAGG - Intergenic
1164478598 19:28594118-28594140 TCTCCTCTGTGTGCTAACTGTGG - Intergenic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
1166228260 19:41410798-41410820 TCACGTGGGGGTCCTCGCTGGGG - Exonic
1166307127 19:41941160-41941182 TCTCCTGGGGGTGTTCGGGGAGG - Intergenic
1168724131 19:58571343-58571365 TCTTCTGGGGGTGCTCGGTCTGG + Exonic
925178853 2:1803720-1803742 AGTCCTGGGGCTGCCCACTGCGG + Intronic
925180899 2:1816418-1816440 TCCTCTGGGGGTGCCCACCGGGG - Intronic
925202295 2:1978272-1978294 TGACCTGGGTCTGCTCACTGAGG + Intronic
928166956 2:28978776-28978798 TCTCCTGGGTGTGCTCACACTGG - Intronic
929035080 2:37682991-37683013 CCTCCAGGGGGTGATCACAGGGG + Intronic
929531362 2:42755079-42755101 TCTCCTCAGGGTTCCCACTGAGG + Exonic
931427629 2:62185485-62185507 TCTACTGGGAGTGCTGACGGCGG + Intergenic
931590329 2:63876022-63876044 TCTCCTGGGGGAGCTAAGTAGGG + Intronic
937245082 2:120487285-120487307 TCTCCTGGAGGTGCCCCCTGTGG + Intergenic
937261326 2:120588304-120588326 TCTCCTGGAGGTGCTCTCGCTGG - Intergenic
943302442 2:186220821-186220843 TCTCCTGGGGTAGGTGACTGAGG - Intergenic
948084142 2:235232418-235232440 TCTCCTGCGTGTGCTGACTGTGG + Intergenic
1172639993 20:36435137-36435159 TACACTGGGGGTACTCACTGAGG + Intronic
1173664279 20:44753853-44753875 ACACCTGGGGGTGGTCAGTGAGG - Intronic
1174944995 20:54975106-54975128 TTTCATGGGGGTCCTCAGTGGGG + Intergenic
1175552021 20:59823409-59823431 TCACCTGGGGCTGAGCACTGAGG - Intronic
1175868612 20:62195873-62195895 ACTCCTTGCGGGGCTCACTGTGG - Exonic
1176189191 20:63799765-63799787 TCTCATGGGGGAGCTTGCTGTGG - Intronic
1176849098 21:13899147-13899169 TCTCCTGAGGCTGCACACAGAGG + Intergenic
1179632777 21:42688915-42688937 TCCACTGGGGGGCCTCACTGAGG - Intronic
1179712678 21:43272393-43272415 AGACCAGGGGGTGCTCACTGAGG + Intergenic
1179929739 21:44559307-44559329 TCTGCTGGGGGTGAGCCCTGGGG + Intronic
1180130407 21:45823350-45823372 TCTCCTGGAGCTGCACAGTGTGG - Intronic
1180198109 21:46209345-46209367 TCACCTGGGGCAGCTCTCTGAGG - Intronic
1180782593 22:18529343-18529365 TCGCCTGGGGGCGGGCACTGAGG + Intronic
1180880402 22:19199348-19199370 ACTACTGGGGCTGCACACTGTGG + Intronic
1181126150 22:20703370-20703392 TCGCCTGGGGGCGGGCACTGAGG + Intergenic
1181239483 22:21468681-21468703 TCGCCTGGGGGCGGGCACTGAGG + Intergenic
1181695096 22:24588983-24589005 GCTCCTGGGGCTGCTCACAGAGG - Intronic
1182706566 22:32284878-32284900 CCTCCTGGGGGTTGTCACTGAGG - Intergenic
1184045836 22:41971723-41971745 TCTCCTGTGGGGGCACACTCCGG - Intergenic
1184331435 22:43830358-43830380 CCTCGTGGGGCAGCTCACTGCGG + Intronic
1184394887 22:44227950-44227972 CCTCCTGGGGGTTGTCACTGAGG - Intergenic
1184661245 22:45966519-45966541 ACTCCAGGGGATGCTCACTCGGG + Intronic
949255763 3:2044011-2044033 TCTCCTGAGGGAGCTGCCTGTGG + Intergenic
949358532 3:3207173-3207195 TTTCCTGGGTGTGGACACTGAGG + Intergenic
949904633 3:8848759-8848781 GCTGCAGGGGATGCTCACTGTGG - Intronic
949911739 3:8915904-8915926 ACTCTTGTGGGTGCCCACTGAGG - Intronic
950530196 3:13548807-13548829 TCTTCCAGGGGTGATCACTGAGG + Intergenic
950799555 3:15539169-15539191 TCTCCTTGGGGTCCACACTCTGG - Intergenic
951697672 3:25462755-25462777 GCTTCTAGGGGTGCTGACTGTGG + Intronic
954351580 3:50048619-50048641 TCTCCTGGGGGTGGTCATAAAGG + Intronic
954903725 3:54042086-54042108 TCTCCTGGGGAGGCTGAGTGAGG + Intergenic
956784054 3:72627792-72627814 TCATCTGTGGGTGCTCACTATGG - Intergenic
957206490 3:77205348-77205370 TCTGCTGGGGGTGCTCAGAGAGG - Intronic
958069104 3:88586235-88586257 TCTCTTGGTGTTTCTCACTGTGG - Intergenic
960249637 3:115437779-115437801 CCTCCTAGGGGTACTCAGTGGGG + Intergenic
961044913 3:123701420-123701442 GCTCCTGGGGGCACTCACCGTGG + Exonic
961456149 3:127025008-127025030 TCTCCTAGGGATGCTGACAGTGG - Intronic
962971323 3:140404473-140404495 CCTCCTGGGGGCACTGACTGAGG - Intronic
968231866 3:197009119-197009141 TCTCCTGGAGGATCTCAGTGCGG + Intronic
968547766 4:1207349-1207371 CCAGCTGGGGGTGCCCACTGTGG - Intronic
969455139 4:7296166-7296188 GCTCCTTGGGGTGCTCCCTCTGG + Intronic
970550227 4:17173225-17173247 TCTCCTGTGGTTTCTCACTCTGG - Intergenic
970853124 4:20625658-20625680 CCTCCTGGGTGTGCTCAGTTGGG - Intergenic
974860242 4:67511697-67511719 TTTCCTGGGGGTGGTCACATAGG - Intronic
982064820 4:151644843-151644865 TCTTCTCTGGGTGCCCACTGGGG + Intronic
985492630 5:188314-188336 TGTCCTGGGGGGGCTCACAGAGG + Exonic
985603958 5:848873-848895 TCACCTGGGCGTGCTCACCTGGG + Intronic
985868967 5:2538789-2538811 TCTCCCGGGGGGACTCAGTGGGG - Intergenic
986242274 5:5971683-5971705 TCTCCTGGGTCTGCAGACTGTGG - Intergenic
986686367 5:10278493-10278515 TCCCCTGGAGGTTCTAACTGGGG - Intronic
992883091 5:81130153-81130175 GCTCCTGGTGGTGCTTTCTGAGG + Intronic
994166901 5:96618027-96618049 TCTTCTAGGGGTGTTAACTGAGG + Intronic
995806082 5:116053586-116053608 TCTACTTTGGGTTCTCACTGTGG + Intronic
999999221 5:157121063-157121085 TCTCCTGGGGATGGTCCTTGGGG - Intronic
1006712337 6:36084827-36084849 TCTCATGGGGTAGCTTACTGGGG - Intronic
1006810965 6:36820226-36820248 TCTCCTGTGAGGGCTCAGTGAGG + Intronic
1011723354 6:90182484-90182506 TCTCTTAGCAGTGCTCACTGAGG + Intronic
1012717752 6:102698733-102698755 TATCCTGGCAGTGCTGACTGTGG - Intergenic
1013643782 6:112114921-112114943 TCAACTGGGGGTGCTCTTTGGGG + Intronic
1015217350 6:130765626-130765648 TCCCCTGGTGGTACTGACTGAGG + Intergenic
1017711309 6:157170671-157170693 TGTCCTGGGGGTGGCCACAGTGG + Intronic
1017786602 6:157762031-157762053 TCTTCTGGCCGTGCTCCCTGCGG - Intronic
1018838993 6:167505793-167505815 TCTCCTGGGGGGACTCCCCGCGG + Intergenic
1018967970 6:168503424-168503446 TCACCAGGAGGAGCTCACTGTGG - Intronic
1019000005 6:168742192-168742214 CCTCCTGCGGGTGCTAACGGCGG - Intergenic
1019398371 7:835896-835918 TCTCATGGGGGTGTTGGCTGTGG + Intronic
1019563304 7:1668242-1668264 TTTCCTCGGGGTGCAAACTGAGG - Intergenic
1019922508 7:4171964-4171986 GCCCCTGGGTTTGCTCACTGGGG + Intronic
1021290279 7:18835199-18835221 TCTCCAGGGCATGCTCGCTGTGG + Intronic
1023272532 7:38480264-38480286 ACTCCTGGCGCTGGTCACTGGGG - Intronic
1023508323 7:40923160-40923182 TGTCCTGGGTGTGCACCCTGTGG + Intergenic
1023822635 7:43988469-43988491 CCTACTGGGGGTGGGCACTGTGG + Intergenic
1025756555 7:64350049-64350071 TCTCCTGGGGTATCTTACTGGGG + Exonic
1025790024 7:64680456-64680478 TCCACTGGGGGTCCTCACGGGGG - Intronic
1029750898 7:102541884-102541906 CCTACTGGGGGTGGGCACTGTGG + Intronic
1029768852 7:102640995-102641017 CCTACTGGGGGTGGGCACTGTGG + Intronic
1034684050 7:152954212-152954234 TTTCCTCGGGGTGCTCCCTATGG + Intergenic
1034939321 7:155220245-155220267 ACAGCCGGGGGTGCTCACTGAGG - Intergenic
1035610755 8:962518-962540 CCTCCTGGGGCTGCTCACATGGG + Intergenic
1035632370 8:1117746-1117768 TCTCCTGGGGGAGCCCCCTGGGG - Intergenic
1036034454 8:5003976-5003998 CCTCCTGGGCCTGCTCCCTGGGG - Intergenic
1036193819 8:6696705-6696727 TCTCCTGAAGGACCTCACTGAGG + Intergenic
1036687400 8:10921111-10921133 TCTCATGTGGGAGCCCACTGGGG - Intronic
1037540097 8:19862585-19862607 TGTCCTGGGGGGGCTGTCTGTGG - Intergenic
1039421878 8:37450293-37450315 AGTCCTGGGGCTGCTGACTGTGG + Intergenic
1039844840 8:41318585-41318607 CCACCTGGGGATTCTCACTGGGG + Intergenic
1039922724 8:41904709-41904731 TGGGCTGGGGGTGCTCACAGAGG - Intergenic
1040728592 8:50414109-50414131 CCTCCTGGGATTTCTCACTGTGG + Intronic
1042344902 8:67717492-67717514 TCTCTTGGGAGTGCTTAGTGGGG - Intronic
1042373662 8:68022240-68022262 TCGCCTGGGGATGCTAACAGAGG - Intronic
1049639177 8:143706847-143706869 TCTCTTCGGGGTCCTCACCGAGG - Exonic
1053438204 9:38091669-38091691 TTCCTTGGGGGTGCTCACTTAGG + Intergenic
1054781349 9:69168886-69168908 TCTCCTGGAGGTAATCACAGGGG + Intronic
1056713522 9:89010372-89010394 TCTCATGGGGGTGCTCATTGTGG - Intergenic
1057906833 9:98989852-98989874 CCTCCTGGGAATGCTCCCTGTGG + Intronic
1059285847 9:113170917-113170939 GCTCCTAGTGGTGCTCACAGTGG - Intronic
1061294886 9:129671705-129671727 GCTCCTGGAGATGCTCTCTGAGG + Intronic
1061999938 9:134210835-134210857 TCCACTGGGGGTGCTCATTCTGG - Intergenic
1062108125 9:134766827-134766849 AGTCCTGGGGCTGCTCTCTGTGG + Intronic
1062217469 9:135397052-135397074 GGTCCTGGGGGTGGTCCCTGTGG - Intergenic
1062480576 9:136749047-136749069 TGTTCTGGGGGTGCTGGCTGTGG - Intergenic
1185826761 X:3258739-3258761 TCTCCGGGTGGTGCTCCCTTTGG + Intergenic
1187881822 X:23854322-23854344 GCTCCCCGGAGTGCTCACTGTGG - Intronic
1192405836 X:70885366-70885388 TCTCATGAAGATGCTCACTGAGG + Intronic
1194524965 X:94967413-94967435 TTGCCTGGGGGTGCTTTCTGAGG - Intergenic
1195060253 X:101187495-101187517 TCTCCTGGGGAGGCAGACTGTGG + Intergenic
1197765794 X:130058772-130058794 TCTCTTAGGGCTTCTCACTGTGG + Intergenic
1200024488 X:153245197-153245219 TTTCCTGGGGCTGAACACTGTGG - Intergenic
1200101755 X:153691902-153691924 ACTCCTGGGGGTGGACCCTGTGG + Intronic
1200976383 Y:9216012-9216034 TCACATGGGGGTGCTGGCTGTGG + Intergenic
1201622591 Y:15976878-15976900 TCTCCTGGAGTTAATCACTGAGG - Intergenic
1202134787 Y:21650518-21650540 TCACATGGGGGTGCTGGCTGTGG - Intergenic