ID: 1103590771

View in Genome Browser
Species Human (GRCh38)
Location 12:121990493-121990515
Sequence GGAAACAAGCATGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 640
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 592}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103590771_1103590777 11 Left 1103590771 12:121990493-121990515 CCCTCCTCCTCATGCTTGTTTCC 0: 1
1: 0
2: 2
3: 45
4: 592
Right 1103590777 12:121990527-121990549 GTCTTCCTCTGACCTCCTACTGG 0: 1
1: 0
2: 0
3: 20
4: 181
1103590771_1103590781 26 Left 1103590771 12:121990493-121990515 CCCTCCTCCTCATGCTTGTTTCC 0: 1
1: 0
2: 2
3: 45
4: 592
Right 1103590781 12:121990542-121990564 CCTACTGGCCAAACCCTTCATGG 0: 1
1: 0
2: 1
3: 5
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103590771 Original CRISPR GGAAACAAGCATGAGGAGGA GGG (reversed) Intronic
900093506 1:930756-930778 GGCAACAAGCAAGAGGGAGAAGG + Intronic
900334797 1:2157157-2157179 GAGAACAAGAAGGAGGAGGAAGG - Intronic
900687092 1:3955534-3955556 GGAAACAGGGAAGAGGAGTAGGG - Intergenic
901123468 1:6913143-6913165 GGACAAAAGGATGTGGAGGAAGG + Intronic
901300800 1:8198825-8198847 AGAAACAAGCGTGGGGAAGACGG + Intergenic
902381395 1:16054111-16054133 GGCAACAAGGATTTGGAGGAGGG - Intronic
902844722 1:19100888-19100910 TGAGACCAGCAGGAGGAGGAAGG - Intronic
904329450 1:29748479-29748501 GGAAACAAGGAAGAGAAGCAAGG + Intergenic
904330427 1:29754839-29754861 GGAAACAGGAGTGTGGAGGAGGG + Intergenic
904350052 1:29899198-29899220 GGAAAGAAAGAGGAGGAGGAAGG + Intergenic
904416250 1:30362756-30362778 GGAAACAGGAGTGTGGAGGAGGG - Intergenic
904497592 1:30895836-30895858 GGAAGCGAGTAAGAGGAGGAGGG + Intronic
904923117 1:34024338-34024360 AGAAACAGTGATGAGGAGGAAGG - Intronic
906192290 1:43905932-43905954 GGAGAGGAGCAGGAGGAGGAGGG - Intronic
906192433 1:43906438-43906460 GGAGAGGAGCAGGAGGAGGAGGG - Intronic
906431639 1:45760302-45760324 GGAAATAACCACTAGGAGGAGGG - Intergenic
906511773 1:46414087-46414109 GGAAAGAAGCAGAAGAAGGAAGG - Intergenic
907090791 1:51723519-51723541 GGAAACAGGAAAGAAGAGGAAGG - Intronic
907744775 1:57202140-57202162 TGAAACAAGGATGAGGTAGAGGG - Intronic
908035379 1:60046155-60046177 GGAAAGAAGCAAGGAGAGGAAGG - Intronic
908498440 1:64718841-64718863 GGAAACAAGAAAGAGTAAGAGGG - Intergenic
908818682 1:68059668-68059690 GAAAAAAAGAATGAAGAGGAAGG + Intergenic
909686563 1:78355277-78355299 AGAAAAAAGAATGAGGAGAAGGG - Intronic
910202682 1:84715737-84715759 GAAAACAAACAGGTGGAGGAGGG - Intergenic
910429202 1:87144504-87144526 GGAACAAAGCAGGAGGAAGAAGG + Intronic
911055975 1:93708846-93708868 GGACACAGGCAGGAGGAGGTTGG + Intronic
911566620 1:99469933-99469955 GAAAACAACCAGGAGCAGGAAGG - Intergenic
911632813 1:100201351-100201373 AGAAAAAAGAATGAGAAGGAAGG + Intronic
912590665 1:110816399-110816421 GGAAAAGAGAAGGAGGAGGAGGG - Intergenic
912670591 1:111620362-111620384 GGGGACATGCAAGAGGAGGAAGG - Intronic
913463607 1:119116243-119116265 GGAGGCAACAATGAGGAGGAGGG + Intronic
914519645 1:148404094-148404116 AGAAAAAAGGAGGAGGAGGAAGG - Intergenic
914677062 1:149913611-149913633 GGGACCCAGGATGAGGAGGAAGG - Exonic
914857275 1:151361980-151362002 GAAAAGAAGGAGGAGGAGGAAGG + Intergenic
915620215 1:157077664-157077686 GGATAGAAGAAGGAGGAGGAAGG - Intergenic
915656932 1:157368420-157368442 GAAATCAAACATGAAGAGGATGG - Intergenic
915672045 1:157497852-157497874 GAAATCAAACATGAAGAGGATGG + Intergenic
916076016 1:161200392-161200414 GGAAACAAGCAGCCAGAGGATGG - Intronic
916106760 1:161438709-161438731 GTTTGCAAGCATGAGGAGGAAGG + Intergenic
916767693 1:167877691-167877713 GGAAAAAAGGAAGAGGAAGAAGG + Intronic
917123551 1:171665474-171665496 GGAGAGCAGCATGAGGAAGATGG - Intergenic
917670626 1:177270303-177270325 GGAAATGAGCATGAGGATCATGG + Intronic
917870382 1:179236333-179236355 GGAAACAAGGATCCTGAGGAAGG + Intergenic
918226506 1:182488368-182488390 GGAAGGAATCATGAGGATGAGGG + Intronic
919203316 1:194387785-194387807 GGGAACTAGCTGGAGGAGGAAGG - Intergenic
919211929 1:194498061-194498083 GGAAACAATCATGAGGATCATGG + Intergenic
919345807 1:196376814-196376836 GGAAACAACTATGAGGAAGCGGG - Intronic
919988839 1:202694787-202694809 GGAGAGAAGGAGGAGGAGGAGGG - Intronic
921771797 1:219049125-219049147 AGAAAGAAGAATGAGGAGGCTGG + Intergenic
922170501 1:223150536-223150558 GGAAACAAGAATGTCCAGGAAGG - Intergenic
922406505 1:225319604-225319626 AGAAACAAGCAAGAGAAGGAGGG + Intronic
923254848 1:232212742-232212764 GGAAAAAAGTTTGAGGAGGCAGG + Intergenic
923516732 1:234703977-234703999 AGAAGCAAGCTTGAGGGGGAAGG + Intergenic
923517732 1:234711607-234711629 GGGAAGAAGGAGGAGGAGGATGG - Intergenic
923920883 1:238563778-238563800 GGAAAAGAGCATGAGGAAGCTGG + Intergenic
924332416 1:242953390-242953412 GGAGAGGAGCATGTGGAGGAAGG + Intergenic
1063200746 10:3783917-3783939 GGAAAAAAACAGGAGGGGGAGGG + Intronic
1064009035 10:11720667-11720689 GGAACTTCGCATGAGGAGGAGGG - Intergenic
1064786916 10:18907940-18907962 GGAAAAAAGGATGATGAGGGAGG + Intergenic
1064855150 10:19759286-19759308 GTAAACACGCATGAGAAGAACGG - Intronic
1064941616 10:20741762-20741784 GGGAGCTTGCATGAGGAGGATGG - Intergenic
1065834534 10:29644841-29644863 GGCTACAAGACTGAGGAGGAGGG + Intronic
1067143913 10:43679846-43679868 CCAAACAGGCATGAGGAGAAAGG - Intergenic
1067706564 10:48610667-48610689 GGAAGCAGGGATGGGGAGGAAGG + Intronic
1068697318 10:59981788-59981810 GGATAGTAGTATGAGGAGGAGGG - Intergenic
1068834200 10:61534304-61534326 GGATAAAAGCAGGAAGAGGAAGG - Intergenic
1069143328 10:64856468-64856490 TGAAACAAGAATGAAGAGAATGG - Intergenic
1069226318 10:65949572-65949594 AGAAAAAAGCATGGGGAGGTAGG + Intronic
1069267072 10:66473353-66473375 AGAGAGAAGCATGAGGAGCAAGG - Intronic
1069291552 10:66786371-66786393 GGGTAGAAGCAAGAGGAGGAAGG - Intronic
1069760672 10:70809038-70809060 AGAAACAAGCCTGAGGGGGACGG - Intergenic
1070392041 10:75979717-75979739 GGGAAGAAACATGGGGAGGAGGG - Intronic
1071494091 10:86155861-86155883 GGATACAGGCCTGAGGAGGATGG + Intronic
1071887586 10:89967828-89967850 GGAAAGAAGGAGGAAGAGGAAGG - Intergenic
1072216011 10:93287822-93287844 GGAAACAAACCTGAGGCTGAAGG - Intergenic
1072445743 10:95497189-95497211 GTAAACAAGGAGGAGGAGGCAGG + Intronic
1072614530 10:97040493-97040515 GAATGCAGGCATGAGGAGGATGG + Intronic
1073083628 10:100874862-100874884 GCAGACATGAATGAGGAGGAAGG + Intergenic
1073886706 10:108048183-108048205 GAAGACTAGAATGAGGAGGAAGG - Intergenic
1074100622 10:110352143-110352165 GGACACAGGCCTGAGGAGAAAGG - Intergenic
1075935493 10:126337520-126337542 GGAACAAAGCAGGTGGAGGAAGG - Intronic
1075945265 10:126427562-126427584 GGAATAAAGCAGGAGGAAGAAGG + Intronic
1076196648 10:128523276-128523298 AGGGACAAGCTTGAGGAGGAAGG - Intergenic
1076442610 10:130490777-130490799 GGAGAAGAGGATGAGGAGGAGGG - Intergenic
1076526894 10:131117618-131117640 GGAACCAAGGGTGGGGAGGAAGG + Intronic
1076896088 10:133312973-133312995 AGGAACAAGGATGGGGAGGATGG - Exonic
1077074377 11:693905-693927 GGAAAAAGGCAAGAGGAAGAGGG + Intronic
1078048552 11:7940775-7940797 GAGAAAAAGCATAAGGAGGAAGG + Intergenic
1078245262 11:9568412-9568434 GAGAACAAGCATAAGGAGAAAGG + Intergenic
1079015124 11:16862285-16862307 GGGAACAGGCATGGGGAGGTGGG - Intronic
1079436626 11:20460168-20460190 GGAAATAAACGTTAGGAGGAAGG + Intronic
1079754586 11:24240319-24240341 GGGAGCAAGCATGAGAAGGAGGG + Intergenic
1080277357 11:30517616-30517638 AGAAACATGCAGGATGAGGAAGG - Intronic
1080786368 11:35478531-35478553 GGGAAACAGCAAGAGGAGGAGGG + Intronic
1081645837 11:44789856-44789878 AGAGACAAGAATTAGGAGGAGGG - Intronic
1081809961 11:45909131-45909153 GGAAACAGGCATGTGGATGCAGG - Intergenic
1083244555 11:61416286-61416308 GGATACCAGGAGGAGGAGGAGGG + Exonic
1083573442 11:63772175-63772197 GGCAAGAAGGAGGAGGAGGAAGG + Intergenic
1083672586 11:64307324-64307346 GGCCACAAGGAAGAGGAGGATGG + Exonic
1083759047 11:64805923-64805945 GAAAGCAAGAATGAGGAGGGGGG + Intronic
1084063655 11:66691258-66691280 TGACCCAAGCATGAGGAGGTGGG - Intronic
1085203980 11:74719268-74719290 GGAAACAAGCATGATTGTGAGGG - Intronic
1085430951 11:76447135-76447157 GGAAACAACAATGAGTAAGATGG - Intronic
1085644389 11:78213727-78213749 GAAGACAAGGATGAGGATGAAGG + Exonic
1086439104 11:86810522-86810544 GGAATCTAGCCTGAGGAAGAAGG + Exonic
1086582786 11:88418473-88418495 TCAAACAAGCATGGTGAGGATGG + Intergenic
1086998917 11:93392984-93393006 AGAAAGAAGGAGGAGGAGGAGGG - Intronic
1087257378 11:95971549-95971571 GGTGACAAGAATGAGGAAGAAGG + Intergenic
1087394641 11:97582059-97582081 TGAAAGAAGCATGACTAGGATGG + Intergenic
1087444325 11:98228689-98228711 GTAAACTAGCATGAGGAGTGGGG + Intergenic
1089124222 11:116164963-116164985 GGAAGCAAGCAGGCTGAGGAGGG - Intergenic
1089391478 11:118104860-118104882 GGAAAGGAGGAAGAGGAGGAAGG - Intronic
1089912505 11:122116061-122116083 GGAAGAAAGGAAGAGGAGGAAGG - Exonic
1090384551 11:126349106-126349128 GGAAGAAAGCATGAGGTAGAGGG - Intergenic
1090422253 11:126583530-126583552 GGAGTCTAGCATGAGGAGGACGG + Intronic
1090861236 11:130654415-130654437 GGAAGTAAGCATGAGGATAATGG - Intergenic
1091119340 11:133043648-133043670 CAAAAAATGCATGAGGAGGAAGG - Intronic
1091538327 12:1435017-1435039 AAAAACAAACATGAGGAAGACGG - Intronic
1091582301 12:1797221-1797243 GGAGACACGCAGGAGGCGGACGG - Intronic
1091629633 12:2149946-2149968 GGAAGCAAGGATGAGGAGCCAGG + Intronic
1091792275 12:3278763-3278785 ATAACCAACCATGAGGAGGAGGG - Intronic
1092171120 12:6374695-6374717 GGGAACAAGCGTGAGGAGCAGGG - Exonic
1092428435 12:8391352-8391374 GGAAAGAAGCAGAAAGAGGACGG + Intergenic
1092429516 12:8397504-8397526 GGAAAGAAGCAGAAAGAGGACGG + Intergenic
1093567552 12:20626446-20626468 GGCAACAATCATGAGAAGCATGG - Intronic
1094070298 12:26405159-26405181 AGAAAGAAGGAGGAGGAGGAGGG + Intronic
1095111875 12:38303880-38303902 GGAAACATTTATGAGTAGGATGG + Intergenic
1095300411 12:40578086-40578108 GGAGAAAAGAAGGAGGAGGAAGG - Intergenic
1095930694 12:47622453-47622475 GGATCCAAGCATGAACAGGAAGG + Intergenic
1096617487 12:52842140-52842162 GCAAACAAGAACCAGGAGGATGG + Intronic
1097989945 12:65824295-65824317 GAAGAAAAGTATGAGGAGGAGGG - Exonic
1098064577 12:66600113-66600135 GGCAACAAATATGTGGAGGAGGG - Intronic
1099421829 12:82471317-82471339 GGTAACAAACATGAGGAGGCAGG - Intronic
1099868957 12:88322107-88322129 ATAAACATCCATGAGGAGGATGG + Intergenic
1099910100 12:88820489-88820511 GGAAGCAATCATGAGGAAGGAGG + Intergenic
1100024872 12:90115752-90115774 TGAAATAAACATGAGGATGAAGG + Intergenic
1100391000 12:94146881-94146903 GGAAAGAAGGGTGAGGTGGAGGG - Intergenic
1100457565 12:94767371-94767393 GGCAGCAAGCAAGAGGAGGGTGG + Intergenic
1101725973 12:107388505-107388527 GGAAAGAAGGAGGAGGAAGAGGG - Intronic
1101848764 12:108385675-108385697 GGAAAGGAGCATGTGGAGGTAGG + Intergenic
1102220709 12:111192498-111192520 GGAAAAAGGCATGAGCTGGAAGG - Intronic
1102238549 12:111309601-111309623 GGAAGGAAGGAGGAGGAGGAGGG - Intronic
1102806348 12:115784087-115784109 GAAATCAAGCATTAGAAGGATGG - Intergenic
1103235367 12:119368150-119368172 GAAAAGAAGGAGGAGGAGGAAGG + Intronic
1103590771 12:121990493-121990515 GGAAACAAGCATGAGGAGGAGGG - Intronic
1103701269 12:122849942-122849964 GGAAACCACCTTGAGGTGGAAGG - Exonic
1103971684 12:124676401-124676423 GGAAACAAGAAAGAGGAAGAAGG + Intergenic
1104418324 12:128614121-128614143 GGAAACAAGAAGGAAGAGCATGG - Intronic
1104503368 12:129307386-129307408 GCAAATAAGCATGAGGCAGAGGG - Intronic
1105344579 13:19561092-19561114 GGCCACAAGGAAGAGGAGGATGG - Intergenic
1105535459 13:21260481-21260503 GGCCACAAGGAAGAGGAGGATGG + Intergenic
1106599709 13:31177103-31177125 GGAAAGAAGCAAGAGAAGGGAGG - Intergenic
1107067471 13:36230630-36230652 GGAAATAAACATGAGGTGAAGGG + Intronic
1107401090 13:40069965-40069987 AGAAAGAAGCATGATGAGGTGGG + Intergenic
1107655585 13:42589584-42589606 GGTAACAAGCCTGAAGAGGCAGG - Intronic
1107999429 13:45892724-45892746 AGAAAGAAGCAACAGGAGGAAGG + Intergenic
1109197464 13:59394450-59394472 GGCAATAAGCATGAGTAGCAAGG + Intergenic
1109680961 13:65751631-65751653 GGAAGCAAACAAGAGGAGAAAGG - Intergenic
1113315658 13:109176763-109176785 GGAGACGGGCATGTGGAGGAGGG - Intronic
1113663977 13:112128176-112128198 GGAAACCAACAAGACGAGGAGGG - Intergenic
1114145795 14:19976219-19976241 GGAGACAACCAAGAGGAGAAAGG - Exonic
1114382461 14:22222052-22222074 GGAAAAAAGCTAGAGAAGGAGGG + Intergenic
1114850770 14:26380020-26380042 GGAAACAATCATGAGGAATGAGG - Intergenic
1115183154 14:30653672-30653694 AGAAACAAAAATGAGAAGGATGG + Intronic
1115275614 14:31605872-31605894 GGAGACAAGGAGGAGGAAGAAGG - Intronic
1119008902 14:70962365-70962387 GGAGACCACCATCAGGAGGAGGG - Intronic
1119439452 14:74618477-74618499 GTAAACAGGCCTGAGGAGAATGG - Intergenic
1119966941 14:78927355-78927377 GGGAACAAGCGTAAGGAGGAGGG + Intronic
1120098741 14:80420187-80420209 GGAAACAAGCAAGAGTTGGAAGG + Intergenic
1120825785 14:88953894-88953916 GGAAGCCAGCATGAGGATGATGG + Intergenic
1121085011 14:91139251-91139273 GAGAACAAGGAGGAGGAGGAAGG - Intronic
1121207159 14:92179228-92179250 GGAAAGAAGGAAGGGGAGGAGGG + Intergenic
1121207176 14:92179278-92179300 GGAAAGAAGGAAGGGGAGGAGGG + Intergenic
1202927122 14_KI270724v1_random:36735-36757 AGAAACAAGAAAGATGAGGAAGG - Intergenic
1202932843 14_KI270725v1_random:54480-54502 GAAAACAAGCGGGAGGAGGGAGG - Intergenic
1123932527 15:25178704-25178726 GGATGCATGCATGGGGAGGAGGG + Intergenic
1124101259 15:26696152-26696174 GGAAATAAGCTGGAGGAGGAAGG - Intronic
1124765142 15:32482340-32482362 GGAAACAAGGCTGAGAGGGAAGG + Intergenic
1124829263 15:33132173-33132195 GGAAAGAAGGAAGAGGGGGAAGG - Intronic
1125762912 15:42109946-42109968 AGAAAAAAGGAGGAGGAGGAGGG - Intergenic
1126350870 15:47743656-47743678 GGAATCAGTCATGAAGAGGAAGG + Intronic
1126681094 15:51202854-51202876 GGAAACAAATATAAGGAGGAAGG + Intergenic
1126894557 15:53244123-53244145 GGAAACCAGGAAAAGGAGGAAGG + Intergenic
1127407614 15:58668017-58668039 GGAAACAGAGATGAGGAAGAGGG + Intronic
1128276221 15:66356263-66356285 GGGAACGAGGATGAGGGGGACGG - Intronic
1128320008 15:66686604-66686626 GGAAAAAAGAATGAGTAGGAGGG + Intergenic
1129166349 15:73780413-73780435 GGCAACAAGCATGAAGACAAAGG - Intergenic
1129582002 15:76821416-76821438 GGAGACAAGCCTGAGGAACATGG + Intronic
1133815419 16:9193860-9193882 GGAAACATGCAGATGGAGGAAGG - Intergenic
1133962485 16:10506584-10506606 GTAAACAAGCAGAAGGAAGAAGG - Intergenic
1134775416 16:16849044-16849066 GGAAACTGGCATAAAGAGGAAGG - Intergenic
1135393871 16:22116204-22116226 GGAAAGAAGGAAGAGAAGGAAGG + Intronic
1135927725 16:26709956-26709978 GGAAAGAAGGAAGAGAAGGAAGG + Intergenic
1137399836 16:48144404-48144426 GGAAAAAAGAAGGAAGAGGAGGG - Intronic
1137650965 16:50119938-50119960 GGAAAGAAGAATGATCAGGAAGG - Intergenic
1137700709 16:50495844-50495866 GGAAGCAAGAATGAGGGGAAAGG - Intergenic
1138538439 16:57673254-57673276 GGCAGCAAGGATGAGGAGCAGGG - Intronic
1139353629 16:66353670-66353692 GGACACAAGCATGGTGAGGAAGG + Intergenic
1139708902 16:68761367-68761389 AGAAGCAAGCTTGAGGAGAAGGG - Intronic
1140455454 16:75102797-75102819 GGAGGAAAGCATGAGAAGGAAGG - Intronic
1141775746 16:86121705-86121727 AGGGACAAGGATGAGGAGGAAGG - Intergenic
1141775773 16:86121797-86121819 AGGGACAAGCAGGAGGAGGAAGG - Intergenic
1142251426 16:88993718-88993740 GGAAAGAGGAAGGAGGAGGAAGG - Intergenic
1143254904 17:5548851-5548873 ACAAACAAGCCTGAGAAGGAGGG - Intronic
1143355701 17:6326408-6326430 GGGAACAAGAATGACTAGGAAGG + Intergenic
1143362965 17:6386596-6386618 GGAAACAAGGATGATGAGAGAGG - Intergenic
1144046904 17:11462168-11462190 GGACAGAAGCAAGAGGGGGAGGG - Intronic
1144090185 17:11849418-11849440 GGGAAGAAGTATGAGGAGTATGG - Intronic
1144287240 17:13788610-13788632 GTTAACAAGGGTGAGGAGGAAGG - Intergenic
1144873298 17:18383310-18383332 GTAAACCAGCTGGAGGAGGACGG + Exonic
1145062063 17:19739683-19739705 GGAAACAAGCCAGAGTTGGACGG + Intronic
1145268062 17:21389987-21390009 GGAATGAGGCAGGAGGAGGAGGG - Intronic
1145831083 17:27916892-27916914 AGAAAGAAGAGTGAGGAGGAAGG + Intergenic
1146738795 17:35263036-35263058 GGAAACAAGGATGGTGAGGAAGG - Intronic
1147487882 17:40835894-40835916 AGAAACAATCATGAAGAGGCGGG - Exonic
1148002341 17:44397236-44397258 GGAAAAAAGCAGAGGGAGGAGGG + Intronic
1148135503 17:45289204-45289226 GGAGACAAGCCTGAGTGGGAAGG - Intronic
1148610990 17:48964483-48964505 GGAAACAAGGGTGCGGAGAAGGG + Intronic
1149633660 17:58148586-58148608 TGAGACAAGCATGGGGTGGAGGG + Intergenic
1152114190 17:78374899-78374921 GCAAGCAAGCTAGAGGAGGAGGG + Intergenic
1152266247 17:79296689-79296711 GGAAAAAAGGAAGAGGAGGAAGG - Intronic
1152420598 17:80190922-80190944 GGAAGCAAGCATGGGGTGGCGGG - Intronic
1152628414 17:81398886-81398908 CGAAAGATGCATGAGGGGGATGG + Intronic
1153266911 18:3280057-3280079 GGAAACAAGGCTGAGCTGGAGGG - Intergenic
1153537075 18:6113977-6113999 GGAAGAAAGCAAAAGGAGGAAGG - Intronic
1154462929 18:14613838-14613860 GGAGACAACCAAGAGGAGAAAGG - Intergenic
1156374676 18:36502781-36502803 GGAAACATGCATGTGGGGGTAGG - Intronic
1156957593 18:42987310-42987332 TGAAACAAGCATGTGCAGTATGG + Intronic
1157212368 18:45754567-45754589 GGATTGAAGCATGAGAAGGATGG - Intergenic
1157415679 18:47500777-47500799 GGAAACAAGGATGAAGGGGGAGG + Intergenic
1157445078 18:47738385-47738407 GGAAACACGCATGATGAAGCAGG + Intergenic
1157464690 18:47932858-47932880 GGAAACAAGGCAGAGGAGGTGGG - Intergenic
1157504477 18:48216974-48216996 GGACACCAGCATGCGCAGGAAGG + Intronic
1157775350 18:50390682-50390704 GAAAAAAAGGAGGAGGAGGAAGG - Intronic
1158889698 18:61861773-61861795 GGAAGCAAGGGTGAGGAGGCAGG + Intronic
1158939767 18:62396538-62396560 GGAAATAAGCATGGGGAAGGCGG - Intergenic
1158959378 18:62575975-62575997 GGAAACAGGCATGAGGCAGCTGG - Intronic
1158963126 18:62602783-62602805 GGCAACATGCATTAGGAGGCTGG + Intergenic
1159731455 18:72033294-72033316 GGGACCATGCAGGAGGAGGAGGG - Intergenic
1159822511 18:73164137-73164159 GGAAACAGGCATTTGGAGGGAGG + Intronic
1160345725 18:78130203-78130225 AGAATCAATCATCAGGAGGAAGG - Intergenic
1160974326 19:1785232-1785254 GAAACCAAGGCTGAGGAGGATGG + Exonic
1162024161 19:7884405-7884427 GGAAAGAGGGAGGAGGAGGAGGG + Intergenic
1162325889 19:9999167-9999189 GCAAGCAAGCAAGAGAAGGAAGG - Intronic
1162826084 19:13253107-13253129 GGAAAGAAGCAGGAGTAGCAGGG + Intronic
1163127280 19:15251157-15251179 GAACACAGGCAGGAGGAGGATGG - Intronic
1163542699 19:17920690-17920712 GGCAACAAGCATGAGGAAAAAGG - Intergenic
1163779766 19:19240107-19240129 GGGAAGAAGGATGGGGAGGAGGG - Intronic
1163896162 19:20061683-20061705 GGATTTTAGCATGAGGAGGAAGG + Intergenic
1164441732 19:28284611-28284633 GGAAAAAAGGGTGAGGGGGAAGG + Intergenic
1164591891 19:29511973-29511995 GGAAAGGAGGATGAGGAGGAAGG + Intergenic
1164591913 19:29512082-29512104 GAGAGCAAGGATGAGGAGGAAGG + Intergenic
1164592025 19:29512499-29512521 GAGAACAAGGATGAGGAGGAAGG + Intergenic
1164592065 19:29512643-29512665 GAGAACAAGAATGAGGAGGAAGG + Intergenic
1164592125 19:29512857-29512879 GGAGAGAGGGATGAGGAGGAAGG + Intergenic
1164592629 19:29514575-29514597 GGAGAGGAGGATGAGGAGGAAGG + Intergenic
1164592636 19:29514596-29514618 GGAAAGGGGGATGAGGAGGAAGG + Intergenic
1164718642 19:30415070-30415092 GGAAGAGAGCAGGAGGAGGAGGG - Intronic
1164916765 19:32058278-32058300 GGAACGAAGGAAGAGGAGGAAGG - Intergenic
1165238088 19:34439834-34439856 GAAAAAAAGAATGAGAAGGAAGG + Intronic
1166218687 19:41352387-41352409 GGAGACAAGCAATAGGGGGAGGG - Intronic
1166248217 19:41546115-41546137 GGGCACAAGCAAGTGGAGGAGGG - Intergenic
1167101379 19:47406256-47406278 GGATACATGGAGGAGGAGGATGG + Intronic
1167227015 19:48251921-48251943 GCAACCAAGCAGCAGGAGGATGG - Intronic
1167608170 19:50492802-50492824 GGAAAGAGGAAGGAGGAGGAGGG + Intergenic
1168245436 19:55110940-55110962 GGAAAAAAACAGGAGGAGAAAGG + Intronic
1168434244 19:56304686-56304708 GGAAAGAAGCGAGAGGGGGATGG + Intronic
925149063 2:1602188-1602210 GGAAGCCAGCATGAGGAGTCAGG + Intergenic
925528900 2:4837869-4837891 GGAACAAAGCAGGGGGAGGAAGG - Intergenic
926175151 2:10584199-10584221 GGAAAGGAGCATAAGAAGGAAGG - Intronic
926462592 2:13150548-13150570 GGAAGGAAGGATTAGGAGGATGG + Intergenic
926775523 2:16418813-16418835 GGACTCAAGCATGGGAAGGAAGG - Intergenic
926877212 2:17494702-17494724 GGGAACAGGCATGAGGTAGAAGG + Intergenic
926918515 2:17916352-17916374 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
927866204 2:26589262-26589284 GGAAAGAAGGAGGAGGAGGAAGG - Intronic
928328095 2:30335898-30335920 GGAAACAAGCATTCTGAGAAAGG - Intergenic
929035292 2:37685227-37685249 GGAAACAAGCAAGGGGGAGAAGG + Intronic
929458030 2:42079928-42079950 GGAAGGAAGCAGGGGGAGGAAGG + Intergenic
929458647 2:42085019-42085041 GGGAAGAAGAATAAGGAGGAGGG + Intergenic
929685606 2:44031498-44031520 GGAAAATGGCATGAGGAGAATGG + Intergenic
931099169 2:58976098-58976120 AGAAAGAACAATGAGGAGGAGGG + Intergenic
931898935 2:66766354-66766376 GGAAAGTAACATGAGGAGAAAGG - Intergenic
932019839 2:68073211-68073233 AGAAAAAAGCATGAGGAGTCAGG + Intronic
932128360 2:69165517-69165539 GGAGACAAGAAAGATGAGGAGGG + Intronic
932154484 2:69403676-69403698 GGAAAGAAGCATGAGATGGTGGG - Intronic
932467061 2:71930704-71930726 GGATGCAGGCATGAGGAAGAAGG - Intergenic
934865708 2:97808515-97808537 TGAAACAAGTATGGGGAGGAGGG - Intronic
934979893 2:98831098-98831120 GGGAGAAAGGATGAGGAGGATGG - Intronic
936855829 2:116956274-116956296 GGAAACAGGAATTAGGGGGAGGG - Intergenic
936962298 2:118088587-118088609 GGAAAGCGGCCTGAGGAGGAGGG + Intronic
937323665 2:120975991-120976013 GGGAACAGGCAGGAGGAGGAAGG - Intronic
937579086 2:123461538-123461560 GAAAAGAAGAAGGAGGAGGAGGG - Intergenic
937840228 2:126518054-126518076 CAGAACAAGCATGAGAAGGAAGG + Intergenic
938138631 2:128779354-128779376 GGTAACATGCATGCGGAGGCTGG - Intergenic
938816325 2:134908301-134908323 GGATAAACGCATGAGGGGGATGG + Intergenic
939543490 2:143522576-143522598 GGAAACAAGCATGTAGAGCAGGG + Intronic
939656315 2:144830546-144830568 AGAAACAACCAAGATGAGGAGGG - Intergenic
939727494 2:145740949-145740971 AGAAACATGCATGAGGAAAATGG + Intergenic
939966951 2:148619639-148619661 GGGAAAAAGGAGGAGGAGGAGGG - Intergenic
940492876 2:154387574-154387596 GGCTACAGGCATGAGGAGGGAGG - Intronic
942043739 2:172087249-172087271 GGTAAGAAGGAGGAGGAGGAGGG - Intronic
944995449 2:205288616-205288638 GGAAATAAACATGAGTAGAAAGG - Intronic
945630294 2:212266193-212266215 GGAAACTAATACGAGGAGGAGGG + Intronic
946217682 2:218198276-218198298 GGAGAGAAGCGGGAGGAGGAAGG + Intergenic
946335544 2:219032901-219032923 GGAACCAAGGCTGAGGAGGGTGG + Intronic
946398008 2:219453045-219453067 GGACAGAAGCATGTGGTGGAGGG - Intronic
946899120 2:224355381-224355403 AGAATGAAGAATGAGGAGGATGG - Intergenic
947838483 2:233191740-233191762 TGAACAAAGCATGAGGAGGGAGG + Intronic
948195206 2:236090567-236090589 GGAAACACGCTGCAGGAGGAAGG - Intronic
948228828 2:236334878-236334900 GGAGAGAGGCAAGAGGAGGAGGG + Intronic
948875541 2:240825370-240825392 GGAAAGGAGGAAGAGGAGGAGGG - Intergenic
948883582 2:240872283-240872305 GTGAACATGCAGGAGGAGGAGGG + Intronic
948883607 2:240872440-240872462 GTGAACATGCAGGAGGAGGAGGG + Intronic
1168831467 20:847377-847399 GGAGACAAGCATGAGGAGGGTGG + Intronic
1168848184 20:959389-959411 GGAAACAGGTCTGAGAAGGAAGG - Exonic
1169448072 20:5688772-5688794 GGAAACACCCGTGGGGAGGACGG - Intergenic
1169482610 20:5998388-5998410 GAACACAAGCAAGAGGAAGATGG - Intergenic
1169765571 20:9144655-9144677 AGAAAGAAGGAGGAGGAGGAGGG + Intronic
1169812495 20:9622474-9622496 TGAAGTAAACATGAGGAGGAGGG + Intronic
1170507239 20:17039928-17039950 GGAAATAAGAATGAGAAAGATGG + Intergenic
1170546040 20:17436635-17436657 GGAGACAAGGAGGTGGAGGAGGG - Intronic
1170948968 20:20917154-20917176 GCAAACATCCCTGAGGAGGAAGG + Intergenic
1171130967 20:22652648-22652670 GCACACAAGCACGAGGAGGAAGG + Intergenic
1171373040 20:24673968-24673990 GGAAACAAAGATGAGGAAGGGGG + Intergenic
1171424623 20:25041897-25041919 GGTCACCTGCATGAGGAGGAAGG + Intronic
1171781455 20:29422456-29422478 AGAAACAAGAAAGATGAGGAAGG + Intergenic
1173022864 20:39282746-39282768 GGAAACAAGCAGAGGCAGGAGGG - Intergenic
1173313161 20:41918308-41918330 TCAAACTAGCATGAGAAGGAAGG - Intergenic
1173853210 20:46232046-46232068 GGACACCAGCATCAGGAGGGAGG + Intronic
1174112243 20:48204856-48204878 GGAAAAAAGCATGAGCACGCAGG + Intergenic
1174701221 20:52611169-52611191 GGAAAGAAGGAGGACGAGGAAGG - Intergenic
1175291589 20:57879526-57879548 GGAAACAGGCATGGGAATGAGGG - Intergenic
1175293719 20:57894804-57894826 GGAAAGAAGAAGGAGGGGGAAGG + Intergenic
1175298903 20:57928861-57928883 GGAGACAAGAAGGAGGAGGAGGG - Intergenic
1175452092 20:59077925-59077947 GGGAAGAAGGAGGAGGAGGATGG + Intergenic
1175693074 20:61079966-61079988 GGAAAGAAGCTGGAGGTGGAAGG - Intergenic
1175771673 20:61628073-61628095 GGACACAACCCTGAGGAGGCTGG + Intronic
1175884368 20:62280633-62280655 GGAAACAAGTATGTGGAGTGCGG + Intronic
1176057103 20:63154728-63154750 GGAAGCAGGAAGGAGGAGGAGGG - Intergenic
1176419992 21:6506361-6506383 GGAACAAAGCAGGTGGAGGAGGG + Intergenic
1176717777 21:10368105-10368127 GGAATCAAGCAGGAGAAAGAAGG - Intergenic
1176811597 21:13544534-13544556 GGAGACAACCAAGAGGAGAAAGG + Intergenic
1177153978 21:17482820-17482842 GGGAACAAGCTTGGGGAGCAGGG + Intergenic
1177675163 21:24287792-24287814 GAAAAAAAGCAAGAGGCGGAAGG + Intergenic
1177678281 21:24331769-24331791 GGAGACAAGTATCAGGAGGGCGG + Intergenic
1177919927 21:27139755-27139777 GCAAACAAGCAGCAGGAGAAAGG - Intergenic
1178288540 21:31346491-31346513 GAAAACAATCATGAAGGGGATGG + Intronic
1178733717 21:35130153-35130175 GGAAACACGAATGAGAAGGCTGG + Intronic
1179173714 21:38992222-38992244 GGAAAAAAGCAAGAGGAGGTGGG + Intergenic
1179230373 21:39498703-39498725 GGAAACGGGCATGGGGACGATGG - Intronic
1179282396 21:39945090-39945112 GGAAACAAGGATAAAGAGAATGG - Intergenic
1179319460 21:40275921-40275943 GGAAACATGATTGAAGAGGATGG - Intronic
1179695483 21:43114681-43114703 GGAACAAAGCAGGTGGAGGAGGG + Intergenic
1179831659 21:44000753-44000775 GGAAACAAGTCTGAGGACGAGGG - Intergenic
1179878667 21:44284429-44284451 GGGAACAAACCTGGGGAGGAAGG - Intergenic
1180299004 22:11021011-11021033 GGAATCAAGCAGGAGAAAGAAGG - Intergenic
1181949321 22:26542687-26542709 GGAAACAGGCAGGTGGAGAAGGG + Intronic
1182666467 22:31963961-31963983 GGAAAAAACCAGGAAGAGGAAGG - Intergenic
1182676088 22:32041077-32041099 GATGACAAGCATGAGGAGTAAGG - Intergenic
1182897869 22:33873756-33873778 GGAAAGGAGGAGGAGGAGGAAGG - Intronic
1183062795 22:35346200-35346222 GGAAGCACCCAGGAGGAGGAGGG + Intronic
1183796283 22:40121087-40121109 GGAAGGAAGCATCAGGAGCAGGG + Intronic
1184244993 22:43231341-43231363 GGGAACAAGGATAATGAGGAGGG - Intronic
1184989903 22:48160292-48160314 AGAAAGAAGAAGGAGGAGGAGGG + Intergenic
1185040051 22:48499300-48499322 TGAAACAAGCAGGAAGATGAGGG - Intronic
949147710 3:722745-722767 GGAAAGTAGGATGAGAAGGAAGG - Intergenic
949672249 3:6412642-6412664 GGAAGCAATCATGAGAATGAGGG - Intergenic
949706072 3:6818305-6818327 GGAAGCAAGAAAGAGGAGGGAGG + Intronic
950205116 3:11074170-11074192 GGAAGCAATCATGAGAATGAGGG - Intergenic
950624052 3:14231316-14231338 GGAAAAAAGCAGGAGGATCAGGG - Intergenic
951101962 3:18698928-18698950 GAAAGCAAGAGTGAGGAGGAGGG + Intergenic
951134848 3:19093216-19093238 GGAAACAAGAAGGAGGAAGTTGG - Intergenic
951266438 3:20573451-20573473 GAAAAAAAGGATGAGGAGCATGG + Intergenic
952828654 3:37545069-37545091 GGAAGCAAGGATGAGGGGAAGGG + Intronic
953035368 3:39206326-39206348 GTAAAGAGGAATGAGGAGGAGGG + Intergenic
953122352 3:40057156-40057178 GGAACCAAGCATGAAGGTGAAGG - Intronic
953374306 3:42415829-42415851 GGAAAGGAGGAGGAGGAGGAAGG + Intergenic
953383555 3:42492172-42492194 GGAAGGAAGGATGAGGAGGGTGG - Intronic
954667481 3:52264683-52264705 GGAAGCAAGCAGAAAGAGGAAGG + Intronic
954789216 3:53118648-53118670 GCAAACAAGCATGGAGAGAAGGG + Intronic
954936149 3:54328825-54328847 GGGAACAGTCCTGAGGAGGAGGG + Intronic
955373049 3:58370282-58370304 GGGAAGAAGCATGAGCTGGAAGG + Intronic
955377353 3:58409196-58409218 GGAAACAAACATGTCCAGGAAGG + Intronic
955840475 3:63107469-63107491 GGTAAAAAGCTTGAGGGGGAAGG - Intergenic
956629677 3:71303865-71303887 GGAAACAAGAAAGAAAAGGAAGG + Intronic
956878381 3:73486377-73486399 GGAGAAGAGCATGAGGTGGAAGG + Intronic
957024443 3:75165579-75165601 AGAAACAGCCATGAAGAGGAGGG + Intergenic
958575134 3:95939541-95939563 GGAAACTGGCACAAGGAGGAGGG - Intergenic
958984219 3:100761605-100761627 GAAAACAAGCAGGAGAAGGTTGG + Intronic
959293422 3:104503327-104503349 AGACACAAGCGTGAGGAGGCTGG - Intergenic
960354628 3:116636292-116636314 GGAAAGAGGTATGGGGAGGAAGG - Intronic
960493083 3:118341139-118341161 GGAAACAAGCCTCAGAAGAAAGG + Intergenic
961193611 3:124983086-124983108 GGAACCAAGGAAGTGGAGGAAGG - Intronic
961345491 3:126260800-126260822 GGAAAGAAGGGTGGGGAGGAGGG - Intergenic
961638331 3:128349071-128349093 GGAAACAGGAAGGTGGAGGAGGG + Intronic
962102034 3:132352773-132352795 GGCAAGAAGCATAGGGAGGAAGG - Exonic
962280624 3:134049144-134049166 GGAAAGGAGAATGAGGAGAATGG - Intronic
962459017 3:135591667-135591689 GGAGTCAGGCCTGAGGAGGAGGG - Intergenic
962511055 3:136101041-136101063 AGAAACAAGAATTAGGAGAAAGG + Intronic
962880426 3:139571771-139571793 GGAACCAAGAATTAAGAGGAAGG + Intronic
963027155 3:140931269-140931291 AGAAACACGAATGAGGGGGAAGG + Intergenic
964629884 3:158799079-158799101 GGTAACAAGCTTGATTAGGATGG + Intronic
964869097 3:161293471-161293493 GAATACAAGCAAGAGGAGAAAGG - Intergenic
966202468 3:177371602-177371624 GGAACTAAGGATGAGGAGGGTGG - Intergenic
966828976 3:183989677-183989699 GGAAAAACAGATGAGGAGGACGG - Intronic
967006066 3:185383588-185383610 GGAAGCAAGAGTGAGGTGGAAGG - Intronic
967030942 3:185606074-185606096 GGAAATGGGCATGAAGAGGAAGG + Intronic
967240577 3:187435585-187435607 GCAATCAAGCATAAGCAGGATGG - Intergenic
967258602 3:187619405-187619427 AGAGACAAGGCTGAGGAGGAGGG - Intergenic
969474105 4:7411521-7411543 GGAAGGAAGAATGAGAAGGAGGG - Intronic
970162080 4:13199026-13199048 GAGAACAAGGATGAAGAGGAAGG + Intergenic
970692489 4:18635461-18635483 GGAAAAAAAAATGAGGAGGTGGG - Intergenic
970952594 4:21774630-21774652 GGAAAAAAGAATGAAAAGGAAGG - Intronic
971567338 4:28161899-28161921 GGAAAGAAGGATGAGAAGGAGGG + Intergenic
971866226 4:32176394-32176416 GGAAGCAAGCCTGAGGACCAAGG - Intergenic
972382899 4:38535917-38535939 TGATACAAGGATGAGAAGGAGGG - Intergenic
972419417 4:38872611-38872633 GGACACAACAATGAGGAGAATGG - Intronic
973122363 4:46537922-46537944 GTAAACAAGCATGATTAAGAAGG + Intergenic
974878635 4:67727177-67727199 GGAAACAACCATGAGGAAGCAGG - Intergenic
975656978 4:76651308-76651330 GGAAAGATGCTTGAGGGGGATGG + Intronic
976221915 4:82762903-82762925 GGAAAGTAGAATGGGGAGGAAGG - Intronic
976877766 4:89876579-89876601 GGAAACAGCCATGGGGAGAAGGG + Intergenic
976987863 4:91325446-91325468 GAAAACAATCAAGAGAAGGAAGG + Intronic
977051516 4:92133860-92133882 GAAAAAAAAAATGAGGAGGAGGG + Intergenic
978382278 4:108141880-108141902 GGAAGCAAGAATGAAGGGGAGGG + Intronic
978419865 4:108519857-108519879 TGAAACACTCATGAGAAGGAGGG + Intergenic
978578877 4:110213022-110213044 GGAAAGAAGGAAGAGAAGGACGG + Intergenic
978816095 4:112907496-112907518 TGAAAGTAGGATGAGGAGGAGGG - Intronic
978828176 4:113049624-113049646 GGAAAGCAGGAGGAGGAGGAGGG - Intronic
979558946 4:122080473-122080495 GGAAAGAAGAAAGAGGAGGGAGG + Intergenic
981886143 4:149675337-149675359 GGAAACAGCAATGAGGAGCAAGG + Intergenic
982010244 4:151099183-151099205 GGAAACAAGCGTGGAGAGGTCGG + Intergenic
982257736 4:153466622-153466644 GGAAAGGGGCAGGAGGAGGAAGG + Intronic
982564369 4:156970750-156970772 AGAAACAAGCAGGGGGAGAATGG + Intronic
984247396 4:177291637-177291659 GGAAGTCATCATGAGGAGGACGG + Intergenic
984790445 4:183610050-183610072 GCAAATAAGCATGTAGAGGATGG - Intergenic
985707850 5:1411650-1411672 AGAAACAAGGAGGAGCAGGAGGG + Intronic
986191727 5:5502703-5502725 GGAACCAAGCAGGAGGAGGAAGG + Intergenic
986294401 5:6424952-6424974 GGAAAGAAGAAAGAGAAGGAAGG - Intergenic
986294404 5:6424977-6424999 GGAAAGAAGAAAGAGAAGGAAGG - Intergenic
987317571 5:16738231-16738253 GGAACCAGTCAAGAGGAGGAGGG + Intronic
988181413 5:27799030-27799052 GGAAAGAAGGAAGGGGAGGAAGG + Intergenic
989107313 5:37875861-37875883 GGAGGCAAGCATGAGGAAGATGG - Intergenic
989221118 5:38965791-38965813 GAAAACAAGGGTGGGGAGGAGGG + Intronic
989771409 5:45150998-45151020 GGAAACAGGCATGAGTAAAATGG - Intergenic
991500507 5:67271985-67272007 GGAAACGAGCATGGGTAGGTTGG + Intergenic
991979778 5:72218882-72218904 GGAAGGAATCCTGAGGAGGAGGG + Intergenic
992133645 5:73720549-73720571 GGGAAAATGCAAGAGGAGGAAGG + Intronic
992504578 5:77374198-77374220 GCAAACAAGCATAAGAAGGCTGG - Intronic
992546464 5:77818694-77818716 GGAGAGGAGAATGAGGAGGAGGG - Intronic
993642377 5:90421063-90421085 GGATACAAGCAAGAGAAGGCAGG + Intergenic
993870068 5:93242071-93242093 GGAAACAAGGACTAGGAAGAGGG + Intergenic
995016788 5:107318875-107318897 GAAAAGAAGGAGGAGGAGGAAGG + Intergenic
995402980 5:111762401-111762423 GGAAGGAAGCATGAGGAAAAGGG - Intronic
995854694 5:116578718-116578740 TGAAAGCAGCATGAGGAGCAAGG - Intergenic
997206771 5:132054778-132054800 AGGAAGAAGGATGAGGAGGAGGG + Intergenic
997415950 5:133728804-133728826 GGAAAGAAGGAAGAGAAGGAAGG + Intergenic
997619530 5:135276564-135276586 GAAAAAAAGGAGGAGGAGGAAGG - Intronic
998034909 5:138906991-138907013 AGAAAGAAGGAGGAGGAGGAAGG - Intronic
998365620 5:141628908-141628930 GGGAATAGCCATGAGGAGGAGGG + Intronic
998482338 5:142473396-142473418 GGTTACAAGGATGAGGAGGTGGG - Intergenic
998952663 5:147407341-147407363 GGAGACAGGAATAAGGAGGAGGG + Intronic
999445428 5:151634961-151634983 GGAAAGAAGGAAGAGAAGGAAGG + Intergenic
999502224 5:152158977-152158999 GGAAAAAAGAATGAAAAGGAAGG - Intergenic
1001108406 5:168875303-168875325 AGAAAGAAGAAAGAGGAGGAAGG + Intronic
1001937429 5:175715298-175715320 GGAAAGAAGGGAGAGGAGGAGGG + Intergenic
1002028505 5:176411843-176411865 GGAAGAAAGCATGGGGATGAGGG - Intronic
1002894872 6:1372092-1372114 AGAAAGCAGCATGAGGAGGCAGG + Intergenic
1002899534 6:1399407-1399429 GGAAGAAAGGAGGAGGAGGAAGG + Intergenic
1003781126 6:9428294-9428316 GGAAATAACCATGAGGAGAAAGG + Intergenic
1005347617 6:24905877-24905899 GGAGACAAGCTTGAAGAGAATGG + Intronic
1006332349 6:33401029-33401051 GAAAAAAAGCATGAGGAATAAGG - Intronic
1006360918 6:33586608-33586630 GGGAACAGGCAGGAGTAGGATGG - Intergenic
1006373764 6:33660445-33660467 GGTAAGAAGGATGAGGAGGGTGG - Intronic
1007254073 6:40516426-40516448 GGAAACAGGAATGAGGATGCTGG + Intronic
1007797344 6:44360583-44360605 GCACAGAAGCATGTGGAGGAGGG - Intronic
1008065540 6:47043857-47043879 GAAAACAAGCAGAAGGAGAATGG - Intergenic
1008958483 6:57241608-57241630 GGAAACAAGAATTGGGGGGATGG + Intergenic
1009517141 6:64634865-64634887 GATAACAAGCATGATGGGGATGG + Intronic
1009899532 6:69795197-69795219 GGATAAAAGCATTAGGAAGAAGG - Intronic
1010298662 6:74232099-74232121 GGAAGGAAGGAAGAGGAGGAAGG - Intergenic
1010843570 6:80677861-80677883 GGAAGCAAGAGTGAGGAGGCAGG - Intergenic
1011183740 6:84651257-84651279 GGAAACAGACTAGAGGAGGATGG - Intergenic
1011626950 6:89290671-89290693 AGAACCAAGCAGGAGGTGGAGGG - Intronic
1012863291 6:104588019-104588041 GGAAACATGCTTGAGATGGAAGG - Intergenic
1013850822 6:114513273-114513295 GAAAGCAAGGGTGAGGAGGAAGG - Intergenic
1013914180 6:115314333-115314355 GGAAAGAAGGGTGAGGAGTATGG + Intergenic
1014192483 6:118513479-118513501 GGAGACAAAGATGAAGAGGATGG + Intronic
1014207566 6:118672779-118672801 AGAAAGAAGAAGGAGGAGGAAGG + Intronic
1014495042 6:122111094-122111116 GAAAGCAATCATGAGGAGGAGGG - Intergenic
1015804238 6:137092365-137092387 GGAGAGAAACAGGAGGAGGAAGG - Intergenic
1015818426 6:137234227-137234249 GAAAACAAGGAAGTGGAGGAAGG + Intergenic
1015847563 6:137536701-137536723 AAAAACAAGGATGAAGAGGAAGG - Intergenic
1015882556 6:137883612-137883634 GAAAACAAGAGGGAGGAGGAGGG + Intergenic
1018005218 6:159615797-159615819 GGAAATAAGAATGAGGAAGGAGG + Intergenic
1018844646 6:167547300-167547322 GGAGACAGGCAGGAGGAGGGAGG - Intergenic
1018936204 6:168275493-168275515 CGAGACAAGCATGTGGAGGTGGG + Intergenic
1019879687 7:3847547-3847569 AGAAGCAGGCAAGAGGAGGAAGG - Intronic
1020004328 7:4774325-4774347 GGAAGGAAGGAGGAGGAGGAGGG - Intronic
1020421006 7:8005385-8005407 TGAAAGCAGCAAGAGGAGGAGGG + Intronic
1020571623 7:9870774-9870796 GGAGAGAAGCATCAGGAGAAAGG + Intergenic
1020594758 7:10191946-10191968 TGAAACAAGAGTGAGTAGGAAGG - Intergenic
1020906017 7:14065658-14065680 AAAAAAAAGAATGAGGAGGAAGG - Intergenic
1021530348 7:21637248-21637270 GGAGACAAGTAGGAGGAGGTGGG - Intronic
1021851588 7:24814012-24814034 GGAGTCAAGGATGATGAGGAGGG + Intronic
1022388097 7:29920574-29920596 GGAAGGAAGCACGTGGAGGAGGG - Intronic
1022436088 7:30387091-30387113 GGAAACAAACATGATGAGGTAGG - Intronic
1022522357 7:31016449-31016471 GGAAGGAAGGGTGAGGAGGAAGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022847139 7:34221662-34221684 GGAAATAAACATGACCAGGAAGG + Intergenic
1023043776 7:36194501-36194523 GGTAACAAGCCTGGGAAGGAAGG - Intronic
1026461565 7:70619424-70619446 GATAACAAGCATGAAGAGCATGG - Intronic
1026528508 7:71176513-71176535 GGAAAAGGGAATGAGGAGGATGG + Intronic
1027364236 7:77440648-77440670 GGAAATAAGGATGAAGAGGCAGG + Intergenic
1027409096 7:77894731-77894753 GGAGACAAGCCTGGGGAGGTTGG + Intronic
1028897031 7:96053475-96053497 GGAACCAAGAAGGATGAGGAAGG - Intronic
1029041356 7:97579936-97579958 AGAAATAGGCATGAGGAGAAAGG + Intergenic
1029536067 7:101158581-101158603 GGAAAGATGCAAGAGGAAGAGGG + Intronic
1030658088 7:112190446-112190468 GTAAAGAAGCAGGAGGTGGATGG + Intronic
1031893879 7:127325673-127325695 GAAAGAAAGCATGGGGAGGAGGG - Intergenic
1032503333 7:132416510-132416532 GGGATCAAGGATGAGGATGATGG - Intronic
1032672629 7:134099292-134099314 GGGACAAAGCATGAGGCGGATGG - Intergenic
1033008481 7:137593112-137593134 AGAAATAAGCATGAAGTGGATGG + Intronic
1033124787 7:138698127-138698149 GGAATGAAGCAAGAGGAGGAAGG + Intronic
1033479071 7:141721126-141721148 GGAATGAACTATGAGGAGGAGGG - Intronic
1033840031 7:145361445-145361467 GCAAACAACTATGAGGAAGAGGG + Intergenic
1037005115 8:13768476-13768498 TGAAATAAGCATGAGAATGAAGG + Intergenic
1037041099 8:14235448-14235470 AGAAAATAGCAAGAGGAGGACGG - Intronic
1037181254 8:16007980-16008002 AGAAACAATCATGAATAGGAAGG - Intergenic
1037450161 8:19008845-19008867 TGAAACAATGAGGAGGAGGATGG - Intronic
1037691233 8:21183258-21183280 GGAGAGAAGGAGGAGGAGGAAGG - Intergenic
1037753390 8:21696865-21696887 GGAAACAGGAAAGAGGAAGAGGG + Intronic
1038047809 8:23781065-23781087 GTAAACAAACAAGTGGAGGAAGG - Intergenic
1038367531 8:26951566-26951588 GGAAAGAAGGAAGAGAAGGAAGG - Intergenic
1038429265 8:27486593-27486615 GGAAACAGGCCAGAGGAGAAGGG - Intergenic
1038572946 8:28678769-28678791 CAAAACAAGCATGGGGAGAAGGG + Intronic
1039044463 8:33437268-33437290 GGAAGCAAGAGTGAGGGGGAAGG - Intronic
1039317309 8:36387812-36387834 GGAGAAGAGCAGGAGGAGGAAGG - Intergenic
1040387493 8:46923429-46923451 GGAAACCAGAATGAGGAGTGAGG + Intergenic
1040399141 8:47030617-47030639 GGAAACCAGCATAAGGAAAAGGG - Intergenic
1040718817 8:50292203-50292225 GGAAACAAGCCAGATGAGTAAGG + Intronic
1040840765 8:51781929-51781951 GGAAGTCACCATGAGGAGGATGG - Intronic
1041026399 8:53691059-53691081 GGAAAAAGGCATGCAGAGGAGGG + Intergenic
1041214967 8:55591321-55591343 GAAGACAAGCAGGGGGAGGATGG + Intergenic
1041441776 8:57904792-57904814 GGGAAGAAGCAAGAGGAAGAGGG + Intergenic
1042878440 8:73461663-73461685 GGCAGCAAGTAGGAGGAGGATGG + Intronic
1043915130 8:85914009-85914031 GGAAGGAAGCATCAGGAGTAGGG - Intergenic
1044087612 8:87959719-87959741 GGAAAAAAGCAGGAGGGAGAAGG - Intergenic
1044326424 8:90864327-90864349 GGAAACAAGGAAGAGAGGGAGGG + Intronic
1045737953 8:105318587-105318609 GGAAAGAAGGAAGAGAAGGAGGG - Intronic
1046888245 8:119392869-119392891 AGAAAGAAGAAAGAGGAGGAAGG - Intergenic
1047276978 8:123413246-123413268 GGAAAGAAGAATGAGGAAGCAGG - Intronic
1047336405 8:123940762-123940784 GGAAATAAGCTTCAGGAGTAGGG - Intronic
1048237220 8:132702886-132702908 GGAAACAAGGAAGATTAGGAAGG + Intronic
1048292766 8:133192991-133193013 TGAAACAAGCATGGGGTGGGTGG - Intronic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1048709648 8:137195156-137195178 AGAAAAAAGAAAGAGGAGGAGGG + Intergenic
1049003331 8:139839654-139839676 GGAAACAAGCAGTGGGAAGAAGG - Intronic
1049052050 8:140205923-140205945 GGAAATAAGACTGAGGATGAGGG - Intronic
1049542839 8:143216126-143216148 GGCACCAAGTATGAAGAGGATGG + Intergenic
1049932522 9:470558-470580 GAAAGGAAGCAGGAGGAGGAGGG + Intronic
1050233648 9:3555611-3555633 GGAACAAAGCAGGAGGAAGAAGG - Intergenic
1050296720 9:4212651-4212673 GGAAACAAGGATGAGGCCAAAGG + Intronic
1050313510 9:4377255-4377277 GGAACAAAGCAGGAGGAAGAAGG + Intergenic
1050469560 9:5972607-5972629 GGTAACAAGAGAGAGGAGGAAGG - Intronic
1050475921 9:6041008-6041030 AGAAAGAGGAATGAGGAGGAAGG - Intergenic
1050854576 9:10336381-10336403 GGAAACGAGCATGAGGATTATGG + Intronic
1052003685 9:23320234-23320256 AGAAAGAAGGAAGAGGAGGAGGG + Intergenic
1052096435 9:24390169-24390191 GGAAAAAAGAATGAAAAGGAAGG - Intergenic
1053454789 9:38225713-38225735 GGACACAAAAATTAGGAGGAAGG + Intergenic
1053885766 9:42644329-42644351 GGGAACAGGGATGAGCAGGAAGG - Intergenic
1054224784 9:62451778-62451800 GGGAACAGGGATGAGCAGGAAGG - Intergenic
1055737753 9:79350545-79350567 TTAAACAAGCTTGGGGAGGAAGG - Intergenic
1055759548 9:79591874-79591896 TGAAAGAAGGAAGAGGAGGAGGG + Intronic
1056098079 9:83274549-83274571 GGGAACCAGCACGAGAAGGAAGG + Intronic
1056236970 9:84604361-84604383 GAAAAGAAGAAGGAGGAGGAGGG - Intergenic
1056554641 9:87678358-87678380 GGACACAGGCAGGAGGAGGCTGG + Intronic
1056881224 9:90395821-90395843 GGAAACAAGCATCAGACTGAGGG - Intergenic
1057525869 9:95800594-95800616 GGGACCAGGTATGAGGAGGAGGG + Intergenic
1057837558 9:98457567-98457589 GGGTACAAGGATCAGGAGGAGGG + Intronic
1058384430 9:104417271-104417293 GGAGACAAGCATGATGAAGAGGG - Intergenic
1058746359 9:107995096-107995118 GCAGAAAAGCATGAGGAGGGAGG - Intergenic
1058908618 9:109500215-109500237 GCAAACTGGCATGAGGATGACGG - Intergenic
1058985876 9:110207933-110207955 GGAGACAGGCAGGAGGAGGCAGG + Exonic
1059165572 9:112073515-112073537 GGAAACCAGAGAGAGGAGGATGG - Intronic
1059794188 9:117673473-117673495 GGAAACAAACTTGAAGAAGAAGG - Intergenic
1060278441 9:122199636-122199658 GGAGGCAAGCATGAGGAGTCTGG - Intronic
1060643630 9:125259986-125260008 TGAAATAAGCAAGAGGAGGCCGG - Intergenic
1061222736 9:129261700-129261722 GGAAACAAGCTTGAGGAGAGAGG + Intergenic
1061802262 9:133119155-133119177 GGAAACAGGGATGCGGGGGAAGG + Intronic
1062293300 9:135807959-135807981 GGAAAACGGCACGAGGAGGAAGG + Intergenic
1185664054 X:1750292-1750314 GGAAGCAAGCAGGGTGAGGATGG + Intergenic
1185939071 X:4294061-4294083 GGAAGCAAGGAAGAGGAGGAGGG - Intergenic
1186746143 X:12571433-12571455 GGAAACAGGCAGGAAGAGGGAGG - Intronic
1187025685 X:15433659-15433681 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025690 X:15433682-15433704 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025695 X:15433705-15433727 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025700 X:15433728-15433750 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025705 X:15433751-15433773 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025710 X:15433774-15433796 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025715 X:15433797-15433819 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025720 X:15433820-15433842 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025725 X:15433843-15433865 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025734 X:15433886-15433908 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025741 X:15433909-15433931 GGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025752 X:15433955-15433977 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025770 X:15434041-15434063 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025791 X:15434127-15434149 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1188787413 X:34365389-34365411 GGTAAAATGCATGTGGAGGAGGG - Intergenic
1189033631 X:37474466-37474488 GCAAACAAGGATAAGGAGGCTGG + Intronic
1189058663 X:37728212-37728234 GAATACAAGCATGAAGAGAATGG - Exonic
1190558626 X:51664712-51664734 GGGAACAAGCATGAGGTGTGAGG - Intergenic
1190831573 X:54063577-54063599 GGAATCAAGCTGGAGGAGGATGG + Intergenic
1192190359 X:68987686-68987708 GGAAACAAGGATGAGTATGGTGG + Intergenic
1192561388 X:72130288-72130310 AGGAACAAGAATGAGGAGGAAGG - Exonic
1192589405 X:72347350-72347372 GGAAGTAAGGAGGAGGAGGAGGG - Intronic
1192619451 X:72662657-72662679 GTAGACATGCATGAGGAGAAGGG - Intronic
1193074982 X:77346004-77346026 GGTAAAAAGGATGGGGAGGACGG - Intergenic
1194672327 X:96749785-96749807 GTACACAAACATGAGGATGAGGG - Intronic
1195839385 X:109156393-109156415 GGAAAAAAGGATGAGAAGAAGGG - Intergenic
1195907107 X:109854955-109854977 GGAAACAGGGATTGGGAGGATGG + Intergenic
1196144786 X:112304818-112304840 GGAAAGAAGCATGAGGAAAGGGG - Intergenic
1196322858 X:114363250-114363272 GGCAATAAGAATGAAGAGGAAGG + Intergenic
1196635214 X:117994221-117994243 GGAAAGAAGGAAGAGGGGGAGGG - Intronic
1196719408 X:118839629-118839651 CGAAACAAGCAGGCGGTGGAGGG - Intergenic
1196890648 X:120287714-120287736 GGAAGCAAGCCTCAGGAGGAGGG + Intronic
1196938261 X:120751057-120751079 GGAGACAGGCATGAGCAGGGTGG - Intergenic
1197130908 X:123004566-123004588 GGAAAGGAGCAGGAGGAGGTAGG - Intergenic
1197772841 X:130100416-130100438 GGAAACAAGCCGGAGTAGGTAGG - Intronic
1197859147 X:130950770-130950792 GGTGAGAAGCATGATGAGGAGGG + Intergenic
1198665867 X:139022133-139022155 GGACAGGAGCAAGAGGAGGAAGG + Intronic
1198852251 X:140977330-140977352 GAAAATAAGAAAGAGGAGGAGGG - Intergenic
1199251081 X:145662463-145662485 GGAAGCAAGCATGAGAGGCACGG + Intergenic
1199506950 X:148573600-148573622 AGAAAAAAACATGTGGAGGAAGG + Intronic
1199618113 X:149675083-149675105 GGAAAGAAGCCAGAGGGGGAGGG - Intergenic
1199624529 X:149728166-149728188 GGAAAGAAGCCAGAGGGGGAGGG + Intergenic
1199860555 X:151797217-151797239 GGAGCCAGGGATGAGGAGGATGG - Intergenic
1199988312 X:152968511-152968533 TGAAAGAAGCAGGAGGAGCAGGG + Intronic
1200988366 Y:9326483-9326505 GGACACAGGCATGGGGAGCAGGG - Intergenic
1201490814 Y:14539580-14539602 GGAAACAAGTTAGAGGAGGGAGG - Intronic