ID: 1103594500

View in Genome Browser
Species Human (GRCh38)
Location 12:122015912-122015934
Sequence CCTGTAGTCCCGGCCTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1203
Summary {0: 1, 1: 0, 2: 14, 3: 165, 4: 1023}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103594489_1103594500 23 Left 1103594489 12:122015866-122015888 CCCCCCCGCCTTACAATAAAGAA 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1103594500 12:122015912-122015934 CCTGTAGTCCCGGCCTCCTCAGG 0: 1
1: 0
2: 14
3: 165
4: 1023
1103594488_1103594500 24 Left 1103594488 12:122015865-122015887 CCCCCCCCGCCTTACAATAAAGA 0: 1
1: 0
2: 1
3: 10
4: 115
Right 1103594500 12:122015912-122015934 CCTGTAGTCCCGGCCTCCTCAGG 0: 1
1: 0
2: 14
3: 165
4: 1023
1103594491_1103594500 21 Left 1103594491 12:122015868-122015890 CCCCCGCCTTACAATAAAGAAAA 0: 1
1: 0
2: 0
3: 22
4: 309
Right 1103594500 12:122015912-122015934 CCTGTAGTCCCGGCCTCCTCAGG 0: 1
1: 0
2: 14
3: 165
4: 1023
1103594492_1103594500 20 Left 1103594492 12:122015869-122015891 CCCCGCCTTACAATAAAGAAAAA 0: 1
1: 0
2: 1
3: 39
4: 791
Right 1103594500 12:122015912-122015934 CCTGTAGTCCCGGCCTCCTCAGG 0: 1
1: 0
2: 14
3: 165
4: 1023
1103594494_1103594500 18 Left 1103594494 12:122015871-122015893 CCGCCTTACAATAAAGAAAAAAA 0: 1
1: 0
2: 16
3: 432
4: 10291
Right 1103594500 12:122015912-122015934 CCTGTAGTCCCGGCCTCCTCAGG 0: 1
1: 0
2: 14
3: 165
4: 1023
1103594493_1103594500 19 Left 1103594493 12:122015870-122015892 CCCGCCTTACAATAAAGAAAAAA 0: 1
1: 0
2: 12
3: 239
4: 3999
Right 1103594500 12:122015912-122015934 CCTGTAGTCCCGGCCTCCTCAGG 0: 1
1: 0
2: 14
3: 165
4: 1023
1103594490_1103594500 22 Left 1103594490 12:122015867-122015889 CCCCCCGCCTTACAATAAAGAAA 0: 1
1: 0
2: 0
3: 7
4: 160
Right 1103594500 12:122015912-122015934 CCTGTAGTCCCGGCCTCCTCAGG 0: 1
1: 0
2: 14
3: 165
4: 1023
1103594495_1103594500 15 Left 1103594495 12:122015874-122015896 CCTTACAATAAAGAAAAAAAAAA 0: 1
1: 5
2: 212
3: 3258
4: 43019
Right 1103594500 12:122015912-122015934 CCTGTAGTCCCGGCCTCCTCAGG 0: 1
1: 0
2: 14
3: 165
4: 1023

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103594500 Original CRISPR CCTGTAGTCCCGGCCTCCTC AGG Intergenic
900087840 1:906980-907002 CCTGCACTTCTGGCCTCCTCGGG - Intergenic
900229628 1:1550052-1550074 CCTGTGATTCCAGCCTCCTCCGG + Intronic
900287237 1:1907529-1907551 CCTGCAGGCCCAGCCTCCCCAGG - Intergenic
900476967 1:2880469-2880491 CCTGTAGCTGCGGCCTCCACAGG + Intergenic
900913030 1:5615615-5615637 CCTGTTGTCCCGGCCTTCAGTGG - Intergenic
901230548 1:7639647-7639669 CCTGTAGTCCCAGCCTCAGGAGG + Intronic
901297991 1:8175513-8175535 CCTGTAGTCCCAGCTAACTCAGG + Intergenic
901842331 1:11961731-11961753 CCTGTAGTCCCAGCTTCTTGGGG - Intronic
902284243 1:15396194-15396216 CCTATAGTCCCAGCTTACTCGGG + Intronic
902292416 1:15444130-15444152 CCTGTAGTCCCAAACTACTCAGG + Intronic
902419379 1:16266359-16266381 CCTGTAGTCCCCAGCTACTCAGG + Intronic
902595102 1:17504136-17504158 CCTGTAGTCCCAGCTACCTGGGG + Intergenic
903381462 1:22899867-22899889 CCTGTAGTCCCAAGCTACTCAGG + Intronic
903585147 1:24409234-24409256 CCTGTAGTCCCAGCTACCTTAGG + Intronic
903632528 1:24787043-24787065 CCTGTGGTCCCAGGCTACTCAGG - Intronic
903760711 1:25696339-25696361 CAGGTAGTCCCGGCCCTCTCAGG - Intronic
903897569 1:26618447-26618469 CCTGTGGTCCCAGCTTACTCAGG - Intergenic
903936164 1:26896574-26896596 CCTGAAGTCCCAGCTTACTCGGG + Intronic
904166610 1:28560403-28560425 CCTGTAGTCCCAGCTTACTCGGG - Intronic
904178140 1:28645841-28645863 CCTGTAGTCCCAAGCTACTCAGG + Intergenic
904550537 1:31313200-31313222 CCTGTAGTCCCAGCTACCTCGGG - Intronic
905221647 1:36451965-36451987 CCTGTAATCCCAGCTTACTCAGG - Intergenic
905249889 1:36641336-36641358 CCTGTAGTCCCAGCTTACTTGGG + Intergenic
905374501 1:37510199-37510221 CCTGTAATCCCAGGCTACTCTGG - Intronic
905451216 1:38057908-38057930 CCTGTAGTCCCCAGCTACTCAGG - Intergenic
905723493 1:40228159-40228181 CCTGTAGTCCCCAGCTACTCAGG + Intronic
905779810 1:40698549-40698571 CCTGTAGTCCCAAGCTACTCAGG - Intronic
906306438 1:44722948-44722970 CCTGTAATCCCAGCCTACTCGGG + Intronic
906438944 1:45823457-45823479 CCTGTAACCCCGGCTTACTCGGG - Intronic
906486197 1:46237280-46237302 CCTGTAGTCCCAGCCACTTGGGG - Intergenic
907032264 1:51184017-51184039 CCTGTAGTCCCAGCTTCTTGGGG - Intergenic
907041679 1:51266584-51266606 CCTGTAGTCCCAGCTACCTCGGG - Intronic
907056476 1:51373657-51373679 CCTGTAGTTCTGGCATTCTCAGG + Intronic
907153542 1:52310987-52311009 CCTGTAGTCCCAGCTTCTTCAGG - Intronic
907175093 1:52513275-52513297 CCTGTAGTCCCAAGCTACTCGGG + Intronic
907178070 1:52544161-52544183 CCTGTAGTCCCAGGCTACTCGGG + Intronic
907342588 1:53747451-53747473 CCTATAGTCCCAGCCTCTTGGGG + Intergenic
907482284 1:54753735-54753757 CCTGTAGTCCCAAGCTACTCAGG + Intergenic
908104511 1:60827672-60827694 CCTGTAGTCCCAGCTACCTCAGG - Intergenic
908240882 1:62188150-62188172 CCTGTAGTCCCAGCTACCTGGGG - Intergenic
908446993 1:64208479-64208501 CCTGTAGTCCCAGCTACTTCAGG + Intronic
908824340 1:68118749-68118771 CCTGTAATCCCAGGCTACTCAGG + Intronic
910021000 1:82589464-82589486 CCTGTAGTCCCAGCTGACTCGGG - Intergenic
910223335 1:84912060-84912082 CCTGTAGTCCCAGCTACCTGGGG - Intergenic
910691745 1:89972595-89972617 CCTGTAGTCCCAGCTACCCCGGG + Intergenic
910893905 1:92047283-92047305 CCTGTAGTCCCAGCTACCTGGGG + Intronic
910989775 1:93043053-93043075 CCTGTAGTCCCAGCTACCTGTGG - Intergenic
911076033 1:93876078-93876100 CCTGTAGTCCCAGCCACCCAGGG - Intronic
911313222 1:96323434-96323456 CCTGTAGTCCCAGCTTCCCAAGG + Intergenic
911408502 1:97471711-97471733 CCTGTAATCCCAGCTACCTCGGG - Intronic
911746761 1:101449322-101449344 CCTGTAGTCCCAGCTACCTCAGG - Intergenic
912351616 1:109019257-109019279 CCTGTAATCCCAGCTTACTCGGG + Intronic
912388814 1:109287411-109287433 CCTGTAGTCCCAGCCACTTGAGG - Intergenic
912693968 1:111826867-111826889 CCTGTAGTACCAGCCTCATAGGG - Intronic
913004194 1:114612475-114612497 CCTGTAGTCCCAGCCTACTCTGG - Intronic
913712306 1:121497273-121497295 CCTGTAGTCCCCAGCTACTCGGG + Intergenic
914834674 1:151197401-151197423 CCTGTAGTCCCAGGCTACTCGGG - Intergenic
916022944 1:160810001-160810023 CCTGTAATCCCAACTTCCTCGGG - Intronic
916043120 1:160978367-160978389 CCTGTAGTCCCCAGCTACTCTGG - Intergenic
916971858 1:170028459-170028481 CCTGTAGTCCCCAGCTACTCAGG - Intronic
917197297 1:172480100-172480122 CCTGTAGTCCCTGCAGCCTCTGG - Intergenic
917336153 1:173926254-173926276 CCTGTAGTCCCAGCTACTTCAGG + Intergenic
917581634 1:176384446-176384468 CCTGTAGTCCCAGCTACCTGTGG - Intergenic
917884175 1:179367095-179367117 CCTGTAGTCCCAGCTTACTCTGG + Intronic
917901141 1:179544547-179544569 CTTGTAGTCCCAGCTTACTCAGG + Intronic
918001611 1:180502484-180502506 CCAGTCGACCCGGTCTCCTCCGG + Exonic
918271397 1:182904665-182904687 CCTGTAGTCCCAACTTACTCAGG - Intronic
918772213 1:188575676-188575698 CCTGTAGTCCCAGCTACCTGGGG - Intergenic
918779142 1:188673477-188673499 CCTGTAATCCCAGCTACCTCGGG + Intergenic
919866197 1:201784890-201784912 CCTGTAGTCCCCAGCTACTCGGG - Intronic
920001182 1:202800166-202800188 CCTGTAGTCCCAAGCTACTCGGG - Intronic
920148421 1:203883360-203883382 CCTGTAGTCCCAGCTACCTGGGG + Intergenic
920173658 1:204087045-204087067 CCTGTAGTCCCAGCTTACTCGGG - Intronic
920525800 1:206664938-206664960 CATGTCATCCCGTCCTCCTCTGG - Intronic
920684244 1:208096920-208096942 CCTGGAGTCCAGGTCTCCTGAGG - Intronic
920910816 1:210214696-210214718 CCTGTAATTCCAGCCTCCTTTGG - Intergenic
921003187 1:211065932-211065954 CCTGTAGTCCCCACCTACTTGGG + Intronic
921022781 1:211251552-211251574 CCTGTAGTCCCAGCTACTTCAGG + Intergenic
921324897 1:213980229-213980251 CCTGTTTCCCGGGCCTCCTCCGG + Intergenic
921473113 1:215571753-215571775 CCTGTAGTCCCAGCTTACTCAGG - Intronic
921480356 1:215658056-215658078 CCTGTAGTCCCAGGCTACTCGGG - Intronic
922138858 1:222860759-222860781 CCTGTAGTCCCAGCTACCTGAGG + Intergenic
922498637 1:226080639-226080661 CCTGTAGTCCCCAGCTACTCAGG + Intergenic
922737959 1:227999512-227999534 CCTTCAGTGCCGCCCTCCTCTGG + Intergenic
922782346 1:228263434-228263456 CCTGTAGTCCCAAGCTCCTTGGG + Intronic
922922234 1:229315597-229315619 CCTGTAGTCCCAGCCGCTTGGGG + Intergenic
923089031 1:230724699-230724721 CCTGTAGTCCCAGCTTCCTCAGG + Intergenic
923323835 1:232862582-232862604 CCTGTAGTCCTAGCTTACTCGGG + Intergenic
923575469 1:235154697-235154719 CCTGTAGTCCCTGCCAATTCAGG - Intronic
923578133 1:235180258-235180280 CCTGTAGTCCCAGCTACCTTGGG - Intronic
923650290 1:235867042-235867064 CGTGTAAGCCCCGCCTCCTCTGG + Intronic
923737439 1:236624157-236624179 CCTGTAGTCCCAGCTTACTAGGG + Intergenic
924151884 1:241138045-241138067 CCTGTAATCCCAGCCTACTTGGG + Intronic
924670038 1:246114753-246114775 CCTGTAATCCCAAGCTCCTCGGG - Intronic
924684115 1:246269688-246269710 CCTGTAGTCCCGGCTGCTTACGG - Intronic
924700012 1:246441868-246441890 CCTGTAGTCCCAGCACCCTGGGG - Intronic
924738999 1:246783767-246783789 ACTGTAGCCTCGACCTCCTCAGG + Intergenic
1063015023 10:2067895-2067917 CCTGTAGTCCCAAGCTACTCAGG - Intergenic
1063411971 10:5843117-5843139 CTTGTAGTCCCAGCCTACTTGGG + Intergenic
1063829501 10:9935702-9935724 CCTGTAATCCCCACCTACTCGGG + Intergenic
1063983715 10:11478779-11478801 CCTGTAGTCCCAGCTACCTGGGG + Intronic
1064013326 10:11753897-11753919 CCTGTAATCCCAGCCTACTTGGG - Intronic
1064264929 10:13818285-13818307 CCTGTAGTCCCCCCCTACTCAGG - Intronic
1064393580 10:14961593-14961615 CCTGTAGTCCCAGCTACTTCGGG - Intronic
1064502001 10:15983687-15983709 CCTGTAGTCCCCAGCTACTCAGG - Intergenic
1064620424 10:17210968-17210990 CCTATAGTCCCAGCCTACTCAGG - Intergenic
1064826891 10:19413825-19413847 CCTGTAGTCCCAGCCACTTGGGG + Intronic
1065042553 10:21712335-21712357 CCTGTAGTCCCAGCTACCTTGGG - Intronic
1065343907 10:24730118-24730140 CCTGTAATCCCAGCTTACTCAGG + Intergenic
1065352476 10:24807878-24807900 CCTGTAGTCCCCCCCTCATTAGG + Intergenic
1065549625 10:26857517-26857539 CCTGTAGTCCCAGCTACCTGGGG + Intronic
1066081598 10:31935931-31935953 CCTGTAGTCCCAGCTACCTAGGG + Intergenic
1066314382 10:34229341-34229363 CCTGTAGTCCCAGCTTACTCAGG - Intronic
1067453120 10:46394567-46394589 CCTGTAGTCCCAGCTTACTCGGG + Intergenic
1067584113 10:47465192-47465214 CCTGCAGTCCCAGCTTACTCAGG - Intronic
1068099057 10:52529163-52529185 CCTGTAGTCCCAGCTGCCTCAGG + Intergenic
1068389142 10:56370612-56370634 GCTGTAGTTCAGGCCTGCTCAGG - Intergenic
1068665397 10:59669710-59669732 CCTGTAGTCCCAGCTTACTCGGG + Intronic
1068737946 10:60435961-60435983 CCTGTAGTCCCAGCTTACTCGGG + Intronic
1068967890 10:62932004-62932026 CCTGTAGTCCCAAGCTACTCAGG + Intergenic
1068977979 10:63032514-63032536 CCTGTAGTTCCCAGCTCCTCGGG - Intergenic
1069021381 10:63492155-63492177 CCTGTAGTCCCAGCTGCTTCCGG - Intergenic
1069417587 10:68214668-68214690 CCTGTAATCCCAGCTACCTCGGG - Intergenic
1069698103 10:70402289-70402311 CCTATAGTCCCAACCTACTCAGG - Intergenic
1069931055 10:71881879-71881901 CCTGTAGTCCCAGCCACTTGGGG - Intergenic
1070478582 10:76856028-76856050 CCTGTAGTCCCCAGCTACTCAGG - Intergenic
1070994207 10:80761831-80761853 CCTGTAGTCCCAGCTACCTTGGG - Intergenic
1071160562 10:82740698-82740720 CCTGTAGTCTCAGCTACCTCTGG + Intronic
1071977245 10:90967447-90967469 CCTGTAGTCCCAGGCTACTCAGG + Intergenic
1072099488 10:92215871-92215893 CCTGTAGTTCCAGCCTACTCGGG - Intronic
1072343384 10:94478148-94478170 CCTGTAGTCCTAGCCTACTTGGG + Intronic
1072467020 10:95673713-95673735 CCTGTAGTCCTAGCTACCTCGGG + Intronic
1072644850 10:97245495-97245517 CCTGTAGTCCCCAGCTACTCAGG + Intronic
1072921587 10:99581628-99581650 CCTGTAGTCCCAGCCACTTGAGG + Intergenic
1072951123 10:99847476-99847498 CCTGTAGTCCCAAGCTACTCAGG + Intronic
1072969740 10:100006988-100007010 CCTGCAGTCCCAGCTTACTCGGG + Intronic
1073129148 10:101175473-101175495 CCTGTAGTCCTAGCCACCTGGGG - Intergenic
1073299677 10:102463292-102463314 CCTGTAGTACCAGCTTACTCGGG - Intronic
1073334170 10:102692831-102692853 CCTGTAGTCCCAGCCTACTAGGG - Intronic
1073577150 10:104636278-104636300 CCTGTAATCCCAGCTGCCTCAGG + Intergenic
1073585526 10:104706330-104706352 CCTGTAGTCCCCAGCTACTCCGG - Intronic
1074242399 10:111652088-111652110 CCTGTCCTCCCAGCCTCTTCAGG + Intergenic
1074352848 10:112755129-112755151 CCTGTAATCCCAGCTACCTCAGG + Intronic
1075057539 10:119230712-119230734 CCTGTAGTCCCAGCCACTTGGGG + Intronic
1075683422 10:124348198-124348220 CCTGTAACCCCGGCTTCTTCAGG - Intergenic
1075717976 10:124568035-124568057 CCTGTAGTCCCCCCCTACTAAGG - Intronic
1075862498 10:125689225-125689247 CCTGTAATCCCAGCCACCTGGGG + Intergenic
1076394659 10:130129777-130129799 CCTGTGGTCCCGTGGTCCTCAGG - Intergenic
1076396299 10:130139802-130139824 CCTGTAGTCCCCAGCTACTCAGG + Intronic
1077054817 11:586249-586271 CCTGTAATCCCGGCATCTTTGGG - Intronic
1077071313 11:675058-675080 CCTGTAGTCCCAGCTACCTCGGG + Intronic
1077105329 11:839764-839786 CCTGTAGTCCCGGCCACTCGGGG - Exonic
1077231876 11:1461363-1461385 CGTGTAGTCTTGGCCTCCTCAGG + Exonic
1077506493 11:2932068-2932090 CCTGGAGGCCAGGCCTCCCCAGG + Intergenic
1078226921 11:9400544-9400566 CCTGTAGTCCCCAGCTACTCTGG - Intronic
1078373194 11:10769095-10769117 CCTGTAATCCCAGCTTACTCAGG + Intronic
1078770269 11:14343708-14343730 CCTGTAGTCCCAGCTACTTCCGG + Intronic
1078783530 11:14463440-14463462 CCTGTAGTCCCAGCTAACTCGGG - Intronic
1078992430 11:16663444-16663466 CCTGTAGTCCCAGCCACTTGGGG - Intronic
1079060770 11:17247044-17247066 CCTTTAGTCCCAGCCTGCTTGGG - Intronic
1079132732 11:17757295-17757317 CCTGCAGGCCAGGCTTCCTCGGG - Intronic
1079217260 11:18525033-18525055 CCTGTAATCCCAGCCTACTCGGG - Intronic
1079936649 11:26625047-26625069 CCTGTAGTCCCCAACTACTCGGG - Intronic
1079970638 11:27031655-27031677 CCTGTAGGCCCTGCCTCCACTGG - Intergenic
1079978640 11:27124780-27124802 CCTGTAATCCCTGCCTCCCTTGG - Intronic
1081011437 11:37817793-37817815 CCTGTAGTCCCCAACTACTCGGG - Intergenic
1081344015 11:41960336-41960358 TCTGTAGTCCCGAGCTACTCGGG + Intergenic
1081476634 11:43439590-43439612 CCTATAGTCCCAGCCACCTCGGG - Intronic
1081898586 11:46608567-46608589 CCTGTAGTCCCAGCTTACTCAGG - Intronic
1081978749 11:47253080-47253102 CCTGTAGTCCCAGCCACTTGGGG - Intronic
1083397433 11:62401456-62401478 CCTGTAATCCCGCCTTCCTCAGG - Intergenic
1083402786 11:62435534-62435556 CCTGTAGTCCCCAGCTACTCGGG - Intronic
1083432578 11:62621967-62621989 CCTGCAGACCCCGCCTGCTCGGG - Exonic
1083604725 11:63971365-63971387 CCTGTAGTCCCCAACTACTCGGG + Intergenic
1083947988 11:65936110-65936132 CCTGTAGTCCCAGCTAACTCAGG - Intergenic
1084185910 11:67471068-67471090 CCTGTAATCCCAGCCTCCTCGGG - Intergenic
1084277281 11:68060149-68060171 CCTGTAGTCCCAGCTAACTCGGG - Intronic
1084566423 11:69931374-69931396 CCTGCAGTCCCTGCTTCCTCTGG + Intergenic
1084662939 11:70557762-70557784 CGTGCAGGCCCAGCCTCCTCGGG - Intronic
1085667869 11:78431656-78431678 CCTGTAGTCCCAGCTTACTCAGG - Intergenic
1086001232 11:81987956-81987978 GCTGCAGTCCAGGCCTGCTCAGG - Intergenic
1087036197 11:93758670-93758692 CCTGCCGTCCCGGCCCCTTCTGG + Intronic
1087101035 11:94364949-94364971 CCTGTAGTCCCAGCTAACTCTGG + Intergenic
1087109447 11:94447709-94447731 CCTGTAGTCCCGAGCTACACAGG + Intronic
1087342824 11:96930181-96930203 CCTGTAGTCCCAGCGAACTCTGG - Intergenic
1087800324 11:102496569-102496591 CCTGTAATCCCAGCTTACTCCGG + Intronic
1088030546 11:105243368-105243390 CCTGTAGTCCCAGCTACTTCGGG - Intergenic
1088485604 11:110337312-110337334 CCTGTAGTCCCAGCTACCTGGGG + Intergenic
1088489152 11:110370121-110370143 CCTGTAGTCCCAGCCACCCAGGG + Intergenic
1088747800 11:112818994-112819016 CCAGCAGTCCCCACCTCCTCTGG + Intergenic
1089130634 11:116209130-116209152 CCTTTAGTCCCAGCCTCTTGGGG + Intergenic
1089503019 11:118943783-118943805 CCTGTAGTCCCACGCTACTCGGG - Intronic
1089720616 11:120416773-120416795 CCTGTAGTCCCAGGCTACTCAGG - Intronic
1089970390 11:122688568-122688590 TCTGTAGTCCCAGCTTACTCGGG - Intronic
1090093616 11:123722759-123722781 CCTGTAGTCCCAGCTTCCTGGGG + Intergenic
1090181802 11:124705957-124705979 CCTGTGGTCCCAGGCTACTCGGG + Intergenic
1090279355 11:125442857-125442879 CCTGTAGTCCCAGCTTACTTGGG - Intergenic
1090302022 11:125650684-125650706 CCTGTAATCCCAGCCACCTGAGG - Intronic
1090349676 11:126099882-126099904 CCTGTAGTCCAGGCATCCACCGG + Intergenic
1090412622 11:126519613-126519635 CCTGTGGTTCCAGCATCCTCTGG + Intronic
1092158393 12:6300220-6300242 CCTGTAGTCCCAGCTACCTGGGG - Intergenic
1092201428 12:6586274-6586296 CCTGTAGTCCCCAGCTACTCGGG + Intronic
1092460278 12:8680278-8680300 CCTGTAGTCCCCAGCTACTCGGG - Intergenic
1092607008 12:10131788-10131810 CCTGTAATCCCAGCTTACTCAGG - Intergenic
1092645064 12:10561703-10561725 CCTGTAGTCCCAGCTTACTCAGG - Intergenic
1093414600 12:18905977-18905999 CCTGTAGTGCCTTCCTCTTCAGG - Intergenic
1093460989 12:19406553-19406575 CCTGTAATCCCAGCTTACTCTGG + Intronic
1093898343 12:24601806-24601828 CCTGTAGTCCCAGCTACCTGGGG + Intergenic
1093939088 12:25033078-25033100 CCTGTAGTCCCAGCTTACTGGGG - Intronic
1094411308 12:30170624-30170646 CCTGCAGTCCCAGCCTCCCTTGG + Intergenic
1094414167 12:30200917-30200939 CCTGCAGACCCAGCCTCCTGCGG - Intergenic
1094434766 12:30409090-30409112 CCTGTAGTCCCCAGCTACTCAGG + Intergenic
1094607720 12:31963219-31963241 CCTGTAGTCCCAGCTAACTCAGG + Intronic
1094665011 12:32511421-32511443 CCTGTAGTCCCAAGCTACTCTGG - Intronic
1096173332 12:49492342-49492364 CCTGTAGTCCCGCCCTACGTAGG - Intronic
1096487077 12:51990438-51990460 CCTGTAGTCCCAAGCTACTCAGG - Intronic
1096597378 12:52705031-52705053 CCTGTAGTCCCAGCTCCCACGGG + Intergenic
1096641184 12:52995624-52995646 CCTGTAGTCCCAGCTGCCTGGGG + Intergenic
1096970422 12:55661404-55661426 CCTGTAGTCCCGGCTACTTGGGG + Intergenic
1097070747 12:56352942-56352964 CCTGTAGTCCCTAGCTACTCAGG - Intronic
1097099834 12:56579507-56579529 CCTGTAGTCCCAGCTTACTTGGG + Intronic
1097666224 12:62480439-62480461 CCTGTGGTCCCAGGCTACTCAGG + Intronic
1097877036 12:64653191-64653213 CCTATAGTCCCAGCTACCTCAGG - Intronic
1098092114 12:66914863-66914885 CCTATAGTCCCAGCTACCTCAGG + Intergenic
1098097461 12:66974046-66974068 CCTGTAATCCCCACCTACTCAGG - Intergenic
1098235814 12:68417185-68417207 CCTGTAGTCCCAGCCACTTTCGG + Intergenic
1098261931 12:68680662-68680684 CCTGTAGTCCCAGCTACTTCAGG + Intergenic
1098262541 12:68685556-68685578 CCTGTGGTCCCAGCAACCTCAGG + Intergenic
1098289849 12:68947766-68947788 CCTGTAGTCCCAGCTACTTCGGG - Intronic
1098321131 12:69244652-69244674 CCTGTAATTCCAGCCTCCTTTGG - Intronic
1098383154 12:69890608-69890630 CCTGTAGTCCCAGCTTACTCAGG + Intronic
1098717837 12:73854586-73854608 CCTGTAGTCCCAGCTAACTCGGG - Intergenic
1098886037 12:75961817-75961839 CCTGTAGTCCCAGCTTACTCAGG - Intergenic
1099192253 12:79572468-79572490 CCTGTAGTCCCCAGCTACTCAGG + Intergenic
1099305523 12:80950156-80950178 CCTGTAGTCCCAGCTCCTTCAGG + Intronic
1099612558 12:84892911-84892933 CCTGTAGTCCCAGCTACTTCTGG - Intronic
1099789124 12:87308468-87308490 CCTGTAGTCCCCAGCTACTCAGG - Intergenic
1099836847 12:87917266-87917288 CCTGTAATCCCAGCCTACTCGGG + Intergenic
1099888477 12:88560842-88560864 CCTGTAGTCCCAGCTACCTGGGG + Intronic
1100462927 12:94818730-94818752 CCTGTAATCCCAGCTTCCCCGGG + Intergenic
1100835714 12:98565121-98565143 CCTGTAGTCCCGGCTGAGTCAGG + Intergenic
1100888955 12:99102618-99102640 CCTGTAGTCCCGGCTACTCCGGG + Intronic
1101094783 12:101326845-101326867 CCTGTAGTCCCAGCTACCTGAGG - Intronic
1101318305 12:103649957-103649979 CCTGTCGTCCCAGCTTCCCCAGG + Intronic
1101466084 12:104950627-104950649 CCTGTAGTCCCAGCTATCTCAGG - Intronic
1101816173 12:108147753-108147775 CCTGTAGTCCCAGCTTCTTGGGG + Intronic
1101828559 12:108239835-108239857 CCTGTAGTCCCAGCCACTTGGGG - Intronic
1102078670 12:110080371-110080393 CCTGTAATCCCCACCTACTCGGG - Intergenic
1102214662 12:111152158-111152180 CCTGTAGTTCCAGCTACCTCAGG + Intronic
1102674282 12:114646107-114646129 CCTGTAGTCCCAGCTAACTCGGG - Intergenic
1102864476 12:116363040-116363062 CCTGTAGTCCCCAGCTACTCGGG + Intergenic
1103078749 12:118006443-118006465 CCTGTAGCCTCGACCTCCTTGGG - Intergenic
1103088683 12:118081890-118081912 CCTGTAATCCCAGCTACCTCGGG + Intronic
1103097203 12:118141608-118141630 TCTGTAGTCCCAGCCACCTGTGG + Intronic
1103482963 12:121263091-121263113 CCTGTAATCCCAGCCACTTCAGG - Intronic
1103574667 12:121868642-121868664 CCTGTAATCCCAGGCTACTCAGG - Intergenic
1103594500 12:122015912-122015934 CCTGTAGTCCCGGCCTCCTCAGG + Intergenic
1103756477 12:123211474-123211496 CCTGTAGTCCCAGCTTCTTGTGG - Intronic
1103783715 12:123416513-123416535 CCTGTAGTCCCAGCTGCCTCGGG + Intronic
1103819736 12:123687837-123687859 CCTGTAATCCCAGCTTACTCGGG + Intronic
1104447039 12:128842978-128843000 CCTGTAGTCCCAGCTACCTGGGG + Intergenic
1105398970 13:20071194-20071216 CCTGTAATGCCAGCCTCCTCAGG - Intronic
1105408640 13:20151578-20151600 CCTGGAGCCCCGGTCTGCTCTGG - Intronic
1105524936 13:21168648-21168670 CCTGTAGTCCCAGCTACCCCAGG - Intronic
1106155154 13:27148002-27148024 CCTGTAGTCCCAAGCTGCTCAGG + Intronic
1106201842 13:27544657-27544679 CCTGTAGTCCCAGCTAACTCGGG - Intergenic
1106279625 13:28253731-28253753 CCTGTAGTCCCAGCTACCTGGGG - Intronic
1107199614 13:37698283-37698305 CCTGTAGTCCCAGCTACCTCGGG - Intronic
1107975543 13:45685063-45685085 CCTGTAGTCCCAGCTACCTCGGG + Intergenic
1108059525 13:46518751-46518773 CCTGTAGTCCCAGCTTACTTGGG + Intergenic
1108187068 13:47898630-47898652 CCTGTAGTCCCAAGCTACTCGGG - Intergenic
1108310231 13:49182104-49182126 CCTGTAGTCCCAGCTTACTCAGG - Intronic
1108386475 13:49903908-49903930 CCTGTAGTCCCAGCCTGCTCTGG - Intergenic
1109061439 13:57626257-57626279 CCTGTAATCCCAGCCTACTCGGG + Intergenic
1109470586 13:62799291-62799313 CCTGTCCTCTCGGCCCCCTCCGG + Intergenic
1109639145 13:65164553-65164575 CCTGTAGTCCCGATCTACTCTGG - Intergenic
1109997981 13:70154824-70154846 GCTGTAGTTCAGGCCTACTCAGG - Intergenic
1110121408 13:71886542-71886564 CCTGTAGTCCCGGCTACTTGGGG - Intergenic
1110299391 13:73908275-73908297 CCTGTAGTCCCAAGCTACTCGGG + Intronic
1110433511 13:75454143-75454165 CCTGTAGTCCCAGGCTCCCAGGG - Intronic
1110479960 13:75962445-75962467 CCTGTAATCCCAGCCTACTTGGG - Intergenic
1111068013 13:83123000-83123022 CCTGTAGTCCCCAGCTACTCAGG + Intergenic
1112288051 13:98121386-98121408 CCTGTAGTCCCAGCTACCTGGGG + Intergenic
1112349898 13:98624216-98624238 CCTGTAGTCCCCAGCTACTCAGG + Intergenic
1112400681 13:99075475-99075497 CCTGTAGTCCCTAGCTACTCAGG - Intronic
1112454053 13:99542024-99542046 CCTGTAGCCCCAGCTACCTCGGG + Intronic
1112551761 13:100428188-100428210 CCTGTAGTCCCAGCTACCTGGGG - Intronic
1112598377 13:100830895-100830917 CCTGTAATCCCAGGCTACTCGGG - Intergenic
1112618830 13:101034450-101034472 CCTGAAGTCCCTGCCACCACAGG + Intergenic
1112843898 13:103614204-103614226 CCTGTAGTCCCAAGCTACTCAGG + Intergenic
1113786124 13:113003050-113003072 CCTGTAGTCCCAGCCACCTGGGG + Intronic
1114428741 14:22642461-22642483 CCTGTAATCCCAGCTTACTCAGG - Intergenic
1115823999 14:37244242-37244264 CCTGTAGTCCCCAGCTACTCGGG - Intronic
1116877149 14:50123504-50123526 CCTGTAATCCCAGCATACTCAGG - Intronic
1116895218 14:50309804-50309826 CCTGTAGTCCCAGCCACTTGTGG - Intronic
1117024324 14:51604820-51604842 TCTGTACTCCCAACCTCCTCAGG + Intronic
1117295217 14:54372827-54372849 CCTGCAGTCCCAGCTTACTCAGG - Intergenic
1117364668 14:55014215-55014237 CCTGTAGTCCCAGCGACCTGGGG - Intronic
1117732399 14:58736552-58736574 CCTGTGGTCCCAGCTTACTCAGG + Intergenic
1117848094 14:59935167-59935189 CCTGTAATCCCAGCCTATTCAGG + Intronic
1118275505 14:64382961-64382983 CCTGTATTCCCAGCTTACTCAGG + Intergenic
1118330712 14:64813644-64813666 CCTGTAGTCCCAGCTACCTGGGG - Intronic
1119086287 14:71742240-71742262 CCTGTAGTCCCAGCTGCCTGAGG + Intergenic
1119149880 14:72349040-72349062 CCTGTAGTCCCCAGCTACTCAGG + Intronic
1119838767 14:77774607-77774629 CCTGTAATCCCAGCTTACTCTGG - Intergenic
1120154843 14:81082247-81082269 GCTGTAGTTCAGGCCTACTCAGG - Intronic
1121098976 14:91236694-91236716 CCTGTAATCCCAGCTTACTCGGG + Intronic
1121136468 14:91503406-91503428 CCTGTAGTCCCGGCTGCTTGGGG - Intronic
1121296574 14:92830721-92830743 CCTGTAGTCCCAGCCACTTGGGG - Intronic
1121359922 14:93247467-93247489 CCTGTAGTCCCAGCCTCGGGAGG - Intronic
1122003719 14:98685108-98685130 CCTGTAGTCCCAGCTTACTCAGG + Intergenic
1122068552 14:99190363-99190385 CCTGTAGTCCCAGCTACCTGGGG + Intronic
1122179653 14:99945973-99945995 CCTGTAGTCCCAGCTACTTCAGG + Intergenic
1122463436 14:101915203-101915225 CCTGTAGTCCCAGCATACTTGGG - Intronic
1122550578 14:102547011-102547033 CCTGTAGTCCCAGCTGGCTCGGG + Intergenic
1122571715 14:102707911-102707933 CCTGTAGTCCCAAGCTACTCAGG - Intronic
1122678315 14:103435840-103435862 CCTATAGTCCCAGCTACCTCAGG - Intronic
1122777034 14:104122837-104122859 CCTGTAGTCCCAGCTACTTCAGG - Intergenic
1122977870 14:105178398-105178420 CCTGTGGTCCCGTTCTCCTGTGG + Intronic
1123185208 14:106510030-106510052 GCTGTAGTTCTGGCCTGCTCAGG + Intergenic
1123458822 15:20449418-20449440 CCTGTAGTCCCAGCTTACTTGGG + Intergenic
1123485821 15:20737501-20737523 CCTGTAGTCCCAGCTACTTCAGG + Intergenic
1123542308 15:21306544-21306566 CCTGTAGTCCCAGCTACTTCAGG + Intergenic
1123659238 15:22550998-22551020 CCTGTAGTCCCAGCTTACTTGGG - Intergenic
1123688943 15:22821085-22821107 CCTGTAGTCCCCGGCTACTCAGG - Intronic
1123699794 15:22905882-22905904 CCTGTAGTCCCAGCTTACTCGGG - Intronic
1123706454 15:22954559-22954581 CCTGTGCCCCCGGCCTCCCCAGG + Intronic
1123707637 15:22961500-22961522 CCTGTAGTCCCAGCTACCTGGGG - Intronic
1123883498 15:24698489-24698511 CCTGTAGTCCCCAGCTACTCAGG - Intergenic
1123895668 15:24827389-24827411 CCTGTAGTCCCAGCATACTCAGG + Intronic
1124459817 15:29878997-29879019 CCTGTAGTCCCCAGCTACTCGGG + Intronic
1124679183 15:31715010-31715032 CCTGTAGTCCCTGCTACCTAGGG + Intronic
1124830501 15:33144511-33144533 CCTGTAGTCCCAGGCTACTCGGG + Intronic
1125157791 15:36609133-36609155 CCTGTGGTCCCAGGCTACTCAGG - Intronic
1125676302 15:41504174-41504196 CCAGAAGTCCCTTCCTCCTCTGG + Exonic
1125911041 15:43439410-43439432 CCTGTAGTCCCAGCACCCTGTGG + Intronic
1125912351 15:43452432-43452454 CCTGTAGTCCCGGCTTCTCGGGG + Intronic
1125952056 15:43760651-43760673 CCTGTGGTCCCGAGCTACTCGGG - Intronic
1125974626 15:43940051-43940073 CCTGTAATCCCAGCCACCTGTGG + Intronic
1125985783 15:44050482-44050504 CCTGTAGTCCCCAGCTACTCGGG - Intronic
1126123509 15:45274384-45274406 CCTGTAGTCCCAGCTACCTGGGG + Intronic
1126609017 15:50509521-50509543 CCTGTAGTCCCAAGCTACTCAGG + Exonic
1127175068 15:56345546-56345568 CCTGTAGTCCCAGCCTACTTGGG - Intronic
1127187929 15:56499370-56499392 CCTGTAGTCCCAGCTTACTCAGG + Intergenic
1127270313 15:57394986-57395008 CCTGTAGTCCCAGCTACCTGGGG + Intronic
1127306364 15:57709447-57709469 CCTGTAGTCCCAGGCTACTCAGG + Intronic
1127788756 15:62379700-62379722 CCTGTGGTCCCAGCCTCCGAAGG + Intergenic
1128039949 15:64563324-64563346 CCTGTAGTCCCAGCTCCCTCGGG + Intronic
1128208310 15:65872006-65872028 ACTGCAGTCTCGGCCTCCTCAGG + Intronic
1128244247 15:66122137-66122159 CCTGTAATCCCAGCTTACTCAGG + Intronic
1128250621 15:66161507-66161529 CCTGTAGTCCCAGCCACTTAAGG - Intronic
1128316062 15:66660143-66660165 CCTGTAGTCCCAGCTTCTCCAGG - Intronic
1128378930 15:67097337-67097359 CCTGTAGTCCCAAGCTACTCAGG - Intronic
1129637096 15:77331739-77331761 CCTGTAGTCCCACGCTACTCAGG - Intronic
1129793324 15:78356974-78356996 CCTGTAGTCCCAAGCTACTCAGG - Intergenic
1129809135 15:78492682-78492704 CCTGTAGTCCCAAGCTACTCAGG - Intronic
1130344867 15:83033699-83033721 CCTGTAGTCCCAGCTACCTGGGG - Intronic
1130444621 15:83989004-83989026 CCTGTAGTCCCCAGCTACTCGGG - Intronic
1131173578 15:90195731-90195753 CCTGTAGTCCCAGCTACTTCGGG - Intronic
1131269415 15:90937608-90937630 CCTGTAGTCCCAGCTACCTGGGG - Intronic
1131281287 15:91023414-91023436 CCTGTAATCCCAGTCTACTCGGG - Intergenic
1131693103 15:94847192-94847214 CCTGTAATCCCAGCCTACTTAGG - Intergenic
1131777585 15:95819125-95819147 CCTGTAGTCCCAGCTACTTCAGG + Intergenic
1131963195 15:97810307-97810329 CCTGTAGTCCCGGCTACTTGGGG + Intergenic
1202950625 15_KI270727v1_random:33685-33707 CCTGTAGTCCCAGCTACTTCAGG + Intergenic
1132507021 16:315701-315723 CCTGTAGTCCCAGACTACTTCGG + Intronic
1132854127 16:2037247-2037269 CCTCCAGTCTCTGCCTCCTCAGG + Intronic
1132997281 16:2829895-2829917 CCTGGAGTCAGGGCCTCCTTCGG - Intergenic
1133029491 16:3003657-3003679 CCTGTAGTCCCGGCTACTTGGGG + Intergenic
1133214428 16:4282990-4283012 CCTGTAGTCCCCAGCTACTCTGG - Intergenic
1133449876 16:5894896-5894918 CCTGTAGTCCCCTTCTACTCTGG + Intergenic
1133774611 16:8886936-8886958 CCTGTAGTCCCAGCTACCTGTGG + Intergenic
1134173432 16:11987186-11987208 CCTGTAGTCCCAGCCTCCTGGGG - Intronic
1134284570 16:12849277-12849299 CCTGTAGTCCCAGCCTGTTAGGG - Intergenic
1134403745 16:13937041-13937063 CCTGTAGTCCCAGCCACTTGGGG - Intronic
1134657344 16:15957201-15957223 CCTGTAGTCCCAGCTACCTGGGG - Intronic
1134745328 16:16583570-16583592 CTTGTAGTTCCAGCCTACTCAGG - Intergenic
1135000142 16:18770194-18770216 CTTGTAGTTCCAGCCTACTCAGG + Intergenic
1135022507 16:18974568-18974590 CCTGTAGTCCCAGCTTACTCGGG - Intergenic
1135033637 16:19058825-19058847 CCTGTAGTCCCCAGCTACTCAGG - Intronic
1135119813 16:19756058-19756080 CCTGTAGTCCCAGCTACCTGGGG + Intronic
1135238299 16:20779297-20779319 CCTGTAGTCCCAGCCTACTCGGG + Intronic
1135428793 16:22364061-22364083 CCTGTAGTCCCAGCTTACTTGGG - Intronic
1135535834 16:23293797-23293819 CCTGTAGTCCCCAACTACTCAGG + Intronic
1135541401 16:23332944-23332966 CCTGTAATCCCAGCTTACTCGGG + Intronic
1135820538 16:25681378-25681400 CCTGTAGTCACAGGCTGCTCGGG + Intergenic
1135966724 16:27041666-27041688 CCTGTAGTCCCAGCTAACTCTGG - Intergenic
1136387137 16:29935716-29935738 CCTGTAGTCCCAGCTTACTCAGG - Intergenic
1136500784 16:30668894-30668916 CCTGGAGTCCGGGCGGCCTCAGG - Exonic
1137307360 16:47216315-47216337 CCTGTAGTCCCAGCTACTTCGGG - Intronic
1137412720 16:48243275-48243297 CCTGTAGTCCCCAGCTACTCGGG + Intronic
1137611909 16:49823956-49823978 CCTGTAGTCCCAAGCTGCTCAGG + Intronic
1137622231 16:49883595-49883617 CCTGTAATCCCGGCACCCTGGGG - Intergenic
1138034066 16:53584630-53584652 CCTGTAATCCCACCCTACTCGGG + Intergenic
1138389792 16:56662188-56662210 CCTGTAGTCCCAGCTAACTCTGG - Intronic
1138482097 16:57310336-57310358 CCTGTAGCCCCAGCTTACTCAGG - Intergenic
1138844416 16:60547939-60547961 CCTGTAGTCCCAGCCTACTCAGG + Intergenic
1138904225 16:61310967-61310989 CCTGTAGTCCCGGCTACTCCGGG + Intergenic
1139214041 16:65109992-65110014 CCTGTAGTCCCCAGCTACTCGGG - Intronic
1139693362 16:68655736-68655758 CCTGTAATCCCAGCTTACTCAGG + Intronic
1139904875 16:70357507-70357529 CCTGTAGTCCCAGCTAACTCGGG - Intronic
1140264907 16:73412200-73412222 CCTGTAATCCCAGCTACCTCAGG + Intergenic
1140285175 16:73596143-73596165 CCTGTAGTCCCAGCTAACTCAGG - Intergenic
1140343063 16:74184448-74184470 CCTGTAGTCCCCACCACCTGGGG + Intergenic
1140572642 16:76126648-76126670 CCTGTAGTCCCGAGCTACTCAGG - Intergenic
1140769734 16:78192365-78192387 CCTGTAGTCCCAAGCTACTCAGG + Intronic
1141179320 16:81741684-81741706 CCTGTAGTCCCCAGCTCCTTGGG + Intronic
1141198299 16:81878104-81878126 CCTGTAGTCCCCAGCTACTCGGG - Intronic
1141470279 16:84233578-84233600 CCTGTAGTCCCAGCTACCTGGGG + Intronic
1141504740 16:84468504-84468526 CCTGTAATCCCAGGCTACTCGGG + Intergenic
1141558682 16:84852808-84852830 CCTGTAATCCCAGCCTCCTTTGG + Intronic
1141671424 16:85493957-85493979 CCTGTAGTCCCAGCTACCTTGGG + Intergenic
1142018202 16:87763478-87763500 CCTGTAGTCCCAAACTACTCGGG + Intronic
1142187117 16:88699786-88699808 CCTGAGGTCTCGGCCTCCCCAGG - Intronic
1203060554 16_KI270728v1_random:965265-965287 CCTGTAGTCCCAGCTACCGCAGG - Intergenic
1142775273 17:2132903-2132925 CCTGTAGTCCCAGCTTCCTGGGG - Intronic
1143091502 17:4451790-4451812 CCTGTAATCCCAGCCCACTCAGG - Intronic
1143197946 17:5090792-5090814 CCTGTAGTCCCAGCTTCTTGGGG - Intronic
1143405239 17:6673097-6673119 CCTGTAGTCCCAGCTACCTGGGG + Intergenic
1143650246 17:8259028-8259050 CCTATAGTCCCAGCCTCCTGAGG + Intronic
1143655682 17:8292232-8292254 CCTGTAGTCCCAAGCTACTCGGG + Intronic
1143686242 17:8518255-8518277 CCTGTAGTCCCAGCTACCTGTGG - Intronic
1144015294 17:11189597-11189619 CCTGTAGTCCCAGCTTACTCTGG - Intergenic
1144063810 17:11606571-11606593 CCTGTAGTCCCAGCTACTTCAGG - Intronic
1144090520 17:11852007-11852029 CCTGTTGTCACGGCCCCCTGAGG - Intronic
1144105872 17:11984636-11984658 CCTATAGTCCAAGCTTCCTCGGG - Intronic
1144495785 17:15743831-15743853 CCTGTAGTCCCCAGCTACTCAGG + Intronic
1144590464 17:16519518-16519540 CCTGTAGTCCCAGCTACCTGGGG - Intergenic
1144687865 17:17237945-17237967 CCTGTAGTCCCCAGCTACTCGGG - Intergenic
1144691665 17:17270030-17270052 CCTGTAGTCCCCAGCTACTCAGG + Intronic
1144701852 17:17345535-17345557 CCTGTAGTCCCAGCTACTTCAGG + Intronic
1144812021 17:18006675-18006697 CCTGTGGTCCTGCCCTCCTGGGG + Intronic
1144911773 17:18688181-18688203 CCTGTAGTCCCCAGCTACTCAGG + Intergenic
1144943955 17:18960363-18960385 CCTGGAATCCCGGGCTGCTCCGG - Intronic
1144997446 17:19279959-19279981 CCTGTAATCCCAGCTTACTCAGG - Intronic
1145105858 17:20116210-20116232 CCTGTAGTCCCAAGCTACTCGGG - Intronic
1145107290 17:20129307-20129329 CCTGTAGTCCCCAGCTACTCGGG - Intronic
1145111303 17:20164282-20164304 CCTGTAGTCCCAGCTACTTCAGG - Intronic
1145361116 17:22213305-22213327 GCTGTAGTTCAGGCCTACTCAGG - Intergenic
1145948839 17:28799730-28799752 CCTGTAGTCCCAGCTTACTCAGG - Intronic
1145982102 17:29018939-29018961 CCTGTGGTCCCTGCCTCCCTCGG - Intronic
1146073242 17:29703371-29703393 CCGGTAATCCCAGCCTACTCGGG - Intronic
1146909046 17:36636466-36636488 CCTCCCGTCCCGGCCTCCCCAGG + Intergenic
1147048452 17:37772372-37772394 CCTGTAGTCCCAGCTAACTCAGG + Intergenic
1147134472 17:38427338-38427360 CCTGTAGTCCCAGCTACCTGGGG + Intergenic
1147280494 17:39356477-39356499 CCTGTAGTCCCAGCCACTTGGGG - Intronic
1147361240 17:39931772-39931794 CCTGTAATCCCAGCCCACTCGGG - Intergenic
1147616314 17:41830382-41830404 CCTGTAATCCCAGCTTACTCGGG + Intronic
1147749631 17:42722022-42722044 CCTGTAGTCCCAGCTACCTCGGG + Intronic
1147841285 17:43373506-43373528 GCTGTAGTTCAGGCCTACTCAGG - Intergenic
1148011459 17:44485225-44485247 CCTGTAGTCCCAGCCACTTGGGG - Intronic
1148111222 17:45145548-45145570 CCTGTAGTCCCAGCTACTTCCGG - Intergenic
1148259339 17:46166086-46166108 CCTGTAATCCCAGCTTACTCAGG + Intronic
1148336519 17:46845612-46845634 CCTGTAGTCCCCAGCTACTCGGG - Intronic
1149078058 17:52620047-52620069 CCTGTAATCCCAGCCTACTCAGG + Intergenic
1149152945 17:53591920-53591942 CCTGTAGTCCCAAACTACTCGGG - Intergenic
1149392826 17:56209000-56209022 CCTGTAGTCCCAGCTAACTCGGG - Intronic
1149473612 17:56940231-56940253 CCTGTAGTCCCAGCCACCTTTGG - Intronic
1149476286 17:56963783-56963805 CCTGTAGTCCCCAGCTACTCGGG - Intergenic
1149637495 17:58182741-58182763 CCTGTAGTCCCAGCTACCTGGGG - Intergenic
1149652741 17:58286666-58286688 CCTGTACTCCCAGCTTCCTTGGG + Intergenic
1149668455 17:58383417-58383439 CCTGTAGTCCCAGCCACTTGGGG - Intronic
1149790712 17:59474587-59474609 CCTGTAGTCCCAGCTTACTCAGG - Intergenic
1149864708 17:60144852-60144874 CCTGTAGTCCCAGCCACCTGGGG - Intergenic
1150027834 17:61696859-61696881 CCTGTAGTCCCCAGCTACTCGGG + Intronic
1150065212 17:62103221-62103243 CCTGTAGTCCCAGCTACCTGCGG + Intergenic
1150088821 17:62301401-62301423 CCTGTAGTCCCCAGCTACTCAGG + Intergenic
1150227440 17:63531613-63531635 CCTGGCGTCCCACCCTCCTCAGG - Intronic
1150261638 17:63797225-63797247 CCTGTAATCCCAGCTTACTCAGG + Intronic
1150530302 17:65974198-65974220 CCTGTAGTCCCAGCCACTTGGGG - Intronic
1150647373 17:66987626-66987648 TCTGTGGTCCCAACCTCCTCCGG - Intronic
1150898965 17:69248847-69248869 CCTGTAGTCCCAGCTAACTCAGG - Intronic
1151397979 17:73837232-73837254 CCTGGGGTTCTGGCCTCCTCTGG + Intergenic
1151565469 17:74894953-74894975 CCTGTAGTCCCAAGCTACTCAGG - Intergenic
1151638416 17:75369733-75369755 CCTGTAGTCCCCAGCTACTCAGG + Intronic
1151678101 17:75610238-75610260 CCTGCAGTCTCTGCCGCCTCTGG - Intergenic
1151737144 17:75950368-75950390 CCTGTAATCCCGGCCTACTTGGG - Intronic
1151754830 17:76068165-76068187 CCTGTAATCCCAGCCTACTCGGG + Intronic
1151923506 17:77175562-77175584 GCTGTAGTTCCGGCCTACTCAGG + Intronic
1152712061 17:81876597-81876619 CCTGTAGTCCCAAGCTCCTCAGG - Intergenic
1153223931 18:2883614-2883636 CCTGCAGTCCCGGGCTCACCAGG - Intronic
1153277673 18:3383918-3383940 CCTGTAGTCCCAAGCTACTCAGG + Intergenic
1153624927 18:7014496-7014518 CCTGTAGTCCCAGCCACTTGGGG + Intronic
1153645152 18:7189189-7189211 CCTGTAGTCCCAAGCTACTCAGG - Intergenic
1154062532 18:11075911-11075933 CCTGTAGTCCCAGCTAACTCGGG - Intronic
1154219678 18:12441117-12441139 CCTGTAGTCCCCAACTACTCGGG + Intergenic
1154260602 18:12829019-12829041 CCTGTAGTCCCAGCTACCTGGGG - Intronic
1154421212 18:14230151-14230173 CCTGTAGTCCCAGCTACCTTGGG + Intergenic
1155016088 18:21841240-21841262 CCTGTAGTCCCCAGCTACTCAGG + Intronic
1155385520 18:25273101-25273123 CCTGTAGTCCCAGCTACTTCGGG + Intronic
1155480777 18:26285089-26285111 CCTGTAGTCCCAGCTACCGCAGG - Intronic
1155732692 18:29180578-29180600 GCTGTAGTTCAGGCCTACTCAGG + Intergenic
1155899712 18:31373856-31373878 CCTTTTGTCCCCGCCTCCCCAGG + Intergenic
1157707170 18:49816794-49816816 CCTGTAGTCCCAAGCTACTCAGG - Intronic
1157842569 18:50972604-50972626 CCTGTAGTCCCAGCTACTTCAGG - Intronic
1158489929 18:57900806-57900828 CCTGTAATCCCAGGCTACTCAGG + Intergenic
1158617927 18:59005096-59005118 CCTGTAGTCCCAGCTTACTTGGG - Intergenic
1159568357 18:70082813-70082835 CCTGTAGTCCCTAGCTACTCAGG - Intronic
1160579348 18:79874845-79874867 CCTGAAGTCCCGGCCTGCGCTGG - Intronic
1160862716 19:1244508-1244530 CCTGGGGTCCCGGCCACCTGGGG + Exonic
1160885269 19:1343592-1343614 CCTGTAGTCCCAGCTACCTGGGG + Intergenic
1161111626 19:2474136-2474158 CCTGTAATCCCAGCTTACTCAGG - Intergenic
1161207381 19:3048105-3048127 CTTGTAGTCCCAGCTACCTCGGG + Intergenic
1161345531 19:3767188-3767210 CCTGGTGTCCCGGGCACCTCGGG - Intronic
1161460688 19:4395230-4395252 CCTGCAGCCCTGACCTCCTCAGG + Intronic
1161492325 19:4568799-4568821 CCTGTAATCCCAGGCTACTCGGG + Intergenic
1161649585 19:5476184-5476206 CTTGTAGTCCCAGCTTACTCGGG + Intergenic
1161691078 19:5734675-5734697 CCTGTAATCCCAGCTTACTCTGG + Intronic
1161691488 19:5737436-5737458 CCTGTAGTCCCAGCCACAGCAGG + Intronic
1161829889 19:6594983-6595005 CCTGTAGTCCCAGCTATCTCGGG + Intronic
1161918434 19:7248267-7248289 CCTGTAGTCCCAGCTACCTGGGG - Intronic
1161937312 19:7380041-7380063 CCTGTAGTCCCCAGCTACTCTGG + Intronic
1162095420 19:8307165-8307187 CCTGTAGTCCCAAGCTACTCGGG + Intronic
1162276750 19:9661886-9661908 CCTGTAGTCCCAGCCACTTTGGG - Intronic
1162279979 19:9688086-9688108 CCTGTAGTCCCCAGCTACTCTGG - Intergenic
1162357682 19:10196231-10196253 CCTGTAATCCCAGCCTACTAGGG - Intronic
1162518197 19:11162823-11162845 CCTGTAGTCCCAAGCTACTCAGG - Intergenic
1162697526 19:12487803-12487825 CCTGTAGTCCCCAGCTACTCAGG - Intronic
1162727269 19:12697333-12697355 CCTGTAGTCCCAGCTACCTGGGG - Intergenic
1162815475 19:13191640-13191662 CCTGTAATCCCAGCTTACTCAGG - Intergenic
1162822630 19:13232319-13232341 CCTGTAGTCCCCAGCTACTCAGG - Intronic
1162881136 19:13660462-13660484 CCTGTAGTCTCAGGCTACTCAGG + Intergenic
1162904485 19:13815593-13815615 CCTGTAGTCCCAAGCTACTCAGG - Intronic
1163002490 19:14376697-14376719 CCTGTAATCCCAGCTTACTCAGG + Intergenic
1163002566 19:14377192-14377214 CCTGTAATCCCAGCTTACTCGGG + Intergenic
1163398411 19:17077111-17077133 CCTGTAGCCCAGGTCACCTCCGG - Intronic
1163421838 19:17217957-17217979 CCTGTAGTCCCAGCATACTTGGG + Intronic
1163607654 19:18283907-18283929 CCTGTAGTCCCCAGCTACTCGGG + Intergenic
1163707854 19:18826661-18826683 CCTGTAATCCCAGCTTACTCTGG + Intergenic
1163717578 19:18880819-18880841 CCTGTAGTCCCAGCTTCTCCGGG - Intronic
1163779007 19:19235868-19235890 CCTGTAGTCCCAGCCTACTGGGG - Intronic
1163906647 19:20154478-20154500 CCTGTAGTCCCAGCTACCTGGGG + Intergenic
1164005556 19:21145350-21145372 CCTGTAGTCCCAGCTTACTCGGG + Intronic
1164678867 19:30120939-30120961 CCTGCACTCCCGCCCTCCTCAGG + Intergenic
1164917102 19:32060665-32060687 CCTGTAGTCCCAGCTTACCCAGG + Intergenic
1164968033 19:32502931-32502953 CCTGTAGTCCCAGCTTATTCAGG - Intergenic
1164974539 19:32562082-32562104 CCTGTAGTCCCAGCTTCCGGAGG + Intergenic
1165045827 19:33104214-33104236 CCTGTAGTCCTAGCCTCTTGGGG + Intronic
1165070432 19:33252215-33252237 CCTGTAGTCCCAAGCTACTCAGG - Intergenic
1165113501 19:33515249-33515271 CCTGGAGTCCCAGCCTGCCCAGG + Intronic
1165465426 19:35971930-35971952 CCTGTAGTCCCAGGCTACTTGGG - Intergenic
1165480700 19:36062068-36062090 CCTGTGGTCCCAGCCACCTGGGG - Intronic
1165727915 19:38125157-38125179 CCTGTAGTCCCAGCTACCTGGGG - Intronic
1165874704 19:38997988-38998010 CCTGTAATCCCAGCTTACTCTGG + Intronic
1165986608 19:39774816-39774838 CCTGTAGTCCCAGCTACCTGGGG + Intergenic
1166001655 19:39881096-39881118 CCTGTAGTCCCCCACTACTCGGG + Intronic
1166004437 19:39897347-39897369 CCTGTAGTCCCCCACTACTCGGG + Intronic
1166041636 19:40206307-40206329 CTTGTAGTCCCAGCCTACTCAGG + Intronic
1166246805 19:41534059-41534081 GCTGTAGTTCAGGCCTGCTCAGG + Intergenic
1166308524 19:41949260-41949282 CCTGTAGTCCCGGCTACTTGGGG - Intergenic
1166338900 19:42125659-42125681 ACTGCAGCCCCAGCCTCCTCTGG + Intronic
1166773609 19:45299298-45299320 CCTGTAGTCCCAGCTACTTCAGG + Intronic
1167098995 19:47392436-47392458 CCTGTAATCCCTGGCTACTCAGG - Intergenic
1167114769 19:47482828-47482850 CCTGTAATCCCAGCCTACTCAGG - Intronic
1167139667 19:47641022-47641044 CCTGTAGTCCCAGCTTACTCAGG - Intronic
1167231562 19:48287775-48287797 CCTGTAGTCCCAGCTACCTGGGG + Intergenic
1167261171 19:48459116-48459138 CCTGTAGTCCCAGCCTCGGGAGG + Intronic
1167275146 19:48533510-48533532 CCTGTAGTCCCAGCTACCTCGGG - Intergenic
1167586254 19:50377339-50377361 GCTGTAGGCCCCGCCCCCTCAGG - Intronic
1167638850 19:50669132-50669154 CCTCCAGTCCCCTCCTCCTCAGG - Exonic
1167677088 19:50894002-50894024 CCTGTACTCCCAGCTTCCTGGGG + Intergenic
1167882191 19:52469282-52469304 CCTGTAGTCCCAGCTGCCTGGGG - Intronic
1167987369 19:53330083-53330105 CCTGTAATCCCAGCTTACTCAGG - Intergenic
1168137418 19:54360709-54360731 CCTGGAGCCCTGGTCTCCTCTGG - Intronic
1168393084 19:56026701-56026723 CCTGTAGTCCCCAGCTACTCAGG - Intronic
1168492630 19:56823304-56823326 GCTGTACCCCCAGCCTCCTCAGG - Intronic
1168629887 19:57948288-57948310 CCTGTAGTCCCCAGCTACTCCGG + Intergenic
926111787 2:10188439-10188461 CCTGGAGTCTCGCCCTCATCTGG + Intronic
926192809 2:10741419-10741441 CCTGTGTTCCCTGCCTCCCCTGG - Intronic
926270785 2:11364481-11364503 ACTGTAGTCCCAGCTACCTCGGG - Intergenic
926691983 2:15742939-15742961 CCTGTAGTCCCAGCTACTTCGGG - Intronic
927169880 2:20360389-20360411 CCTGTAGTCCCAGCTACCTGGGG + Intergenic
927326473 2:21811193-21811215 CCTGTAGTCCCCAGCTACTCAGG - Intergenic
927545188 2:23946275-23946297 CCTGTAGTCCCAAGCTACTCAGG - Intronic
927545530 2:23949445-23949467 CCTGTAGTCCCCAGCTACTCGGG + Intronic
927782679 2:25952174-25952196 CCTGTAGTCCCAAGCTACTCAGG + Intronic
928005889 2:27561205-27561227 CCTGTAATCCCAGCTTCCCCAGG + Intronic
928147254 2:28790154-28790176 CCTGTAGTCCCAGCTTGCTTGGG + Intronic
928623908 2:33119679-33119701 CCTGTAGTCCCAGCCTACTCGGG - Intronic
928823587 2:35392011-35392033 CCTGCTGCCTCGGCCTCCTCTGG - Intergenic
928894283 2:36243173-36243195 CCTGTAGTACCCACCTCATCTGG - Intergenic
929177953 2:39001184-39001206 CCTGTAGTCCCAGCTTACTCGGG - Intronic
929216978 2:39424704-39424726 CCTGTAGTCCCAGCTACCTTGGG + Intronic
929219519 2:39449056-39449078 CCTGTAGTCCCCAGCTACTCGGG + Intergenic
929228608 2:39536298-39536320 CCTGTAATCCCAGCTTACTCAGG + Intergenic
929531050 2:42753047-42753069 CCTGTAGTCCCAGCTACTTCAGG - Intronic
930685519 2:54303225-54303247 CCTGTAGTCCCAGCTACCTGGGG + Intronic
931268841 2:60684194-60684216 CCTGTAATCCCAGCTTACTCGGG + Intergenic
931541025 2:63328849-63328871 CCTGTAGCCCCAGCCTACTCAGG - Intronic
932651342 2:73561193-73561215 GCTGTAGTTCAGGCCTACTCAGG + Intronic
932880544 2:75497725-75497747 CCTGTAGTCCCAGCTACTTCTGG + Intronic
933230145 2:79797534-79797556 CCTGTTGTCCCAGCTTACTCAGG + Intronic
933387406 2:81628846-81628868 CCTGTAGTCCCAAGCTACTCAGG + Intergenic
933532752 2:83531232-83531254 GCTGTAGTTCAGGCCTACTCAGG - Intergenic
933746101 2:85572457-85572479 CCTGTAGTCCCAGCTACTTCGGG - Intronic
933753701 2:85620353-85620375 CCTGTAGTCCCAGCTTCTTGGGG + Intronic
934885975 2:98025305-98025327 CCTGTAGTCCCAGCTTCCCTGGG - Intergenic
934966495 2:98728622-98728644 CCTGTAATCCCAGCTTACTCGGG + Intronic
935414510 2:102801586-102801608 GCTGTAGTTCAGGCCTGCTCAGG + Intronic
935811715 2:106804715-106804737 CCTGTAGTCCCCAGCTACTCAGG + Exonic
936056161 2:109263842-109263864 CCTGTAGTCCCCAGCTGCTCGGG + Intronic
936301773 2:111309874-111309896 CCTGCAGTGCGGGCCTCCCCAGG + Intergenic
936348806 2:111696932-111696954 CGTGTAGTCCCAGCTACCTCAGG + Intergenic
937147663 2:119661213-119661235 CCTGTAGTCCCAGCTACCTGGGG + Intronic
937176152 2:119937805-119937827 CCTGTTGTCCCAGCTTACTCAGG + Intronic
937245625 2:120490786-120490808 CCTGTAGTCCCCAGCTACTCGGG + Intergenic
937407542 2:121644528-121644550 CCTGTAGTCCCAAGCTACTCAGG + Intronic
937409999 2:121666271-121666293 CCTGTAGTCCCCAGCTACTCAGG - Intergenic
937954059 2:127409208-127409230 CCTATAGTCCCAGCTACCTCGGG + Intergenic
938066076 2:128282718-128282740 CCTGGATTCCAGGCCTCCACCGG - Intronic
938251678 2:129820637-129820659 GCTGTAGTTCAGGCCTGCTCAGG + Intergenic
938772493 2:134512332-134512354 TCTGTAGTCCCAGCTTACTCAGG + Intronic
938838109 2:135129025-135129047 CATGTAGTCCCAGCCTACCCAGG + Intronic
938994360 2:136661637-136661659 CCTGTAGTCCCAGCCACTTCAGG - Intergenic
939002772 2:136755569-136755591 CCTGTAGTCCCGGCTACTTGAGG - Intergenic
939318843 2:140588833-140588855 CCTGTAGTCCCAGCTAACTCGGG + Intronic
939829074 2:147050905-147050927 CCTGTAGTCCCAGCTACCTGGGG - Intergenic
940270476 2:151884508-151884530 CCTGTAGTCCCCAGCTACTCAGG + Intronic
940287950 2:152050896-152050918 CCTGTAGTCCCAGCTACCTGGGG - Intronic
940321470 2:152381920-152381942 CTTGTAGTTCCAGCCTCCTCAGG - Intronic
940755150 2:157673514-157673536 CCTGTAATCCCAGCCTACTCGGG + Intergenic
940892007 2:159044311-159044333 CCTGTAGTCCCAAGCTACTCGGG + Intronic
940940679 2:159557171-159557193 CCTGTAGTCCCCAGCTACTCAGG - Intronic
941038632 2:160595863-160595885 CCTGTAGTCCCCAGCTACTCAGG - Intergenic
941102348 2:161310035-161310057 CCTGTATTCCCAGCTACCTCAGG + Intronic
941400434 2:165023200-165023222 CCTGTAATCCCAGTCTACTCAGG + Intergenic
941409986 2:165142873-165142895 CCTCTAGTCCCAGCCAACTCAGG - Intronic
941949842 2:171143379-171143401 CCTGTAATCCCCACCTACTCGGG + Intronic
942176504 2:173339677-173339699 CCTGTAGTCCCAGCTACCCCAGG - Intergenic
942239284 2:173944409-173944431 CCTGTAGTCCCAGCTAACTCAGG + Intronic
942242845 2:173979282-173979304 CCTGTAGTCCCAGCTACCTGGGG - Intergenic
942441795 2:176044530-176044552 CCTGTAGTCCCAGCTTCTTGAGG - Intergenic
943919724 2:193689772-193689794 CCTGTAGTCCCAGCTACCTCGGG - Intergenic
944064179 2:195601871-195601893 CCTGTAATCCCAGCCTACTTGGG + Intronic
944120532 2:196235778-196235800 CCTGTAGTCCCCAGCTACTCGGG - Intronic
944207311 2:197170064-197170086 CCTGTAGTCCCAGCTACCTGGGG + Intronic
944237495 2:197453498-197453520 CCTGCAGCACCGCCCTCCTCTGG - Exonic
944328094 2:198431343-198431365 CCTGTAGTCCCAGCTTACTCGGG - Intronic
944523869 2:200598617-200598639 CCTGTAGTCCCAAGCTACTCGGG + Intronic
945511449 2:210707673-210707695 CCTGTAATCCCAGCCACCTGGGG - Intergenic
945736622 2:213608808-213608830 CCTGTAGTCCCCAGCTACTCGGG - Intronic
946000270 2:216476438-216476460 CCTGTAGTCCCCTGCTACTCAGG - Intronic
946321015 2:218954598-218954620 CCTGGAGTCCAGGCCTCCTTTGG - Intergenic
946370640 2:219279488-219279510 CCAGGAGTCCCGGCCTCCTGCGG - Exonic
946639545 2:221768786-221768808 CCTGTAGTCCCAGCTTACTCAGG + Intergenic
946999147 2:225433225-225433247 CCTGTAGTCCCAGCTTACTCAGG + Intronic
947192259 2:227519048-227519070 CCTGTAGTCCCAGCTTACTCAGG + Intronic
947782760 2:232784512-232784534 CCTGTAGTCCCAAGCTACTCAGG - Intronic
947937304 2:234018936-234018958 CCTGTAGTCCCAGCTTTCTCTGG + Exonic
948168319 2:235879985-235880007 CCTGTAGTCCCAAGCTACTCAGG + Intronic
948195457 2:236092515-236092537 CCTGTAATCCCAGCTTACTCGGG - Intronic
948345640 2:237295446-237295468 ACTGTAGTCCCAGCCTTCTCAGG - Intergenic
948442639 2:238005318-238005340 CCTGTGGTCCCAGCTACCTCAGG - Intronic
948696682 2:239736411-239736433 CCTGGAGTCCCGGCTGCCCCTGG + Intergenic
948715680 2:239860132-239860154 CCTGTAGTTCCAGCTACCTCAGG + Intergenic
948806583 2:240455822-240455844 CCTGTGGCCCCGGCCTGCGCCGG + Intronic
948931032 2:241132390-241132412 CCTGTAGTCCCCAGCTACTCGGG + Intronic
948968344 2:241402789-241402811 CCTGTAGTCCCAGCTAACTCAGG - Intronic
1169247808 20:4037671-4037693 CCTGTAGTCCCCAGCTACTCGGG - Intergenic
1169384111 20:5133374-5133396 CCTGTAGTCCTGAGCTACTCAGG - Intronic
1169389635 20:5179243-5179265 CCTGTAGTCCCAGCTACTTCGGG - Intronic
1169475371 20:5926310-5926332 CCTATAGTCCCTCCCTACTCAGG + Intergenic
1169756604 20:9049794-9049816 CCTGTAGTCCCCAGCTACTCGGG - Intergenic
1169775468 20:9247757-9247779 CCTGGAGCACCTGCCTCCTCAGG - Intronic
1170704108 20:18729125-18729147 CCTGTAGTCCCAGCCCCTTGAGG - Intronic
1170992883 20:21321138-21321160 CCTGTAATCCCAGCTTACTCAGG - Intronic
1171214965 20:23345695-23345717 CCTGTAATCCCAGCTTGCTCAGG - Intergenic
1171353568 20:24524519-24524541 CCTGTAGTCCCAGCTACCCCGGG + Intronic
1171445617 20:25201839-25201861 CCTGTAGTCCCAAGCTCCTTGGG - Intronic
1172018362 20:31894225-31894247 CCTGTAGTCCCAGCTACCTGGGG - Intronic
1172251378 20:33481590-33481612 CCTGTAATCCCAGGCTGCTCAGG + Intergenic
1172256463 20:33522616-33522638 CCTGTAGTCCCAACCTACTTGGG + Intronic
1172391028 20:34565374-34565396 CTTGTAGTCCCAGCTTTCTCGGG - Intronic
1172450422 20:35018776-35018798 CCTGTACCCGCTGCCTCCTCTGG - Intronic
1172481604 20:35274909-35274931 CCTGTGGTCACGGCATCCTGTGG + Exonic
1172496470 20:35388939-35388961 CCTGTAGTCCCCAGCTACTCGGG + Intronic
1172541289 20:35719152-35719174 CCTGTAGTTCCAGCTTACTCTGG - Intronic
1172553298 20:35818658-35818680 CCTATAGTCCCAGCCTACTCAGG - Intronic
1172631354 20:36380284-36380306 CCTGTAGTCCCAGCTACCTGGGG + Intronic
1172700100 20:36848022-36848044 CCTGTAGTCCCCAGCTACTCAGG + Intronic
1172748607 20:37233097-37233119 CCTGTAGTCCCGGCTACTTGAGG + Intronic
1173560683 20:44003307-44003329 CCTGTAGTCCCAGCTACTTCGGG - Intronic
1173612515 20:44380417-44380439 CCTGTAGTCCCAGCTTACTTGGG - Intronic
1173794443 20:45849407-45849429 CCTGTAGTCCCCCCCCACTCAGG - Intronic
1173879371 20:46400011-46400033 CCTGTAGTCCCTAGCTACTCAGG + Intronic
1174048748 20:47752625-47752647 CCTGTAGTCCCAGCTACTTCGGG + Intronic
1174617815 20:51849841-51849863 CCTGTAGTCCCAACCTACTCAGG + Intergenic
1174814782 20:53677287-53677309 CCTGTAATCCCAGCTACCTCAGG + Intergenic
1174864809 20:54125422-54125444 CCTGTAGTCCCAGCTACCTTAGG + Intergenic
1175106820 20:56621267-56621289 CTTGTAGTCCCAGCTTACTCGGG - Intergenic
1175183797 20:57166440-57166462 CCTGTAGTCCCCAGCTACTCGGG + Intergenic
1175383619 20:58580337-58580359 CCTGCAGTCCCGGCCCCCGCTGG - Intergenic
1175452931 20:59085249-59085271 CCTGTAGTCCCAAGCTACTCAGG + Intergenic
1175834303 20:61983536-61983558 CCTGTAGTCCCAGGCTACTGGGG + Intronic
1176413928 21:6463940-6463962 CCTGCTGACCCGGCCCCCTCTGG + Intergenic
1176870190 21:14077853-14077875 CCTGTAGTCCCAGCTACCTGGGG + Intergenic
1177227510 21:18276882-18276904 CCTGTAATCCCAGGCTACTCGGG - Intronic
1177227966 21:18281971-18281993 CCTGTAGTCCCAGCTACTTCGGG + Intronic
1177435603 21:21048475-21048497 CCTGTAGTCCCAGCTAACTCTGG - Intronic
1177435678 21:21049141-21049163 CCTGTAGTCCCAGCCTACTCGGG - Intronic
1178367718 21:32001150-32001172 CCTGTAGTCCCAGCTACTTCGGG + Exonic
1178464828 21:32838174-32838196 CCTGTAGTCCCAGCTACCTGGGG + Intergenic
1179453933 21:41485523-41485545 CCTGTAGTCCCAGCCACTTGGGG + Intronic
1179679598 21:43009484-43009506 CCTGTAGTCCCGGCTACTTGGGG + Intronic
1179689426 21:43072262-43072284 CCTGCTGACCCGGCCCCCTCTGG + Intronic
1181036249 22:20171131-20171153 CCTGTAGTCCCAGCTACCTGGGG + Intergenic
1181526440 22:23491712-23491734 CCTGTAGTCCCCAGCTACTCAGG - Intergenic
1181719708 22:24764157-24764179 CCTGGGGTCCCGGCCTCTTCTGG + Intronic
1181757551 22:25035167-25035189 CCTGTAGTCCCCAGCTACTCAGG - Intronic
1181975878 22:26729332-26729354 CCTGTAGACCCAGCTTACTCAGG - Intergenic
1182594054 22:31404362-31404384 CCTGTAGTCCCAGCTTACTCGGG - Intronic
1182594485 22:31408261-31408283 CCTGTAATCCCAGCTCCCTCAGG - Intronic
1182595533 22:31417244-31417266 CCTGTAGTCCCAAGCTGCTCGGG + Intronic
1182669232 22:31982039-31982061 CCTGTAGTCCCAGGCTACTCAGG - Intergenic
1183055444 22:35302458-35302480 CCTGTAATCCCGGCTACCTTGGG - Intronic
1183061148 22:35337058-35337080 CCTGTAGTCCCCAGCTACTCGGG - Intronic
1183119229 22:35717278-35717300 CCTGTAGTCCCCGCCACTTGGGG + Intergenic
1183181669 22:36264244-36264266 CCTTTAGTCCCCGGGTCCTCTGG + Intronic
1183348371 22:37320176-37320198 CCTGTTGTCCTGGCGTCCCCTGG - Intergenic
1183851735 22:40595242-40595264 CCTGTAGTCCCAGCCTACTTGGG - Intronic
1184053075 22:42023314-42023336 CCTGTGGTCCTAGCCTACTCTGG - Intronic
1184162738 22:42707531-42707553 CATGTAGTCCCAGCTACCTCGGG + Intronic
1184729372 22:46364486-46364508 ACTGCAGCCCCGGCCTCCCCAGG + Intronic
1184755704 22:46514683-46514705 CCTGCAGCCCCGGCTCCCTCCGG - Intronic
1184770697 22:46595017-46595039 CCTGTCGTTCCCGCCTCCTGTGG + Intronic
1184856356 22:47148733-47148755 CCTGGGGTCCCTCCCTCCTCTGG + Intronic
1184956630 22:47891304-47891326 CCTGTAGTCCCAGCTACCTGGGG + Intergenic
1185145879 22:49136446-49136468 TCTGTAATCCCAGCCTCCTACGG - Intergenic
1185263093 22:49881643-49881665 CCTGTAGTCCCAAGCTACTCAGG - Intronic
949301754 3:2592000-2592022 CCTGTAGTCCCAGCATACTAGGG - Intronic
949324482 3:2848125-2848147 CCTGTAGTCCCCAGCTACTCAGG + Intronic
950000838 3:9655117-9655139 CCTGTAATCCCAGCCTCCTTTGG + Intronic
950001755 3:9661961-9661983 CCTGTAGTCACAGCATACTCGGG + Intronic
950062003 3:10079427-10079449 CCTGTAGTCCCCAGCTACTCAGG - Intronic
950666648 3:14499597-14499619 CCTGTAGTCCCCAGCTACTCGGG + Intronic
950792664 3:15485834-15485856 CCTGTGGTCCCACCCTCCTGTGG + Intronic
950808178 3:15626427-15626449 CCTGTACTCCCAGCACCCTCAGG + Intronic
950986137 3:17369606-17369628 CCTGTAATCCCACCCTGCTCGGG - Intronic
950989293 3:17415279-17415301 CCTGTAGTCCCAGCTACCTGGGG - Intronic
951209998 3:19964733-19964755 CCTGTAGTCCCAGCCTCAGGAGG - Intronic
951218586 3:20046456-20046478 CCTGTAGTCCCTAGCTACTCAGG + Intronic
951374357 3:21895449-21895471 CCTGTAGTCCCCAGCTTCTCAGG - Intronic
951502243 3:23401803-23401825 CCTGTAGTCCCAAGCTACTCGGG - Intronic
951963316 3:28353057-28353079 CCTGTAGTCCCAGCCACCTGGGG + Intronic
951965905 3:28384735-28384757 CCTGTAATCCCAGCTTACTCAGG - Intronic
952208375 3:31203336-31203358 CCTGTAGTCCCAGCTACATCAGG + Intergenic
952599902 3:35067475-35067497 CCTGTAGTCCCAGCTCACTCAGG - Intergenic
953109669 3:39921755-39921777 CCTGTAGTCCCAGCCTACTCAGG + Intronic
953397999 3:42588278-42588300 CCTGTAGTCCCAGACTACTCGGG + Intronic
953609564 3:44436364-44436386 CATATGGTCCCTGCCTCCTCAGG + Intergenic
953649810 3:44792215-44792237 CCTGTAATCCCAGCCTCTTTGGG + Intronic
954016608 3:47697423-47697445 CCTGTAGTCCCAGGCTACTCGGG - Intronic
954035861 3:47850845-47850867 CCTCTGGTCCCGGCCTTCTCAGG + Intronic
954552758 3:51495867-51495889 CCTGTAGTCCCAGCTACCTGGGG + Intronic
954560564 3:51552694-51552716 CCTGTAATCCCAGCTACCTCAGG - Intronic
954805950 3:53220671-53220693 CCTGTAGACCCAGCTTACTCAGG + Intergenic
954807876 3:53230808-53230830 CCTGGAGCCCCGGCCCCTTCTGG + Intronic
955122340 3:56073292-56073314 CCTGTAGACCAGGGCTTCTCTGG + Intronic
955173996 3:56594556-56594578 CCTGTAGTCCCCAGCTACTCGGG + Intronic
955300679 3:57775561-57775583 CCTGTAGTCCCGGCTGCTTGAGG + Intronic
956098572 3:65743583-65743605 CCTGTAATCCCAGCTTACTCGGG + Intronic
956595354 3:70960964-70960986 CCTATAGTCCCAGCTTACTCAGG - Intronic
956730823 3:72194990-72195012 CCTGTAGTCCCCAGCTACTCGGG + Intergenic
957228321 3:77477478-77477500 CCTGGAGTGCCAGCCTCCCCGGG + Exonic
957865042 3:86012511-86012533 CCTCCGCTCCCGGCCTCCTCAGG - Intronic
957961400 3:87257826-87257848 CCTGTAGTCCCAGCTACTTCAGG + Intergenic
958002048 3:87762370-87762392 CCTGTAGTCCCAGCTACCTGGGG - Intergenic
958009555 3:87859071-87859093 CCTGTAATCCCAGCCTACTTGGG + Intergenic
958936854 3:100264229-100264251 CCTGTAGTCCCCAGCTACTCAGG - Intronic
959513819 3:107243622-107243644 CCTGTAGTCCCAGCCTACTTTGG + Intergenic
959539182 3:107521298-107521320 CCTGTAGTCCCAGCTTACTCGGG + Intergenic
959961263 3:112302144-112302166 GCTGTAGTTCAGGCCTACTCAGG - Intergenic
959962008 3:112308198-112308220 CCTCTAGTTCAGGCCTACTCAGG - Intergenic
960041645 3:113155829-113155851 CCTGTAGTCCCAGCTACCTGTGG + Intergenic
960584551 3:119308963-119308985 CCTGTAGTCCCAGCTTCTTAGGG - Intronic
960627081 3:119691658-119691680 CCTGTAATCCTGGGCTACTCAGG + Intergenic
960654638 3:119989519-119989541 CCTGTAGTCCCAAGCTACTCGGG + Intronic
962300819 3:134241223-134241245 CCTGTAGTCCCAAGCTACTCAGG + Intronic
962557584 3:136571442-136571464 CCTGTAGTCCCAGCTTACTTGGG + Intronic
962859484 3:139386376-139386398 CCTGTAGTCCCCAGCTACTCGGG - Intronic
962911082 3:139850320-139850342 CCTGTAGTCCCAGCTTACTTAGG - Intergenic
963104748 3:141637521-141637543 CCTGTAATCCCAGCCTACTTGGG - Intergenic
963128782 3:141839211-141839233 CCTGTAGTCCCCCGCTACTCGGG - Intergenic
963199607 3:142572648-142572670 CCTGTAGTCCCCAGCTACTCAGG + Intronic
963565223 3:146921215-146921237 CCTGTAGTCTCAGCTTACTCAGG - Intergenic
963822161 3:149909397-149909419 CCTGTAGTCCCAGCTTCCCCAGG - Intronic
963895162 3:150677618-150677640 CCTGTAGTCCCAGCCACTTGGGG - Intronic
964114985 3:153127012-153127034 CCTGTAATCCCAGCCTCCAGAGG - Intergenic
964426255 3:156556861-156556883 CCTGTAGTCCCCAGCTACTCAGG + Intergenic
964728237 3:159837597-159837619 CCTGTAGTCCCGGCTACTCCGGG + Intronic
964901571 3:161665345-161665367 CCTGTAGTCCCAGCCTACTCAGG - Intergenic
965568023 3:170141733-170141755 CCTGTAGTCCCAGCTACCTGGGG - Intronic
965572681 3:170187524-170187546 CCTGTAGTCCCAGCTTACTCGGG - Intergenic
965671315 3:171150749-171150771 CCTGCAGTCCTGGCCTTGTCAGG - Intronic
965747304 3:171938746-171938768 CCTGTAATCCCAGCCTAATCAGG - Intergenic
966429741 3:179818965-179818987 CCTGTAGTCCCCAGCTACTCAGG - Intronic
966457727 3:180136625-180136647 ACTGTAGCCCCAGACTCCTCAGG - Intergenic
966735659 3:183185039-183185061 CCTGTAGTCCCCAGCTACTCAGG - Intronic
966912875 3:184569163-184569185 GCTGGAGCCCCGGCCTGCTCCGG + Intronic
966946379 3:184779758-184779780 CCTGTAGTCCCAGCCACTTGGGG + Intergenic
966997102 3:185293546-185293568 CCTGTAGTCCCAGCTACCTGGGG - Intronic
967024530 3:185553260-185553282 CCTGTAATCCCAGCTACCTCAGG + Intergenic
967311553 3:188110881-188110903 CCTGTAATCCCAGGCTACTCTGG + Intergenic
967613987 3:191542925-191542947 CCTGTAATCCCAGCCACTTCAGG - Intergenic
968136875 3:196226195-196226217 CCTGTAGTCCCAGGCTACTTGGG + Intronic
968173141 3:196526446-196526468 CCTGTAGTCCCAGCTACCTCGGG + Intergenic
968173258 3:196527477-196527499 CCTGTAGTCCCAAGCTACTCAGG - Intergenic
968284432 3:197499724-197499746 CCTGTAGTCCCAGCTACCTTGGG + Intergenic
968337792 3:197928471-197928493 CCTGTAGTCCCCAGCTACTCAGG - Intronic
968779195 4:2566562-2566584 CCTGTAGTCCCCAGCTACTCGGG + Intronic
968862782 4:3185787-3185809 CCTGTAGTCCTGGCTAACTCAGG + Intronic
969010538 4:4058270-4058292 CCTGTAGTCCCACACTACTCAGG - Intergenic
969743524 4:9051626-9051648 CCTGTAGTCCCACACTACTCAGG + Intergenic
969811370 4:9651092-9651114 CCTGTAGTCCCAGCCACTTGGGG - Intergenic
969858107 4:10016017-10016039 CCTGGACTCAAGGCCTCCTCGGG + Intronic
971202670 4:24525915-24525937 CCTGTAGTCCCAGCTAACTCGGG + Intronic
971398351 4:26251509-26251531 CCTGTAATCCCAGCTACCTCAGG + Intronic
971919184 4:32914414-32914436 CCTGTAGTCCCAGCCTACTGGGG + Intergenic
972221603 4:36962318-36962340 CCTGTAATCCCAGCCTCTTGTGG - Intergenic
972544994 4:40072030-40072052 CTTGTAGTCCCAGCTTACTCAGG - Intronic
972545011 4:40072197-40072219 CCTGTAGTCTCAGCTTACTCAGG - Intronic
972636000 4:40884636-40884658 CCTGTAGTCCCAGCTAACTCAGG + Intronic
973655768 4:53046335-53046357 CCTGTAGTCCCAGCTACCTGGGG - Intronic
974037145 4:56827172-56827194 CCTGTAATCCCAGCTTACTCAGG + Intergenic
974052556 4:56954649-56954671 CCTGTAATCCCAGCTTACTCGGG - Intergenic
974989284 4:69064430-69064452 GCTGTAGTTCAGGCCTTCTCAGG - Intronic
975325207 4:73051443-73051465 CCTGTAGTCCCAGCTTACTCGGG - Intergenic
975788460 4:77920885-77920907 CCTGTAATCCCCACCTACTCAGG - Intronic
976247431 4:83017666-83017688 CCTGTAGTCCCAGCTACCTGGGG + Intergenic
976476343 4:85488028-85488050 CCTGTAGTCCCCAGCTACTCAGG - Intronic
976585877 4:86796515-86796537 CCTGTAGTCCCTAGCTACTCAGG + Intronic
976649759 4:87422224-87422246 CCTGTAGTCCCAGCTACGTCGGG + Intergenic
976721442 4:88172452-88172474 CCTGTAATCCCAGCTTACTCAGG + Intronic
976760765 4:88546633-88546655 CCTGTAGTCCCAGCTTCCCTGGG - Intronic
977900621 4:102418112-102418134 CCTGTAGTCCCAGCCTCAGGAGG + Intronic
977956861 4:103037983-103038005 CCTGTAGTCCCAGCCTACTCAGG - Intronic
978297652 4:107225933-107225955 CCTGTAGTCCCCAGCTACTCAGG - Intronic
978427535 4:108597677-108597699 CCTGTAATCCCCACCTACTCAGG - Intergenic
978460430 4:108945786-108945808 CCTGTAGTCCCAGCCTACTGGGG - Intronic
978814907 4:112893276-112893298 CCTGTGGTCCCAGCCTACTTGGG - Intronic
979293843 4:119007978-119008000 TCTGTATTCCCTTCCTCCTCTGG - Intronic
979379135 4:119987697-119987719 CCTGTAGTCCCAGCCACTTGGGG + Intergenic
979580814 4:122357437-122357459 CCTGTAGTCCCCAGCTACTCGGG + Intronic
979644019 4:123045970-123045992 CCTGTAATCCCAGCTACCTCAGG + Intronic
980101486 4:128545585-128545607 CCTGTAGTCCCAGGCTACTCAGG + Intergenic
980105235 4:128582079-128582101 CCTGTAGTCCCAGCTTCTTGGGG - Intergenic
980909703 4:138982950-138982972 CCTGTAGTCCCAGCTACCTGGGG + Intergenic
980916123 4:139034693-139034715 CCTGTAGTCCCAGCTTCTTGAGG - Intronic
981844446 4:149151783-149151805 CCTGTAATCCCAGCCTCTTGAGG - Intergenic
981912102 4:149993820-149993842 CCTGTAGTCCCAGCTAACTCAGG - Intergenic
981957789 4:150500451-150500473 CCTGTAATCCCAGCTTACTCAGG + Intronic
982038631 4:151372726-151372748 CCTGTATTCCCAGCTTGCTCTGG - Intergenic
983222728 4:165058290-165058312 CCTGTAGTCCCAGCCTACTTGGG - Intergenic
983390581 4:167125588-167125610 CCTGTAGTCCCAAGCTACTCGGG + Intronic
983434009 4:167688549-167688571 CCTGTAGTCCCAGCTCCCTGAGG - Intergenic
983573970 4:169240318-169240340 CCTGTGGTCCCAGCTACCTCAGG - Intronic
983641803 4:169950266-169950288 CCTGTAGTCCCAGCTACCTATGG + Intergenic
983654961 4:170073621-170073643 CCTGTAGTCCCCAGCTACTCGGG - Intronic
984142046 4:176015401-176015423 CCTGTAATCCCAGGCTACTCAGG - Intergenic
985572371 5:655233-655255 CCTGTAGTCCCAGCTTCTTGGGG + Intronic
985860767 5:2469009-2469031 CCTGCAGTCCCAGCCACCTGTGG + Intergenic
986501268 5:8402442-8402464 CCTGTAGTACCAGCTTACTCGGG - Intergenic
986884530 5:12216854-12216876 CCTGTAGTCCCAGTTACCTCAGG + Intergenic
987588135 5:19885683-19885705 CCTGTAGTCCTAGCTTGCTCAGG - Intronic
987706825 5:21469341-21469363 CCTGTAGTCCCAGCTTACTCTGG - Intergenic
987714860 5:21554764-21554786 GCTGTAGTTCAGGCCTGCTCAGG + Intergenic
988502159 5:31792541-31792563 CCTGTAATCCCAGCTTCTTCGGG - Intronic
988790923 5:34606874-34606896 CCTGTAGTCCCAAGCTACTCGGG - Intergenic
989057902 5:37382533-37382555 CCTGTAGTCCCAGCTACCTGGGG - Intronic
989058790 5:37389533-37389555 CCTGTAGTCCCAGCTTACTCTGG - Intronic
989367710 5:40675258-40675280 CCTGTAGTCCCGGCTTACTTGGG + Intergenic
989514722 5:42328636-42328658 CCTGTAGTCCCAGCTTACTCAGG - Intergenic
989596735 5:43163094-43163116 CCTGTAGTCCCAGCTTACTCAGG - Intronic
989977709 5:50606804-50606826 CCTGGAGTCTCTGCCTCCACTGG + Intergenic
990594097 5:57295746-57295768 CCTGTAGTCCCGGCTACTTGGGG + Intergenic
990695281 5:58409425-58409447 ACTGTAGTCCCGACCACCTTGGG + Intergenic
990998855 5:61762437-61762459 CCTGTAGTCCCAGTTTACTCGGG - Intergenic
991088046 5:62666434-62666456 CCTGTAGTCCCAGCCACTTGGGG - Intergenic
991333846 5:65524554-65524576 CCTGTAGTCCCAAGCTACTCAGG + Intronic
991368514 5:65894238-65894260 CCTGTAGTCTCAGCCACCTGGGG - Intergenic
992113132 5:73514822-73514844 CCTGTAGTCCCAGCCTACTGGGG + Intergenic
992470656 5:77049671-77049693 CCTGTAGTCCCAGCTACCTTCGG - Intronic
992507165 5:77398444-77398466 CCTGTAGTCCCAGCTTACTCAGG - Intronic
992664246 5:78990613-78990635 CCTGTAGTCCCCAGCTCCTCGGG - Intergenic
993053891 5:82957933-82957955 CCTGTAGTCCCCAGCTACTCAGG - Intergenic
993896217 5:93538348-93538370 CCTGTAGTCCCCCACTGCTCGGG + Intergenic
994096858 5:95855096-95855118 CCTGTAGTCCCCAGCTACTCGGG - Intronic
994372452 5:98982751-98982773 CCTGCAGTCCCAGCCTACTCAGG - Intergenic
994606358 5:101972227-101972249 CCTGTAGTCCCAGCTTGCTCGGG - Intergenic
994894345 5:105683296-105683318 CCTGTAGTCCCAGCTACTTCTGG - Intergenic
995910012 5:117175746-117175768 CCTGTAGTCCCAGCAACTTCAGG - Intergenic
996393020 5:122983726-122983748 CCTGTAGTCCCCACCTACTCAGG - Intronic
996685344 5:126273882-126273904 CCTGTAGTCCCAGCTTACTTGGG - Intergenic
997299357 5:132791177-132791199 CCTGTAGTCCCAGCTTACTCGGG + Intronic
997352977 5:133244169-133244191 CCTGTAGCCCCTGTCTCCTGGGG - Intronic
997448930 5:133966094-133966116 CCTGTAGTCCCAGCATACTCGGG + Intronic
997708911 5:135986508-135986530 CCTGTAGTCCCAGCCACTTGGGG - Intergenic
997934560 5:138098911-138098933 CCTGTAGTCCCCAGCTGCTCGGG + Intergenic
998018328 5:138750686-138750708 CCTGTAGTCCCAGCTACCTGGGG - Intronic
998047641 5:139002085-139002107 CCTGTAGTCCCAGCTACCTGGGG + Intronic
998052752 5:139049666-139049688 CCTGTAGCCCCAGCCTACTCAGG + Intronic
998118215 5:139555167-139555189 CCTGTAGTCCCAGCTACTTCAGG - Intronic
998229821 5:140353831-140353853 CCTGTAGTCCCCAGCTACTCAGG - Intergenic
998428193 5:142047671-142047693 CCTGTAATCCCTCCCTACTCGGG - Intergenic
998740865 5:145199724-145199746 CCTGTAGTCCTAGCTACCTCTGG + Intergenic
999063596 5:148661040-148661062 ACTGTAGCCCCTTCCTCCTCAGG - Intronic
999968223 5:156832572-156832594 CCTGTAGTCCCGAGCTACTTTGG + Intergenic
1000001301 5:157141711-157141733 CCTGTAGTCCCCAGCTACTCAGG - Intronic
1000083084 5:157865549-157865571 CCTGTAGTCCCAGCTACCTCAGG + Intergenic
1000084124 5:157874314-157874336 CCTGTAATCCCAGCTACCTCGGG + Intergenic
1000558204 5:162753429-162753451 CCTGTAATCCCAGCTTACTCGGG - Intergenic
1000774039 5:165394846-165394868 CCTGTAGTCCCAGCTACCTGGGG + Intergenic
1000886098 5:166749410-166749432 CCTGTAGTCCCAGCTACCTGGGG + Intergenic
1001486998 5:172127041-172127063 CCTGTAATCCCAGGCTACTCAGG + Intronic
1001826871 5:174751969-174751991 CCTGGGCTCCCGGCCTCCCCAGG + Intergenic
1002281486 5:178132603-178132625 CCTGTAGTCCCAGCTTCTTGGGG + Intronic
1002655962 5:180747247-180747269 CCTGTAGACCCAGCTTACTCAGG - Intergenic
1003597573 6:7487910-7487932 CCTGTAGTCCCAGCTAACTCTGG - Intergenic
1004405867 6:15333054-15333076 CCTGTAGTCCCAAGCTACTCGGG - Intronic
1004620974 6:17330066-17330088 CCTGTAGTCCCAGCTAACTCAGG - Intergenic
1005050090 6:21676519-21676541 CCTGTAATCCCAGCTTACTCAGG - Intergenic
1005252616 6:23964624-23964646 CCTGTAGTCCCAGCTTACTCGGG + Intergenic
1005299974 6:24460862-24460884 CCTGTAGTTCCAGGCTACTCAGG - Intronic
1005423309 6:25675298-25675320 GCTGTAGTTCAGGCCTACTCAGG - Intronic
1005476170 6:26210144-26210166 CCTGTAGTCCCCAGCTACTCGGG + Intergenic
1005491362 6:26350201-26350223 CCTGTAGTCCCAGCTTACTCAGG + Intergenic
1005959337 6:30684784-30684806 CCTCCAGTCCCAGCGTCCTCTGG + Exonic
1005985553 6:30872287-30872309 CCTGTAGTCCCAGCCACTTGGGG - Intergenic
1005995650 6:30929728-30929750 CCTGTAGTCCCAGCTACTTCGGG - Intergenic
1006468256 6:34209350-34209372 CCTGCAGTCCCTCCCTACTCTGG + Intergenic
1006654675 6:35580661-35580683 CCTGTAGTCCCCAGCTACTCGGG - Intronic
1006657151 6:35605518-35605540 CCTGTAGTCCCAGCTTACTTGGG - Intronic
1006659607 6:35629227-35629249 CCTATAGTCCCAGCTTTCTCAGG - Intronic
1006689901 6:35873949-35873971 CCTGTAGTCCCAAGCTACTCGGG - Intronic
1006888440 6:37401899-37401921 GCTGTAGTTCAGGCCTGCTCAGG + Intergenic
1007013773 6:38442360-38442382 CCTGTAGTCCCAGCCTACTCGGG + Intronic
1007092024 6:39190573-39190595 CCTGCAGGCAAGGCCTCCTCAGG + Exonic
1007331143 6:41110222-41110244 CCTGTAGTCCCCAGCTACTCGGG - Intergenic
1007435789 6:41809700-41809722 CCTGTGGTCCCAACCTACTCAGG + Intronic
1007482965 6:42162288-42162310 CCTGTAATCCCAGCTTACTCAGG + Intronic
1007626139 6:43247351-43247373 GTTGTAGTCTCAGCCTCCTCGGG + Intronic
1007653775 6:43439524-43439546 CCTGTAGTCCCAGCCACTTGAGG - Intronic
1007680848 6:43632379-43632401 CCTGTAGTCCCAGCTACCTGGGG - Intronic
1007682438 6:43643888-43643910 CCTGTAGTCCCAGCTACCTGGGG + Intergenic
1007885807 6:45228761-45228783 CCTGTAGTCCCAGCTTCTTTGGG - Intronic
1008276268 6:49548127-49548149 CCTGTAATCCCAGCTTACTCAGG + Intergenic
1008625635 6:53313483-53313505 CCTGTAGTCCCAAGCTACTCAGG - Intronic
1009001857 6:57727277-57727299 GCTGTAGTTCAGGCCTGCTCAGG - Intergenic
1009021399 6:57951158-57951180 CCTGTAGTCCCAGCTTACTCTGG + Intergenic
1009432748 6:63584657-63584679 CCTGTAGTCCCCAGCTACTCAGG - Intergenic
1009797532 6:68491230-68491252 CCTGTAATCCCAGGCTACTCAGG - Intergenic
1010228508 6:73514118-73514140 CCTGTAGTCCCAAGCTACTCTGG - Intergenic
1010405054 6:75495571-75495593 CCTGTAGTCCCAGCTTCTTGGGG + Intergenic
1011386028 6:86799113-86799135 CCTGTAGTCCCAGCTACTTCAGG - Intergenic
1011395766 6:86905238-86905260 TCTGTAGTCCCAGCCTCCTATGG - Intergenic
1011531011 6:88321011-88321033 CCTGTAGTCCCAGCTACCTGGGG - Intergenic
1012011233 6:93788616-93788638 CCTGTATTCCCAGCTGCCTCAGG - Intergenic
1012409429 6:98938997-98939019 ACTGTAGCCCCAGCCTCCTGAGG - Intronic
1012439114 6:99245880-99245902 CCTGTAATCCCAGCTACCTCGGG + Intergenic
1012526032 6:100178785-100178807 CCTGCAGGCCCAGCATCCTCTGG - Intergenic
1013012644 6:106134266-106134288 CCTGTGGTCACTGCCTCCTTGGG - Intergenic
1013100667 6:106983714-106983736 CCTGTAGTCCCAGCTACCTGGGG - Intergenic
1013237312 6:108208610-108208632 CCTGTAATCCCAGCTACCTCAGG + Intergenic
1013250234 6:108326193-108326215 CCTGTAGCCCTAGCCTACTCAGG - Intronic
1013454688 6:110319900-110319922 CCTCTGCTCCCGGGCTCCTCTGG + Intronic
1013476569 6:110512355-110512377 CCTGTAATCCCAGCTTACTCAGG + Intergenic
1013579523 6:111519145-111519167 CCTATAGTCCCAGCCACCTGGGG - Intergenic
1013776140 6:113680354-113680376 CCTGTAGTCCCAGCTGCTTCAGG - Intergenic
1014005132 6:116409399-116409421 CCTGTAGTCCGAGCCTACTCGGG - Intronic
1014434815 6:121409393-121409415 CCTGTAGTCCCAGCTTACTGGGG - Intergenic
1015023125 6:128500999-128501021 CCTGTAGTCCCAGCCTACCTGGG - Intronic
1015748722 6:136538665-136538687 CCTGTAGTCCCAGCTACCTCAGG + Intronic
1015755533 6:136602425-136602447 CCTGTAGTCCGAGCTACCTCAGG - Intronic
1015928450 6:138333564-138333586 CCTGTAGTCCCAGCTTACTAGGG - Intronic
1015945036 6:138490755-138490777 CCTGTAGTCCCAGCCTTCTCAGG - Intronic
1017502985 6:155042466-155042488 CCTGTAGTCCCAGCTTACTCGGG + Intronic
1017842138 6:158231206-158231228 CCTGTAGTCCCTAGCTACTCGGG + Intergenic
1018016359 6:159715774-159715796 CCTGTAGTCCCAGCTACCTGGGG + Intronic
1018025388 6:159801569-159801591 CCTGTAGTCCCAGTTTACTCAGG - Intronic
1018074278 6:160197236-160197258 CCTGTAGTCCCCAGCTACTCAGG - Intronic
1018303272 6:162426570-162426592 CCTGTAGTCCCAGCCACTTGGGG - Intronic
1018330684 6:162724857-162724879 GCTGTAGTTCAGGCCTACTCAGG - Intronic
1018404601 6:163465502-163465524 CCTGTAATCCCAGCTTGCTCGGG + Intronic
1019339472 7:502095-502117 CCTGTAGTCCCAGCCTACTTGGG + Intronic
1019708852 7:2509356-2509378 GCTGGGGTCCCGGCCTCCTCCGG - Intergenic
1020009949 7:4802257-4802279 CCTGTCCTCCCGGGCACCTCGGG + Intronic
1020166774 7:5813563-5813585 CCTGTAGTCCCCAGCTACTCAGG - Intergenic
1020205930 7:6115977-6115999 CCTCTAGTCCCAGCATACTCAGG + Intronic
1020656394 7:10932845-10932867 CCTGTAGTCCCGGCTACTTAGGG + Exonic
1020829077 7:13070891-13070913 CCTGTAGTCCCAGCTTACTCGGG - Intergenic
1020834388 7:13130904-13130926 CCTGTAGTCCCAGGCTACCCAGG + Intergenic
1021004045 7:15371342-15371364 CCTGTAGTCCCAGCTACCTCTGG - Intronic
1021270091 7:18574692-18574714 CCTGTCGTCTTGGCCTCCTTTGG - Intronic
1021459177 7:20866250-20866272 CCTGTAATCCCAGCTACCTCGGG - Intergenic
1021568882 7:22044327-22044349 CCTGTAGTCCCAGGCTACTCAGG + Intergenic
1021650527 7:22828427-22828449 CCTGTAATCCCAGGCTACTCGGG + Intergenic
1021672815 7:23049142-23049164 CCTGTAGTCCCCAGCTACTCAGG - Intergenic
1021824975 7:24541002-24541024 CCTGTAGTCCCAGCCACTTAGGG - Intergenic
1022085672 7:27065169-27065191 CCTGTAATCCCAGCTTACTCAGG + Intergenic
1022306270 7:29149314-29149336 CTTGTAGTCCCAGCTTACTCGGG - Intronic
1022415554 7:30173792-30173814 CCTGAAGACCCAGCCTCCCCTGG + Intergenic
1022755294 7:33281495-33281517 CCTGCAGTCCCAGCCACCTGTGG - Intronic
1022817878 7:33930824-33930846 CCTGTAGTCCCAGCTACTTCTGG + Intronic
1023155731 7:37249952-37249974 CCTGTAGTCCCTACCTACTCAGG + Intronic
1023384644 7:39643730-39643752 CCTGTAATCCCAGCCATCTCAGG + Intronic
1023520967 7:41049661-41049683 CCTGGAGTTCTGGCCACCTCTGG + Intergenic
1024067314 7:45751155-45751177 CCTGTAGTTCCAGGCTACTCGGG + Intergenic
1024457018 7:49620084-49620106 CCTCTATTCCCAGCCTCCTGAGG + Intergenic
1025083571 7:56004725-56004747 CCTGTAGTCCCAGCTTACTTGGG + Intergenic
1025733474 7:64126798-64126820 CCTGTAGTCCCCAGCTACTCGGG + Intronic
1025955058 7:66176508-66176530 CCTGTAATCCCTGCCTACTTGGG - Intergenic
1025956218 7:66185223-66185245 CCTGTAGTCCCAGCTACCTGGGG - Intergenic
1026173224 7:67972798-67972820 CCTATAGTCCCAGCTTACTCGGG + Intergenic
1026314005 7:69212191-69212213 CCTGTAGTCCCCAGCTACTCAGG - Intergenic
1026536070 7:71239347-71239369 CCTGTAGTCCCAGCTACCTGGGG + Intronic
1026573542 7:71553201-71553223 CCTGTAGTCCCGGCTACTTTGGG + Intronic
1026773741 7:73218337-73218359 CCTGTAGTCCCAACCTACTGGGG + Intergenic
1026836082 7:73640279-73640301 CCTGTAGTCCCAGCTTCTTGGGG + Intergenic
1027014600 7:74771731-74771753 CCTGTAGTCCCAACCTACTGGGG + Intergenic
1027063579 7:75105071-75105093 CCTGTAGTCCCAGCCACCCGGGG + Intronic
1027073433 7:75174226-75174248 CCTGTAGTCCCAACCTACTGGGG - Intergenic
1027256683 7:76435218-76435240 CCTGTAGTCCCAGCCACTCCAGG + Intronic
1027501475 7:78957138-78957160 CCTGTAGTCCCAGCTACTTCGGG + Intronic
1027667799 7:81060580-81060602 CCTGTAGTTCCAGCTTACTCAGG - Intergenic
1028209867 7:88060640-88060662 CCTGTAGTCTCAGGCTACTCAGG + Intronic
1028809013 7:95062509-95062531 CCTGTAGTCCCAGCTGGCTCAGG - Intronic
1028871558 7:95776066-95776088 CCTGTAATCCCAGGCTACTCGGG + Intronic
1028926018 7:96357878-96357900 CCTGTAGTCCCAGCTTCCGGAGG - Intergenic
1029069822 7:97886270-97886292 CCTGTAGTCCCACACTACTCAGG - Intergenic
1029122124 7:98275541-98275563 CCTGTAGTCCCAGCTACCCCAGG - Intronic
1029416384 7:100445819-100445841 CCTGTAGTCCCAAGCTACTCAGG - Intergenic
1029722701 7:102380024-102380046 CCTGTAATCCCAGCCTCCTTTGG + Intronic
1029726224 7:102407088-102407110 CCTGTAGTCCCAGGCTACTCAGG + Intronic
1030057670 7:105597637-105597659 TCTGTAGTCCCAGCTACCTCAGG - Intronic
1030761603 7:113358745-113358767 CCTGTAGTCCCAAGCTACTCAGG + Intergenic
1031074358 7:117198716-117198738 CCTGTTGCACCTGCCTCCTCAGG + Intronic
1031847241 7:126820975-126820997 CCTGTAGTCCCAACTACCTCAGG + Intronic
1032131887 7:129236144-129236166 CCTGTAGTCCCAGCTAACTCAGG - Intronic
1032541562 7:132707067-132707089 CCTGTAGTCCCAGCTAACTCGGG - Intronic
1032651037 7:133878846-133878868 CCTGTAGTCCCCAGCTACTCAGG - Intronic
1032655329 7:133922722-133922744 CCTGTAGTCCCCAGCTACTCAGG + Intronic
1032670488 7:134077810-134077832 GCTGTAGTTCAGGCCTACTCAGG + Intergenic
1032727201 7:134601613-134601635 CCTGTAATCCCGGCTACCCCAGG + Intergenic
1032831970 7:135636880-135636902 CCTGTAGTCCCAGCTACCTGGGG + Intronic
1033004011 7:137540559-137540581 CCTGTAGTCCCCAGCTACTCAGG + Intronic
1033357827 7:140614988-140615010 CCTGTAGTCCCAGCTACCTGGGG - Intronic
1033787264 7:144747660-144747682 CCTGTAGTCTCAGCTACCTCGGG + Intronic
1033939415 7:146633703-146633725 CCTGTAGTCCCAGCTACCTCGGG + Intronic
1034163883 7:149011573-149011595 CCTGAAGACCTGCCCTCCTCGGG + Intronic
1034245661 7:149642491-149642513 CCTGTAGTCCCAGAGTACTCGGG + Intergenic
1034257182 7:149731106-149731128 CCTGCTGTCCTGGCCCCCTCAGG + Intronic
1034532019 7:151701716-151701738 CCTGTAGTCCCCAGCTACTCGGG + Intronic
1034537932 7:151737630-151737652 ACTGGAGCCCAGGCCTCCTCAGG + Intronic
1035220401 7:157402988-157403010 CCTGTCGTCAGGGCCTCCTGAGG - Intronic
1035632215 8:1116670-1116692 CCTGTAGTCCCAGCTAACTCAGG + Intergenic
1036252068 8:7170929-7170951 CCTGTAGTCCCACACTACTCAGG - Intergenic
1036365422 8:8116532-8116554 CCTGTAGTCCCACACTACTCAGG + Intergenic
1036885521 8:12549584-12549606 CCTGTAGTCCCACACTACTCAGG - Intergenic
1037433448 8:18838675-18838697 CCTGTAGTCCCAGCTACTTCGGG + Intronic
1037790057 8:21930964-21930986 CCTGTAGTCCCAGCCTCACTTGG - Intronic
1037794926 8:21985125-21985147 CCTGTAGTCCCAGCTACTTCGGG - Intronic
1037883374 8:22583640-22583662 CCTGTAGTCCCAGCTACCTGGGG + Intronic
1038404529 8:27311479-27311501 CCCGCAGTTCCCGCCTCCTCAGG + Exonic
1038493958 8:27988892-27988914 CCTCTCCTCCCAGCCTCCTCTGG - Intronic
1038609488 8:29046856-29046878 CCTGTAGTCCCAGCTACCTGGGG + Intronic
1038728285 8:30101541-30101563 CCTGTAATCCCAGCTTACTCAGG + Intronic
1038916209 8:32026190-32026212 CCTGTAGTCCCGGCTACTCCGGG - Intronic
1039433995 8:37547206-37547228 GCTGTCCTCCCAGCCTCCTCTGG + Intergenic
1039498518 8:37999174-37999196 CCTGTGGTCCCAGCTTACTCTGG + Intergenic
1039538985 8:38345782-38345804 CCTGTAGTCCCCAGCTACTCGGG + Intronic
1039566932 8:38558527-38558549 CCTGTAGTCCCAAGCTACTCGGG + Intergenic
1039664583 8:39511101-39511123 CCTGTAGTCCCAAGCTACTCAGG + Intergenic
1040934656 8:52769997-52770019 CATGTAGTCACTGCCTCCTTAGG + Intergenic
1041242530 8:55860206-55860228 CCTGTAGTCCTGGCTACCTGGGG + Intergenic
1041891132 8:62869891-62869913 CCTGTAGTCCCAGCCACTTCGGG - Intronic
1041933787 8:63314944-63314966 CCTGCTCTCCAGGCCTCCTCAGG + Intergenic
1042002715 8:64144475-64144497 CCTGTAGTCCCAGCTACCTGGGG - Intergenic
1042293365 8:67193220-67193242 CCTGTAGTCCCCGGCTACTTGGG - Intronic
1042725453 8:71870354-71870376 CCTGTAGTCCCCAGCTACTCCGG - Intronic
1042754052 8:72190164-72190186 CCTGTAGTCCCAAGCTACTCGGG + Intergenic
1042909143 8:73806585-73806607 CCTGTAGTCCCAGCTAACTCAGG + Intronic
1042929966 8:74003536-74003558 GCTGTAGTTCAGGCCTGCTCAGG + Intronic
1043640436 8:82443307-82443329 CCTGTAGCCCCAGGCTACTCGGG + Intergenic
1044781852 8:95751670-95751692 CCTGTAGTCCCAAGCTACTCAGG + Intergenic
1044832294 8:96261978-96262000 CCCGGGGTCCCGGCCTTCTCGGG + Exonic
1044990635 8:97792376-97792398 CCTGTAGTCCCAGCTGCCTGGGG - Intronic
1045219649 8:100186188-100186210 CCTGTAGTCCCAGTATTCTCAGG - Intronic
1045256106 8:100523765-100523787 CCTGTAGTCCCAGCTACCTGGGG - Intronic
1045754176 8:105522644-105522666 CCTGTAATCCCAGCTTACTCGGG + Intronic
1045985503 8:108245343-108245365 CCTGTAGTCCCAGCTACTTCTGG + Intronic
1046803018 8:118449673-118449695 CCTGTAGTCCCAGCCTGCCTCGG + Intronic
1047226605 8:122960412-122960434 CCTGTAGTCCCTGCCACTTGTGG + Intronic
1047267862 8:123325218-123325240 CCTGTATTCCCAGCCTACTGGGG - Intronic
1047377727 8:124318497-124318519 CCTGTAATCCCAGCTTACTCAGG - Intronic
1047398833 8:124528938-124528960 GCTGTAGTTCAGGCCTACTCAGG - Intronic
1047773224 8:128047345-128047367 CCTCTTATCCCTGCCTCCTCTGG - Intergenic
1047955872 8:129975002-129975024 CCTGTAGTCCCAAGCTACTCGGG - Intronic
1047964616 8:130036696-130036718 CCTGTAGTCCCAGCTACCTGGGG + Intergenic
1047997819 8:130353744-130353766 CCTGTAGTCCCAGCTGCCCCAGG + Intronic
1048204248 8:132402891-132402913 CCTGTAGTCCCAGCTTACTCAGG + Intronic
1048322999 8:133416164-133416186 CCTGGACTCCAGGGCTCCTCTGG - Intergenic
1048693117 8:136989753-136989775 CCTGCCGTCTCGGCCCCCTCTGG - Intergenic
1048813134 8:138306704-138306726 CCTGTAGTCCCGGCTACTTGGGG - Intronic
1049055684 8:140235093-140235115 CTTGTAATCCCAGCCTACTCGGG - Intronic
1049304618 8:141894427-141894449 CCTGTAATCCCAGCTGCCTCGGG + Intergenic
1049328396 8:142036512-142036534 CCTGTAGTCCCAGCTACTTCGGG + Intergenic
1049391608 8:142374553-142374575 CCTGTAGTCCCAGGCTACTCGGG + Intronic
1049610597 8:143553129-143553151 CCTGAAGTCCCGCCCTGCGCGGG + Intergenic
1049711280 8:144064466-144064488 CCTGTAGCCCTGGCCTGCCCTGG - Intergenic
1050512602 9:6412026-6412048 CCTGTAGTCCCAGCTACCCCAGG + Intergenic
1050513745 9:6420579-6420601 CCTGTAGTCCCAGCTACTTCAGG + Intronic
1051645463 9:19263777-19263799 CCTGTAGTCCCCAGCTACTCGGG - Intronic
1052647545 9:31254964-31254986 CCTGTAGTCCCAGCTACCTCGGG + Intergenic
1052809743 9:33046767-33046789 CCTGTAGTCCCCAGCTACTCGGG + Exonic
1053102073 9:35379322-35379344 CCTGTAGTCCCAGCTTACTCGGG + Intronic
1053135877 9:35650030-35650052 CCTGCAGCTGCGGCCTCCTCAGG - Exonic
1053447667 9:38165401-38165423 CCCATAGTCCCAGCCTGCTCAGG - Intergenic
1054143348 9:61545398-61545420 CCTGTAGTCCCCAGCTGCTCAGG + Intergenic
1054190295 9:61981580-61981602 CCTGTAGTCCCCAGCTGCTCAGG - Intergenic
1054463059 9:65476267-65476289 CCTGTAGTCCCCAGCTGCTCCGG + Intergenic
1056338191 9:85598842-85598864 CCTGTAGTCCCCAGCTACTCGGG - Intronic
1056556991 9:87697828-87697850 CCTGTAGTCCCAGCTACTTCAGG + Intronic
1056644858 9:88402114-88402136 CCTGTAATCCCAGCTTACTCAGG - Intronic
1057088693 9:92236105-92236127 CCTGTAATCTCAGCCTACTCGGG - Intronic
1057352394 9:94309892-94309914 CCTGTAGTCCCAGCTACCTGTGG + Intergenic
1057411102 9:94817123-94817145 CCTATAGTCCCAGCTTACTCAGG - Intronic
1057421499 9:94916577-94916599 CCTGTAGTCCCAAGCTACTCGGG + Intronic
1057616465 9:96595024-96595046 CCTGTAGTCCCAGCTTACTCAGG + Intronic
1057634045 9:96746664-96746686 CCTGTAGTCCCAAGCTACTCAGG + Intergenic
1057651177 9:96920788-96920810 CCTGTAATCCCAGCTTACTCAGG + Intronic
1057655246 9:96946180-96946202 CCTGTAGTCCCAGCTACCTGTGG - Exonic
1058380715 9:104374386-104374408 CCTGTAGTCCCAGCTTACTGGGG - Intergenic
1058559574 9:106211836-106211858 CCTGTAATCCCAGCTTACTCGGG - Intergenic
1058835116 9:108853767-108853789 CCTGTAATCCCAGCTTCCCCAGG - Intergenic
1059153777 9:111972130-111972152 CCTGTAGTCCCAAGCTACTCAGG + Intergenic
1059380192 9:113917368-113917390 CCTGTAGTCCCTCCCTACACGGG - Intronic
1059940949 9:119359317-119359339 CCTGTAGTCCTGGCTACTTCGGG - Intronic
1060165743 9:121413060-121413082 CCTGTAGTCCCAGCTACTTCAGG - Intergenic
1060181819 9:121539548-121539570 CCTGTAATCCTGGCCAACTCAGG + Intergenic
1060356613 9:122914250-122914272 CCTGAAGTCCCAGCTTACTCGGG - Intergenic
1060604471 9:124901557-124901579 CCTGTAGTCCCTAGCTACTCAGG - Intronic
1060605451 9:124910052-124910074 CCTGTAGTCCCAAGCTACTCCGG - Intronic
1060608238 9:124937326-124937348 CCTGTAGTCCCAAGCTACTCAGG + Intronic
1060613734 9:124992038-124992060 CCTGTAGTCCCAGCTACTTCAGG - Intronic
1060631475 9:125162952-125162974 CCTGTAGTCCCAGCTACCTCAGG + Intronic
1060636314 9:125202088-125202110 CCTGTAGTCCCAGCTTACTCTGG + Intronic
1060914238 9:127376081-127376103 CCTGTAATCCCAGCCTACTTGGG - Intronic
1061343614 9:130003797-130003819 CCTGTAGTCCCCAGCTACTCGGG + Intronic
1061579323 9:131527201-131527223 CCTGTAGTCTCTGGCTACTCAGG + Intronic
1061585377 9:131564021-131564043 CCTGTAGTCCCAGCTTACTCTGG - Intergenic
1062154243 9:135037571-135037593 GCTGTTGTCCTGGCCTCCTAGGG - Intergenic
1062604583 9:137340649-137340671 CCTGTGGTCCTGGCCACCTGGGG - Intronic
1062620478 9:137418221-137418243 CCTGTAGTCCCAGCTAACTCAGG + Intronic
1062669630 9:137700256-137700278 CCTGTAGTGCCCACCTCCCCGGG + Intronic
1062726941 9:138079617-138079639 CCTGTAATCCCAGCCACCTGGGG + Intronic
1185619158 X:1442822-1442844 CCTCTAGGCCAGGCCTCCCCAGG - Intronic
1185832616 X:3316542-3316564 CCTGTAGTCCCAGCTACTTCAGG + Intronic
1185961593 X:4550774-4550796 CCTGTAGTCCCAGCTTACTCAGG - Intergenic
1185980168 X:4770675-4770697 CCTGTAGTCCCAGCTACCTGGGG - Intergenic
1186102151 X:6168595-6168617 CCTGTAGTCCCAGCTTCTTGTGG - Intronic
1186306289 X:8262735-8262757 CCTGTAGTCCCAGGCTACTCGGG + Intergenic
1187148547 X:16660290-16660312 ACTGTAGCCTCGACCTCCTCAGG + Intronic
1187433436 X:19245305-19245327 CCTGTATTGCCAGCCTGCTCGGG + Intergenic
1187482339 X:19669085-19669107 CCTGTAGTCCCCAGCTACTCGGG - Intronic
1188088115 X:25928135-25928157 CCTGTAATCCCAGCTACCTCGGG - Intergenic
1188271369 X:28145688-28145710 CCTGTAGTCCTAGCCCCCTCAGG - Intergenic
1188540284 X:31242130-31242152 CCTGTAGTCCCAGCTGCCTGGGG + Intronic
1189059451 X:37737655-37737677 CCTGTAGTCCCAGCTTCTTAGGG - Intronic
1189158752 X:38788277-38788299 CCTGTAGTCCCAGCTTACTAGGG + Intergenic
1189520901 X:41766761-41766783 CCTGTAGTCCCAGCTACCTGGGG + Intronic
1189761476 X:44326015-44326037 CCTGTAGTCCCAAGCTACTCAGG - Intronic
1189829270 X:44953931-44953953 CCTGTAGTCCCAGCCACTTGAGG + Intronic
1189968054 X:46394242-46394264 CCTGTAATCCCAGCTACCTCGGG + Intergenic
1190084934 X:47387245-47387267 CCTGTAATCCCAGGCTACTCGGG - Intronic
1190334489 X:49253994-49254016 CCTGTCGTCCCAGCCTGGTCTGG - Exonic
1190535040 X:51417506-51417528 GCTGTAGTTCAGGCCTGCTCAGG + Intergenic
1190833185 X:54077556-54077578 CATGTAGTCCCAGCTTACTCAGG + Intronic
1190890569 X:54563660-54563682 CCTGTAGTCCCAGCTACCTATGG + Intergenic
1190914756 X:54803127-54803149 CCTGTAGTCCCAGCTACTTCTGG + Intergenic
1192319498 X:70078217-70078239 CCTGTAATCCCTCCCTACTCAGG - Intergenic
1192439721 X:71165647-71165669 CCTGTAGTCCCCAGCTACTCTGG - Intronic
1192500970 X:71651932-71651954 CCTGTAGTCCCAGCCACTTGTGG - Intergenic
1193123524 X:77847733-77847755 CCTGTAATCCCAGCTTACTCAGG - Intronic
1193141739 X:78034864-78034886 CCTGTAATCCCAGCTTCCTGGGG - Intronic
1193146593 X:78082948-78082970 CCTGTAATCCCAGCTTACTCAGG - Intronic
1193292853 X:79796936-79796958 ACTGTAGTTCAGGCCTACTCAGG - Intergenic
1193641942 X:84020312-84020334 CCTGTAATCCCAGCCTACTTGGG - Intergenic
1195064547 X:101228783-101228805 CCTGTAGTCCCAGCTACCTGGGG + Intronic
1195257241 X:103102570-103102592 CCTGTAATCCCAGCAACCTCAGG + Intergenic
1196203414 X:112911754-112911776 CCTTTAGTCCTGGATTCCTCAGG - Intergenic
1196677742 X:118438554-118438576 CCTGTAGTCCCAGCTACCTGGGG - Intronic
1197733571 X:129832839-129832861 CCTGTAATCCCAGCTTACTCGGG + Intronic
1198056904 X:133004547-133004569 CCTGTAATCCCAGGCTACTCGGG + Intergenic
1199743167 X:150754899-150754921 CCTGTAGTCCCCAGCTACTCGGG + Intronic
1200415218 Y:2902958-2902980 GCTGTAGTTCAGGCCTACTCAGG - Intronic
1200690757 Y:6305211-6305233 CCTGCAGTCCCAGCCTCCTGGGG + Intergenic
1200714286 Y:6520303-6520325 CCTGCAGTCCCAGCCTCCCGGGG - Intergenic
1200813444 Y:7507343-7507365 CCTGTAGTCCCAGCTACCTGGGG - Intergenic
1201019536 Y:9640854-9640876 CCTGCAGTCCCAGCCTCCCGGGG + Intergenic
1201044515 Y:9869505-9869527 CCTGCAGTCCCAGCCTCCTGGGG - Intergenic
1201336258 Y:12883701-12883723 ACTGCAGCCCCAGCCTCCTCCGG + Intergenic
1201494913 Y:14582635-14582657 CCTGTAGTCCCAGCTTCTTGAGG + Intronic
1201992024 Y:20037461-20037483 CCTGTAGTCCCAGCCAACTCGGG + Intergenic