ID: 1103595457

View in Genome Browser
Species Human (GRCh38)
Location 12:122022286-122022308
Sequence CCCGGGGCCCGCGGCGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1249
Summary {0: 1, 1: 0, 2: 12, 3: 156, 4: 1080}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103595457_1103595477 20 Left 1103595457 12:122022286-122022308 CCAGCCCCGCCGCGGGCCCCGGG 0: 1
1: 0
2: 12
3: 156
4: 1080
Right 1103595477 12:122022329-122022351 CGGGCGGGCGGCGCGCGAGCCGG 0: 1
1: 1
2: 7
3: 59
4: 461
1103595457_1103595473 1 Left 1103595457 12:122022286-122022308 CCAGCCCCGCCGCGGGCCCCGGG 0: 1
1: 0
2: 12
3: 156
4: 1080
Right 1103595473 12:122022310-122022332 CTTGGCGAGGGCGGGCGGACGGG 0: 1
1: 0
2: 1
3: 12
4: 131
1103595457_1103595474 4 Left 1103595457 12:122022286-122022308 CCAGCCCCGCCGCGGGCCCCGGG 0: 1
1: 0
2: 12
3: 156
4: 1080
Right 1103595474 12:122022313-122022335 GGCGAGGGCGGGCGGACGGGCGG 0: 1
1: 1
2: 8
3: 128
4: 849
1103595457_1103595468 -7 Left 1103595457 12:122022286-122022308 CCAGCCCCGCCGCGGGCCCCGGG 0: 1
1: 0
2: 12
3: 156
4: 1080
Right 1103595468 12:122022302-122022324 CCCCGGGACTTGGCGAGGGCGGG 0: 1
1: 0
2: 0
3: 9
4: 185
1103595457_1103595472 0 Left 1103595457 12:122022286-122022308 CCAGCCCCGCCGCGGGCCCCGGG 0: 1
1: 0
2: 12
3: 156
4: 1080
Right 1103595472 12:122022309-122022331 ACTTGGCGAGGGCGGGCGGACGG 0: 1
1: 0
2: 1
3: 12
4: 156
1103595457_1103595478 21 Left 1103595457 12:122022286-122022308 CCAGCCCCGCCGCGGGCCCCGGG 0: 1
1: 0
2: 12
3: 156
4: 1080
Right 1103595478 12:122022330-122022352 GGGCGGGCGGCGCGCGAGCCGGG 0: 1
1: 0
2: 10
3: 60
4: 495
1103595457_1103595476 8 Left 1103595457 12:122022286-122022308 CCAGCCCCGCCGCGGGCCCCGGG 0: 1
1: 0
2: 12
3: 156
4: 1080
Right 1103595476 12:122022317-122022339 AGGGCGGGCGGACGGGCGGGCGG 0: 1
1: 3
2: 57
3: 553
4: 5068
1103595457_1103595466 -8 Left 1103595457 12:122022286-122022308 CCAGCCCCGCCGCGGGCCCCGGG 0: 1
1: 0
2: 12
3: 156
4: 1080
Right 1103595466 12:122022301-122022323 GCCCCGGGACTTGGCGAGGGCGG 0: 1
1: 0
2: 1
3: 16
4: 183
1103595457_1103595471 -4 Left 1103595457 12:122022286-122022308 CCAGCCCCGCCGCGGGCCCCGGG 0: 1
1: 0
2: 12
3: 156
4: 1080
Right 1103595471 12:122022305-122022327 CGGGACTTGGCGAGGGCGGGCGG 0: 1
1: 0
2: 0
3: 22
4: 269
1103595457_1103595475 5 Left 1103595457 12:122022286-122022308 CCAGCCCCGCCGCGGGCCCCGGG 0: 1
1: 0
2: 12
3: 156
4: 1080
Right 1103595475 12:122022314-122022336 GCGAGGGCGGGCGGACGGGCGGG 0: 1
1: 1
2: 17
3: 106
4: 682

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103595457 Original CRISPR CCCGGGGCCCGCGGCGGGGC TGG (reversed) Intronic