ID: 1103595900

View in Genome Browser
Species Human (GRCh38)
Location 12:122024029-122024051
Sequence TGCTCTGCAGGGAGGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 556
Summary {0: 1, 1: 0, 2: 6, 3: 62, 4: 487}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103595893_1103595900 -6 Left 1103595893 12:122024012-122024034 CCCGCAGAGCGGCCAGCTGCTCT 0: 1
1: 0
2: 2
3: 19
4: 233
Right 1103595900 12:122024029-122024051 TGCTCTGCAGGGAGGGCAGATGG 0: 1
1: 0
2: 6
3: 62
4: 487
1103595889_1103595900 14 Left 1103595889 12:122023992-122024014 CCTGCACCCTGACAGCTGCTCCC 0: 1
1: 0
2: 4
3: 45
4: 421
Right 1103595900 12:122024029-122024051 TGCTCTGCAGGGAGGGCAGATGG 0: 1
1: 0
2: 6
3: 62
4: 487
1103595894_1103595900 -7 Left 1103595894 12:122024013-122024035 CCGCAGAGCGGCCAGCTGCTCTG 0: 1
1: 0
2: 0
3: 27
4: 262
Right 1103595900 12:122024029-122024051 TGCTCTGCAGGGAGGGCAGATGG 0: 1
1: 0
2: 6
3: 62
4: 487
1103595891_1103595900 7 Left 1103595891 12:122023999-122024021 CCTGACAGCTGCTCCCGCAGAGC 0: 1
1: 0
2: 1
3: 18
4: 240
Right 1103595900 12:122024029-122024051 TGCTCTGCAGGGAGGGCAGATGG 0: 1
1: 0
2: 6
3: 62
4: 487
1103595890_1103595900 8 Left 1103595890 12:122023998-122024020 CCCTGACAGCTGCTCCCGCAGAG 0: 1
1: 0
2: 1
3: 6
4: 203
Right 1103595900 12:122024029-122024051 TGCTCTGCAGGGAGGGCAGATGG 0: 1
1: 0
2: 6
3: 62
4: 487

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103595900 Original CRISPR TGCTCTGCAGGGAGGGCAGA TGG Intronic
900093144 1:929240-929262 TGCTCTGCAGGGACCACAGCGGG + Intronic
900401578 1:2474954-2474976 TGAGCTGCAGGGAGAGGAGAGGG - Intronic
900745332 1:4356858-4356880 GGATCTCCAGGGAGGCCAGAGGG - Intergenic
900803902 1:4755049-4755071 TGGGCTGCAGGGAGGGCACATGG - Intronic
900970558 1:5990335-5990357 TGCCCTGGAGGAAGTGCAGAGGG + Intronic
901091495 1:6644671-6644693 TGCTCTGCAGGGAGAGAACGCGG + Exonic
901236667 1:7670901-7670923 TTCTCTGCAGGGAGGAGTGAAGG + Exonic
902804141 1:18850424-18850446 TGCTAGGCAGGGAAGGGAGAAGG - Intronic
902816288 1:18918499-18918521 TGGGCTGCAGGGAGGACAGCAGG + Exonic
903125643 1:21245572-21245594 TGCCCTGCAGGTGGGGCAGTAGG - Intronic
903232745 1:21931745-21931767 GGCTCAGGAGGGAGGGCAGGAGG - Intronic
904324668 1:29720515-29720537 TGTCCTGCAGGGAGGGCAGAGGG + Intergenic
904432698 1:30475264-30475286 TGCTCTGCCCGCTGGGCAGATGG + Intergenic
904434302 1:30484313-30484335 TGTCCTGTAGGAAGGGCAGAGGG - Intergenic
904581089 1:31544801-31544823 TGCAGTGCAGGGAGGGCAGTGGG + Intergenic
905228452 1:36495085-36495107 AGCTCTGCTGGGCGGGGAGATGG - Intergenic
905731661 1:40302806-40302828 TGCTCTGGAGGGAGGGAGGGAGG + Exonic
905811305 1:40915407-40915429 TGGTTTGGAGGGAGGGCTGATGG - Intergenic
906188142 1:43877382-43877404 TTCTCTGCAGGGAAGTGAGAAGG - Intronic
906211332 1:44013839-44013861 TGCTCAGGAGGGAAGTCAGAGGG - Intronic
906725243 1:48039807-48039829 GGCTCTGCAGGGAGGAAACAGGG + Intergenic
907260833 1:53217348-53217370 TGCCATGCAGTAAGGGCAGAGGG + Intronic
907443119 1:54490520-54490542 AGCCCTGCAGGGAGGGAGGAAGG - Intergenic
907617384 1:55938581-55938603 AGCTCTGCTGGGAGGGAGGATGG + Intergenic
908089214 1:60668919-60668941 TGCTTGGCAGGGAAGGCAGATGG - Intergenic
908827711 1:68149446-68149468 TGCTCTCCTGGAAGGGCAGCAGG + Intronic
909363314 1:74790544-74790566 TGATCTGAAGGTAGGGCACAAGG + Intergenic
911721079 1:101191867-101191889 TTCACTGCAGGAAAGGCAGAGGG + Intergenic
912863387 1:113235176-113235198 TGCTCTGCAGAGAGGGCTCCGGG - Intergenic
913569137 1:120102804-120102826 AGCAATGCAGGGAGGGAAGAGGG + Intergenic
914289946 1:146263795-146263817 AGCAATGCAGGGAGGGAAGAGGG + Intergenic
914550989 1:148714578-148714600 AGCAATGCAGGGAGGGAAGAGGG + Intergenic
914914914 1:151813617-151813639 TGGACTGCAGGGAGGGAGGAGGG + Exonic
918085454 1:181241042-181241064 TGCTGTGAGGGGAGAGCAGAGGG + Intergenic
918602055 1:186375525-186375547 AGCTCTTCAGGGAGGGCCAAGGG - Intronic
919420180 1:197360327-197360349 TCTTCTGCGGGGAGGGCAAAAGG + Intronic
919928725 1:202207533-202207555 TGCTTGAAAGGGAGGGCAGAGGG + Intronic
920674616 1:208030448-208030470 TGCTGTCCAGGGAATGCAGATGG + Intronic
920694852 1:208174432-208174454 GGCTGTGGAGGGAGGGAAGAAGG + Intronic
920746690 1:208635669-208635691 TCATCAGCAGGGAAGGCAGATGG - Intergenic
921017773 1:211207942-211207964 TACAATGGAGGGAGGGCAGAGGG - Intergenic
922003602 1:221505054-221505076 TTCTCTGCATGGATGGCAGCGGG - Intergenic
922228447 1:223665654-223665676 GGCTCTGTAGGGTGGACAGAAGG + Exonic
922553197 1:226512471-226512493 TGCTGTGCTGGGAGGGCACTGGG + Intergenic
922918444 1:229278291-229278313 TGCACAGCAGGCAAGGCAGATGG - Intronic
924274075 1:242367438-242367460 TGCTCAACAGAGAGGGCAGAAGG - Intronic
924416332 1:243860301-243860323 TGCTCTGGAGGGAAGGCAGTGGG - Intergenic
924587316 1:245371402-245371424 TGCTCTGTGGGGAGGGAAGTGGG - Intronic
924834669 1:247636510-247636532 TGATCTGCAGGGAGGGGACAAGG - Intergenic
1063247017 10:4231683-4231705 GGCTCTCCAGGGGTGGCAGAAGG + Intergenic
1064292721 10:14050634-14050656 TGACCTCCAGGGAGGGCAGGGGG + Intronic
1064570852 10:16691604-16691626 TGCTCTGCTGGGAGGTCACAAGG - Intronic
1065395653 10:25234257-25234279 TGATCAGGAGGGAAGGCAGAGGG - Intronic
1065852763 10:29804666-29804688 TGCTCTGCTGAGAGGGAGGATGG - Intergenic
1065925828 10:30433584-30433606 AGCACTGCTGGGAGGGCACACGG + Intergenic
1066551637 10:36564967-36564989 TGCTCTGCCGTAAGTGCAGATGG - Intergenic
1067084748 10:43231819-43231841 TGTCCTGCAGGGAGGGCTGGTGG + Intronic
1067160486 10:43821213-43821235 TGCTGTGGAGGGAGGGGACAGGG - Intergenic
1067288405 10:44924109-44924131 GGCTCTGCAGCGTGAGCAGAAGG - Intronic
1067564563 10:47327247-47327269 TGCTCTGGCTGGAGGTCAGAGGG - Intergenic
1068931624 10:62596220-62596242 CCATCTGCATGGAGGGCAGAAGG - Intronic
1069859846 10:71463557-71463579 TGCTCAGCAGGGATCGCTGAAGG + Intronic
1070457727 10:76633692-76633714 TTCTCTGCAGGGAGGGCTCAGGG + Intergenic
1071515580 10:86294581-86294603 AGCACTGGAGGGAGGGCAGATGG + Intronic
1072268209 10:93750999-93751021 TGGTCTGCAGGGAAGGAAGCAGG - Intergenic
1072285585 10:93911243-93911265 TCCTCTGCAGGGATGTCAGGTGG + Intronic
1073185334 10:101612307-101612329 TGCTGGGCAGGGAGGACAGGTGG - Intronic
1074050552 10:109877546-109877568 TTCTCTGCAGGGTAGTCAGATGG - Intronic
1074059191 10:109949474-109949496 TGCTCTATGGGGAGGGAAGAAGG - Intronic
1074157572 10:110812083-110812105 TCCTCTGCACGGAAGCCAGAAGG + Intronic
1074339505 10:112613480-112613502 AGCTCTACAGAGAGGGGAGAAGG - Intronic
1074709945 10:116169018-116169040 TTCTCTGCAGCAAGGGCAGTGGG + Intronic
1074881945 10:117666472-117666494 TTCTGTGCAGGGACAGCAGAGGG + Intergenic
1075641388 10:124066975-124066997 CGCTCTGCAGCTGGGGCAGAGGG + Intronic
1075920347 10:126206757-126206779 TTCTCTGCAGGCAGGGAGGAAGG + Intronic
1076474767 10:130744245-130744267 TTGTCTGCAGGGACGGCAGGGGG - Intergenic
1076474786 10:130744316-130744338 TCATCTGCAGGGAGGGCAGAGGG - Intergenic
1076572295 10:131440807-131440829 CGGTCAGCAGGGAGGGAAGAGGG + Intergenic
1076632436 10:131859076-131859098 CCCTCTGCAGGCAGGGCAAAGGG + Intergenic
1077393494 11:2310320-2310342 TGCTCTCCAGGAAGGGAAGGGGG + Intronic
1077402520 11:2366245-2366267 TGCCCTCCAGGCACGGCAGACGG + Intergenic
1077986501 11:7356499-7356521 AGCCCTCCAGGGAGGGAAGAAGG + Intronic
1078052131 11:7974957-7974979 AGCTTTGCAGGGAGGGAAGAAGG + Intronic
1078067999 11:8090364-8090386 AGCTGAGTAGGGAGGGCAGAGGG + Intronic
1080001750 11:27358646-27358668 TGCACTACAGTGGGGGCAGATGG - Intronic
1080553590 11:33395868-33395890 TACTCAGCACAGAGGGCAGAAGG + Intergenic
1080651349 11:34225185-34225207 TGGCCGTCAGGGAGGGCAGAGGG + Intronic
1081565770 11:44260164-44260186 TGCACTGCAGGGAAGCTAGAAGG - Intergenic
1081679882 11:44994711-44994733 TGTTCTGAAGGGGAGGCAGATGG + Intergenic
1083184542 11:61009553-61009575 TGCTCTGCAGGGAAGGGGCAGGG - Exonic
1083225993 11:61285184-61285206 TATTCTCCAGGGAGAGCAGAGGG + Intronic
1083803159 11:65058247-65058269 TTCTCTGCAGGGTGGGCAGAGGG + Exonic
1083945724 11:65921481-65921503 TGCTCTGGGGGGAGGAGAGAAGG + Exonic
1084091678 11:66882916-66882938 TTCTGGGCAGGGGGGGCAGAAGG + Intronic
1084122686 11:67078432-67078454 TTGTCTGCTGGGAAGGCAGAGGG + Intergenic
1084185311 11:67468215-67468237 CGTTCTGCGGGGAGGGCAGAGGG - Intronic
1084737099 11:71112580-71112602 TGCTCTGCAGGGAGTGCAATTGG + Intronic
1084875905 11:72133142-72133164 TGCAATGGAGGGAGGGCAGAGGG + Intronic
1084922072 11:72479335-72479357 TGCTATGCAGAAAGGCCAGAAGG + Intergenic
1087603213 11:100342219-100342241 TCTTTTGCAGGGAGTGCAGATGG + Intronic
1088823100 11:113473513-113473535 GGCTGTGCAGGGAAGGTAGAAGG + Intronic
1089530025 11:119121655-119121677 TGCTCTGCAGGGGCTGCAGGAGG + Intronic
1089672176 11:120064145-120064167 TGCTTTGCAGGGACTTCAGAGGG - Intergenic
1090191895 11:124777075-124777097 ATCCCTGCAAGGAGGGCAGAGGG - Intronic
1090805021 11:130197545-130197567 TGCCCTGCAGAGAGGCCAGCTGG - Intronic
1091666524 12:2422687-2422709 TACCCTGCAGGGAGGGTAAAGGG + Intronic
1091926363 12:4353834-4353856 TGCTCTGCGGGCAGGGAAGGCGG + Exonic
1092030409 12:5278882-5278904 TGCTCTGCTGGGGGAGCAAAAGG - Intergenic
1093492295 12:19719061-19719083 TGCTGTGCAGGGAAGGGACATGG + Intronic
1093516105 12:19988768-19988790 TGCTCTGCAGGCAGAGCCCACGG + Intergenic
1093652138 12:21657832-21657854 GGCTCTGCAAGGAGGGAGGAGGG + Intronic
1095254757 12:40021916-40021938 TATTCTGCAGAGAGGTCAGAGGG - Intronic
1095883829 12:47167793-47167815 TGTTCTCCATGGAGGGAAGATGG + Intronic
1096230461 12:49894003-49894025 GGGTCTGGAGGAAGGGCAGAGGG + Intronic
1096523766 12:52198716-52198738 TGCCTTGCAGGGAGGGCCGAGGG + Intergenic
1096563115 12:52451407-52451429 AGCTCTGCAGAGAGTGCAGGTGG - Intronic
1096565267 12:52473067-52473089 AGCTCTGCAGAGAGTGCAGGTGG - Intronic
1096567289 12:52492518-52492540 AGCTCTGCAGAGAGTGCAGATGG - Intronic
1096692008 12:53327133-53327155 TGCTCTGCAGTCAAGGGAGATGG + Exonic
1096812442 12:54180085-54180107 TGATCCCCAGGGAGGGGAGAGGG - Intronic
1097029457 12:56080671-56080693 GGCCCTGCAGGGAGGGGAGCAGG + Intronic
1099918155 12:88922119-88922141 AGCACTGCAGGGATGGAAGAGGG + Intergenic
1100455291 12:94745743-94745765 TGACCCGCAGGGAGGGCAGAAGG + Intergenic
1101854404 12:108430099-108430121 CGCCCTGGAGGGAGGGCTGAAGG + Intergenic
1101922264 12:108942578-108942600 TGCTCTGCAGGGAGGGAGCCAGG - Intronic
1102349719 12:112183619-112183641 GGCTCTGCAAGGAGGGTTGAAGG - Intronic
1103084681 12:118053251-118053273 TGGCCTGCAGGGAGGGGACAAGG - Intronic
1103195671 12:119041804-119041826 TGCTCTGGATGGTGGTCAGAGGG + Intronic
1103232262 12:119341334-119341356 TGCTCTGCAGGGGGAGGGGAGGG + Intronic
1103576054 12:121878012-121878034 GGCTCTGCGGGGAGGGAGGAAGG + Intergenic
1103595900 12:122024029-122024051 TGCTCTGCAGGGAGGGCAGATGG + Intronic
1103723054 12:122984835-122984857 TGCTGGGGAGAGAGGGCAGACGG + Exonic
1103898742 12:124292272-124292294 AGCGCTGTAGGAAGGGCAGAGGG - Intronic
1103948377 12:124539387-124539409 TGCTGTGCGGGGAGGGCCCACGG - Intronic
1104400113 12:128468241-128468263 GGGTGTGCAGGGAGGGCAGGGGG + Intronic
1104810349 12:131616803-131616825 TTCTCTGGAGGGAAGGCAGAAGG - Intergenic
1104964732 12:132503741-132503763 TGCTCTGCAGGGAGAGCTGTGGG + Intronic
1104964752 12:132503902-132503924 TGCTCTCCAGTGGGGGCAGGAGG - Intronic
1105005979 12:132720847-132720869 GCCTGTGCAGGGAGGACAGAGGG - Exonic
1105304895 13:19161479-19161501 TGCTCCCCAGAGAGGGAAGAGGG + Intergenic
1105410803 13:20169632-20169654 TGTCCTACAGGGAGGACAGACGG + Intergenic
1105783329 13:23723334-23723356 TGCTATGCATGGATGGTAGAAGG - Intergenic
1106308663 13:28534566-28534588 GCCACTGCAGGGAGGGCACAGGG + Intergenic
1106592441 13:31109488-31109510 TGCTGTGCATGGAAGGGAGAGGG - Intergenic
1106697778 13:32195839-32195861 TATTCTGAAGGAAGGGCAGAGGG + Intronic
1111065871 13:83090288-83090310 TGTTCTGCAGGCTGTGCAGAGGG - Intergenic
1112251824 13:97788374-97788396 TTCTCTGCAGGGAGGGGTCAGGG + Intergenic
1113096334 13:106667612-106667634 CGCTCTTCACGGTGGGCAGATGG + Intergenic
1113292187 13:108919266-108919288 TGCTGTGCAGTGAGGGAAGGTGG - Intronic
1113574056 13:111382115-111382137 TGCTCTGTAGAGATGGTAGAGGG + Intergenic
1113766070 13:112881857-112881879 GGCTCTGCAGAGAGGCAAGAGGG - Exonic
1113876430 13:113597579-113597601 TGCCCTGTAGGGAGGGCAGCTGG - Intronic
1113919189 13:113897250-113897272 TGCTTTGCAGAGAGGTGAGAAGG + Intergenic
1113942467 13:114025432-114025454 TGCCCTGCAGAGAGGGCATGAGG - Intronic
1114423121 14:22601221-22601243 TGCCCTGCCAGTAGGGCAGATGG + Intronic
1114550722 14:23531431-23531453 AGCTGGGCAGGGAGGGCAGCAGG - Intronic
1114673687 14:24428084-24428106 GGCTCTCCCGGGAGGGCTGAGGG + Intronic
1115528602 14:34305450-34305472 TGACCTACAGGGATGGCAGAAGG + Intronic
1116111447 14:40590555-40590577 TGATCTCCAGGGAGGGAAGAAGG + Intergenic
1118158854 14:63268912-63268934 TGGGCTGCAGTGATGGCAGATGG - Intronic
1118263454 14:64270336-64270358 ACCTCTGCAGGGAGGGAAGTAGG + Intronic
1118839792 14:69501713-69501735 TCCTGGGGAGGGAGGGCAGATGG - Exonic
1119420967 14:74507945-74507967 GGCTCTGGGGGGAGGGCACAGGG - Intronic
1119487840 14:75003290-75003312 TGATCCGCAGAGAGGGCAGGAGG + Exonic
1119678389 14:76573444-76573466 AGACCTGTAGGGAGGGCAGAGGG + Intergenic
1119706331 14:76784899-76784921 TGCTCAGGAGGGAGAGGAGAGGG + Intergenic
1119727164 14:76928510-76928532 TGCTCTGCAGGGCAAGCAAAAGG + Intergenic
1121335818 14:93076965-93076987 AGCTCGGCAGGGACGGCAGGTGG - Intronic
1121486889 14:94323214-94323236 TGCTCTGGAGGCTGGGCAGGGGG + Intronic
1121732125 14:96194307-96194329 TGCTGCATAGGGAGGGCAGAAGG + Intergenic
1122091121 14:99341264-99341286 TTCTCTGCAGAGAGGTCAGCAGG + Intergenic
1122124655 14:99572431-99572453 TGCTCCACAGGGAAGCCAGAGGG + Intronic
1122451666 14:101813562-101813584 TGCGCTGCAGGGTGGGAAGTGGG - Intronic
1122974439 14:105165313-105165335 TGCTCTGTAGGCATGGCAGGTGG - Intronic
1124491729 15:30162104-30162126 TCCACTGCAGGGTGGGCAGGAGG + Intergenic
1124533079 15:30523073-30523095 CACTCTGCAGGAAGGGCAGGAGG - Intergenic
1124751807 15:32376205-32376227 TCCACTGCAGGGTGGGCAGGAGG - Intergenic
1124765577 15:32484571-32484593 CACTCTGCAGGAAGGGCAGGAGG + Intergenic
1124995121 15:34716339-34716361 TGGTCATCAGGGAGGGCTGAAGG - Intergenic
1125035662 15:35121356-35121378 TACAATGGAGGGAGGGCAGAGGG + Intergenic
1127775753 15:62263274-62263296 TGCTCTGAAGGGAGGGATGGTGG - Intergenic
1128729235 15:70009574-70009596 TGTTCAGGAGGGAGGGCAGTGGG - Intergenic
1128731792 15:70026310-70026332 TGCTGTGTAGGGAAAGCAGAAGG + Intergenic
1129297721 15:74609038-74609060 GCATCTGCAGGGAGAGCAGATGG - Intronic
1130273146 15:82462827-82462849 TGCTCCACGGGGAGGCCAGAGGG - Intergenic
1130465498 15:84190198-84190220 TGCTCCACGGGGAGGCCAGAGGG - Intergenic
1130498767 15:84483338-84483360 TGCTCCACGGGGAGGCCAGAGGG + Intergenic
1130908180 15:88254359-88254381 GGGTCAGCAGGGAGGGCAGGAGG - Intronic
1130955706 15:88626063-88626085 TGCACTGCAGGGAGGGAGGGAGG + Intronic
1131654747 15:94444417-94444439 TGACCTGCAGGGAAGGAAGAGGG - Intronic
1131957166 15:97748756-97748778 GGCTGTGCAGGGAGGGGAGGTGG - Intergenic
1132702748 16:1229060-1229082 CGCTCTGCAGGTGGGGAAGAGGG + Exonic
1132705578 16:1241808-1241830 CGCTCTGCAGGTGGGGAAGAGGG - Exonic
1133126035 16:3646572-3646594 AGCTCTGCAGGCAGAGCGGAAGG + Intronic
1133150312 16:3823502-3823524 CTCTCTGCAGGGAGGGCGGGAGG + Intronic
1133183900 16:4081392-4081414 TGTTCTGCAGGAATGACAGAGGG - Intronic
1133223782 16:4330531-4330553 GCCTCTGCAGGGAGGGCGGTGGG + Intronic
1133294848 16:4746670-4746692 GTCCCTGCAGGGAGGGAAGAGGG + Intronic
1133450898 16:5903294-5903316 TGCACAGCAGGGAGGGCAAGAGG - Intergenic
1134199505 16:12186297-12186319 CGCTCTGCAGGAAGAGCACATGG - Intronic
1134514088 16:14873001-14873023 TACTCTGCAGGGATGACGGATGG - Intronic
1134701730 16:16271500-16271522 TACTCTGCAGGGATGACGGATGG - Intronic
1134970100 16:18523150-18523172 TACTCTGCAGGGATGACGGATGG + Intronic
1136472285 16:30489177-30489199 TGGGCTGCAGGGAGTGCAGTTGG + Intronic
1136497719 16:30654297-30654319 GGGTCTGCAGGCAGAGCAGATGG - Exonic
1136552628 16:30989693-30989715 TCCTCTGCAGGGCGGGCTGGGGG + Exonic
1136587651 16:31197869-31197891 TGCTTTGCGGGGAGGGCAGGGGG - Intergenic
1136615862 16:31397991-31398013 GGCCCTCCAGGGAGGGCACAGGG - Intronic
1137379078 16:47981178-47981200 TGCTCAGCAGAGATGGCTGAAGG - Intergenic
1137458356 16:48635504-48635526 GGCCATGCAGGGAGGGGAGATGG + Intergenic
1137762088 16:50949103-50949125 TGCTCTGCAGGGAAGGGTGGAGG + Intergenic
1137864095 16:51875918-51875940 TGCTATGGAGAGAGGGCAGCAGG + Intergenic
1138412327 16:56850447-56850469 TTCTTTGCAGGGAGTGGAGAAGG - Intergenic
1138656193 16:58492905-58492927 GGCTCTGCAGGGAGGAGGGAAGG - Intronic
1138809298 16:60129867-60129889 TGATCTCCAGGGAGGGGAGAGGG + Intergenic
1139684629 16:68593401-68593423 TTGTCTCCAGAGAGGGCAGAAGG + Intergenic
1140122896 16:72098842-72098864 GCCTCGGCAGGGAGAGCAGATGG + Intronic
1140891369 16:79288084-79288106 GGCATTGGAGGGAGGGCAGAGGG + Intergenic
1141029499 16:80575235-80575257 TGGGCTGCAGGGAGGGCAGGGGG + Intergenic
1141382687 16:83589953-83589975 AAATGTGCAGGGAGGGCAGAGGG + Intronic
1141841043 16:86574305-86574327 TGCTCTACAGGGAAAGCAGAGGG + Intergenic
1142027353 16:87821695-87821717 TGTCCTGCAGCGGGGGCAGAGGG + Intergenic
1142601460 17:1054861-1054883 GGCGCTGCAGGGAGGGGTGAGGG + Intronic
1142990888 17:3730091-3730113 TGTTCTGCAGTGAGAGCACATGG - Intronic
1143496097 17:7313445-7313467 TGCACTGCAGGGAATGCCGAAGG + Exonic
1143522683 17:7454281-7454303 TTCTCTCCTTGGAGGGCAGAGGG - Exonic
1144347088 17:14359270-14359292 TGCTCTGCATGGAGAACAGATGG - Intergenic
1144577355 17:16437416-16437438 TTCTCTGCAGGGCAGCCAGAGGG + Intergenic
1145234662 17:21200114-21200136 AGCTCTGCAGCAAGGCCAGACGG + Intronic
1145279606 17:21457906-21457928 TGCTCAGCAGGAGGGCCAGAGGG + Intergenic
1145398273 17:22512586-22512608 TGCTCAGCAGGAGGGCCAGAGGG - Intergenic
1145964564 17:28907493-28907515 TGCCCTGAGGGGAGGGAAGAGGG - Intronic
1146906844 17:36623538-36623560 TGCTTTGGAGAGAGGGTAGAAGG - Intergenic
1147141916 17:38465013-38465035 GGAGCCGCAGGGAGGGCAGACGG + Intronic
1147371259 17:39994645-39994667 TGCTCTAAAGTGAGGCCAGAAGG - Intronic
1147382797 17:40065629-40065651 GGCTGCGCAGGGGGGGCAGAGGG - Intronic
1147818871 17:43229886-43229908 TCTTATGCAGGGAGGGCAGGTGG + Intergenic
1147832154 17:43304588-43304610 TCTTATGCAGGGAGGGCAGGTGG + Intergenic
1147842974 17:43385670-43385692 TCTTATGCAGGGAGGGCAGGTGG - Intergenic
1147885280 17:43680104-43680126 TGCACTGCATGCAGGCCAGAGGG - Intergenic
1147999036 17:44376947-44376969 GGCTCTGCACGGGGGTCAGACGG + Intronic
1148203354 17:45764392-45764414 TGCTCTGCCTTGAGGGGAGATGG + Intergenic
1148691400 17:49528987-49529009 AGTTCTGCAGGGAAGGCAGGAGG - Intergenic
1149462350 17:56840287-56840309 TGCTCTTGGGGGAGGGGAGAAGG + Intronic
1149527131 17:57365523-57365545 TGTTCTGCAGGCAGGGTAGAGGG + Intronic
1150334446 17:64320380-64320402 TGCCCTGGAGGGATGGCAGCAGG - Exonic
1150686367 17:67324306-67324328 TGCTCTGCAGGATGTCCAGATGG + Intergenic
1151053256 17:71003885-71003907 AGCTCTGCAGGGAGGGCCCAGGG - Intergenic
1151412914 17:73942960-73942982 TGCTCCTCATGGAGGGCAGATGG + Intergenic
1151477557 17:74352603-74352625 TGGTCTCCTGGGAGGGCAGCTGG - Intronic
1151660581 17:75516176-75516198 GGCTGGGCAAGGAGGGCAGAAGG - Intronic
1151671028 17:75571789-75571811 TGCTGGGCAGGGAGAGCAGAGGG + Intronic
1152048007 17:77951241-77951263 GGCTCTGGAGGGAGGACAGGAGG + Intergenic
1152094160 17:78263488-78263510 CCCTCGGCAGGGAGGACAGAGGG + Intergenic
1152349839 17:79778365-79778387 TGCCCTGCGGGGAGAGAAGAGGG - Exonic
1152464203 17:80456599-80456621 TGCTCAGCAGGGAGGGCTGATGG - Intergenic
1152528331 17:80902387-80902409 TGAGCTGCACGGATGGCAGAGGG - Intronic
1152720678 17:81922472-81922494 TGCTTTGCAGGGAAGAGAGAAGG + Exonic
1153827657 18:8891207-8891229 TGATCTCCAGGGAGGGAAGAGGG + Intergenic
1156886478 18:42141284-42141306 TGCTGTGCATGGAGTGGAGAGGG - Intergenic
1157590988 18:48836384-48836406 TGCTCTGCCTGGAGGACAGTGGG + Intronic
1157684051 18:49628837-49628859 TGTTTTGCAGTGAGAGCAGAGGG + Intergenic
1158548401 18:58415002-58415024 AGCTCTGAAGGGAGGGGGGAAGG - Intergenic
1159973768 18:74685441-74685463 TGCTGAGGAGGGAGGACAGAGGG - Intronic
1160054275 18:75464653-75464675 GGCTCTGCTGGGATGGCTGATGG - Intergenic
1160443827 18:78912500-78912522 TGCTCTGCTGGGAGGGCGGTGGG - Intergenic
1160532230 18:79572150-79572172 AGGGCTGCAGGGAGGGCGGACGG + Intergenic
1161021523 19:2013691-2013713 TGGACTGCAGGGCGGGCAGGGGG + Intronic
1161085532 19:2333255-2333277 GGCTCTGCTGGGAGGGGAGCAGG + Intronic
1161430513 19:4229588-4229610 TCCACTGCAGGGCGGGCAGCTGG - Exonic
1161663283 19:5560215-5560237 TGCTCTGAAGGGAGGCGAGCAGG + Intergenic
1161710545 19:5845112-5845134 TGCCCTGGAGGCAGGGGAGAAGG + Intronic
1161731244 19:5962029-5962051 TGCTCGGGAGGGAGTGCAGCAGG - Intronic
1162176932 19:8837570-8837592 TTCTCTGGCTGGAGGGCAGAAGG + Intronic
1162480562 19:10924652-10924674 AGCTTGGCAGTGAGGGCAGAGGG - Intronic
1163146249 19:15380609-15380631 TGAGCTGCGGGCAGGGCAGAAGG + Exonic
1163649774 19:18510471-18510493 GGCTCTGCAGTGAGGGAAGCTGG - Intronic
1163666130 19:18604931-18604953 TTCTCTGCAAGCAGGGCGGAAGG + Intronic
1164591424 19:29509663-29509685 TGCTGTGCAGGGAAGGAAGATGG + Intergenic
1164711688 19:30361517-30361539 TGCTATGGAGGGAGGGCATCCGG + Intronic
1164870736 19:31640680-31640702 GGCTCTGGAGGGAGGGAAGTGGG + Intergenic
1164870741 19:31640701-31640723 GGCTCTGGAAGGAGGGAAGATGG + Intergenic
1165322422 19:35094237-35094259 TGGTCTGCAGGGTGGCCAGCTGG + Intergenic
1165574050 19:36798990-36799012 AGCTCGGCAGGGAGGTCAGAGGG - Intergenic
1165621753 19:37253932-37253954 GGCTCAGCAGGGAGGTCACAGGG - Intergenic
1165633289 19:37319755-37319777 TGTTCAGCAGGGAGGTCAGAGGG - Intronic
1166305779 19:41936221-41936243 TGCTGTCCAGGGAAGGCCGAGGG - Intergenic
1166412023 19:42561724-42561746 CCCTCTGCAGGGAGGGCTGAGGG + Intergenic
1166990444 19:46689695-46689717 GGCTCTGCAGGGTGGGGAGCGGG + Exonic
1167138674 19:47634180-47634202 GGCTCTGCAGGGTGGGCGGGAGG + Intronic
1167397641 19:49241726-49241748 TGCCCTGCAGCCAGGGCACAGGG + Intergenic
1167487933 19:49774072-49774094 TGCTCTTCACAGAGGCCAGAGGG - Intronic
1167986856 19:53325565-53325587 TCCTCTCCAGGGAAGGAAGAAGG - Intergenic
1168219397 19:54949704-54949726 TGGCCTCCAGGGAGGGGAGAGGG + Intronic
1168493638 19:56832549-56832571 TGCTCTGAAGAGAGAGCAGAGGG - Intronic
1168521041 19:57050705-57050727 TGACCTCCAGGGAGGGCAAAAGG - Intergenic
1168568355 19:57443053-57443075 TACCATGCAGGGAGGGCAGGTGG - Intronic
925691684 2:6530734-6530756 TTGTTTGCAGGGAAGGCAGAAGG - Intergenic
926418676 2:12675732-12675754 TCCTCTGCTGGCAGAGCAGAGGG - Intergenic
926743909 2:16135048-16135070 TGCTTTGCAGGCAGGGCAGAGGG + Intergenic
926953904 2:18272384-18272406 GCCACTGCAGGGAGGGCACATGG - Intronic
927189370 2:20506625-20506647 TGCTCTGCAGGGAATGCCAAAGG - Intergenic
927847542 2:26479353-26479375 TTCGCTCCAGGTAGGGCAGATGG + Exonic
927895433 2:26778612-26778634 GGTTCTGCAGGGAGGGGACAGGG - Exonic
928217531 2:29374659-29374681 TGCGCTGCAGGGGGCGCAGATGG + Intronic
928313651 2:30230764-30230786 CGGTCTGCAGCGGGGGCAGAAGG - Intergenic
929410560 2:41694087-41694109 TGATTTGCAGGGCTGGCAGAAGG - Intergenic
929473904 2:42225703-42225725 CTATCTGCAGGGAGGGAAGAAGG - Intronic
931566673 2:63622109-63622131 TACAATGGAGGGAGGGCAGAGGG + Intronic
932787307 2:74618236-74618258 TGCTCTGCAGAGACCTCAGATGG + Intronic
933120182 2:78526605-78526627 AGAACTCCAGGGAGGGCAGAAGG - Intergenic
933814493 2:86054797-86054819 TGCTCTGCAGAGAGCTCAAAGGG + Intronic
933939337 2:87232529-87232551 AGCTCTGAGGGGAGGGCAGAAGG - Intergenic
933942979 2:87260515-87260537 TCCTGTTCAGGGAGGGCTGAGGG + Intergenic
935242342 2:101189659-101189681 TGCCCTCCAGGAAGGGAAGAGGG + Intronic
935372618 2:102363702-102363724 TGCTCTTCAGGGCAGGCAGCTGG - Intronic
936098226 2:109550702-109550724 TTCTAGGCAGGCAGGGCAGAAGG - Intronic
936337234 2:111601047-111601069 TCCTGTTCAGGGAGGGCTGAGGG - Intergenic
936353796 2:111733249-111733271 AGCTCTGAGGGGAGGGCAGAAGG + Intergenic
938702092 2:133888552-133888574 TGAAGTGCATGGAGGGCAGAGGG + Intergenic
938724212 2:134092401-134092423 TGCTATGTGGGGAGGGCAGTGGG - Intergenic
939720627 2:145645988-145646010 TGGTGACCAGGGAGGGCAGAAGG + Intergenic
939907699 2:147937921-147937943 TGCTCTGAAGAGACAGCAGAGGG + Intronic
940256069 2:151730526-151730548 TGCTCTGTAGGGTGAACAGAAGG + Intronic
944655997 2:201877276-201877298 TGCCCTGTAGTGAGGGCTGAGGG - Intronic
946487580 2:220115506-220115528 TGCTCTGCTTGAAGGGCAGAGGG - Intergenic
946943726 2:224797727-224797749 TTCTCAGTAGGGAGGGAAGAAGG - Intronic
947876470 2:233471054-233471076 TGCACTGCAGAGGGGACAGAGGG - Exonic
947888775 2:233597099-233597121 GGGTCTTCAGGCAGGGCAGATGG - Intergenic
948750553 2:240129961-240129983 CGCACTGCAGCGAGGGCAGTCGG - Exonic
948776752 2:240293199-240293221 CAGTCTGCCGGGAGGGCAGAAGG - Intergenic
1169806572 20:9566204-9566226 TGCTCTGCAGGGAGGGGTGATGG + Exonic
1170845788 20:19960857-19960879 GGCTCTGCAGGGAGTGGAAATGG + Intronic
1171044615 20:21798182-21798204 TGCTGTGGAGGGAGAGCAGGTGG + Intergenic
1171944985 20:31368546-31368568 CTCTCTGCAGTGGGGGCAGAGGG - Intergenic
1172506915 20:35469728-35469750 TGGTATTCAGGGAGTGCAGACGG + Intronic
1172591282 20:36119839-36119861 TGCCCTGGATGGAGGGCAGTGGG - Intronic
1172687772 20:36769986-36770008 TGGGGTGCAGGGAGGGAAGAGGG + Intronic
1172763857 20:37340528-37340550 TGGCCTGATGGGAGGGCAGAGGG - Intergenic
1172889935 20:38257028-38257050 GGCTCTGAAGGGTGGGCAGGAGG - Intronic
1173362637 20:42358472-42358494 TGTTCTGAAGGAAGGGAAGATGG + Intronic
1173920133 20:46738098-46738120 TGGTCTGCAGGGAGAGCACTGGG + Intergenic
1174354351 20:49988270-49988292 TTCTGTGGAGGGAGGGCAGCTGG + Exonic
1174368993 20:50073621-50073643 TTCCCTGCATGCAGGGCAGAGGG + Intergenic
1175121187 20:56717404-56717426 TGCTCAGCAGGGTGGGGAGGGGG - Intergenic
1175179148 20:57132696-57132718 GGCTCACCAGGGAGGGCTGAGGG + Intergenic
1175575497 20:60057799-60057821 TCCCCTGTAGGGAGGACAGATGG + Intronic
1175761120 20:61562603-61562625 TGCTCTGCAGGCCTGGCAGCCGG - Intronic
1175764506 20:61583163-61583185 GGCTCTGCGGGGGGGACAGAGGG + Intronic
1175941944 20:62541454-62541476 TGCTCTCCAGGGTGGACAGCAGG - Intergenic
1176062026 20:63176640-63176662 GGCTCTGCTCCGAGGGCAGATGG + Intergenic
1176183614 20:63766006-63766028 TGCTCTCCAGGGTGGGCAGCAGG - Intronic
1177374999 21:20258555-20258577 TCCTGAGCAGGGAGGGCACAAGG + Intergenic
1178347412 21:31842295-31842317 TGCCCAGCAGAGAGGGCAGAAGG - Intergenic
1178854502 21:36239296-36239318 GACTTTGCAGGGAGGTCAGATGG + Intronic
1179162210 21:38907918-38907940 TCCTCTGCAGGGCCGACAGATGG - Intergenic
1179603910 21:42499652-42499674 GGCTCTGCAGGGAGGAGGGAGGG + Intronic
1179615430 21:42580225-42580247 TGCTGGGCCGGGAGGGCAGCTGG + Intronic
1179654465 21:42836857-42836879 TGCTCTTCAGGTAAGGGAGATGG - Intergenic
1180937860 22:19637857-19637879 TGCTCTGCCGGCATGGCTGAGGG - Intergenic
1181855950 22:25781715-25781737 TTGTCTGCAGGGAGAGAAGAGGG - Exonic
1182486802 22:30643946-30643968 TGGGCTGCAGGGAGGGGAGGTGG + Intronic
1183102943 22:35594934-35594956 GACTCTTCAGGCAGGGCAGATGG - Intergenic
1183164639 22:36138695-36138717 TCCTCTACAGGGAGGAGAGAGGG - Intergenic
1183170941 22:36187845-36187867 TCCTCTACAGGGAGGAGAGAGGG - Intergenic
1183348095 22:37318976-37318998 TGGTCTGCAGGCAGGGCCGGCGG + Intergenic
1183392986 22:37556410-37556432 TGCATGGAAGGGAGGGCAGATGG + Intergenic
1183677743 22:39309228-39309250 TGCCCAGGAGGCAGGGCAGAGGG + Intergenic
1183724020 22:39578514-39578536 TGCTCTGCAGAGAGAGCACTGGG + Intronic
1184031931 22:41900347-41900369 GGCTCTGCAGGCATGGAAGATGG - Exonic
1184074672 22:42168700-42168722 TGTTCTGCAAGGGGGGGAGAGGG + Exonic
1184161819 22:42701548-42701570 TGTTCTGCAGTGGAGGCAGAGGG + Intronic
1184392840 22:44214844-44214866 TGCCCAGCAGGAAGAGCAGATGG - Intronic
1184563747 22:45278689-45278711 TGTTCTGCAGGACGGGCAGCTGG + Intergenic
1184737371 22:46407099-46407121 TGCGCTGAAGGGAGGTCAGGAGG + Intronic
1184795781 22:46731639-46731661 TGTCAGGCAGGGAGGGCAGAGGG + Intronic
950219832 3:11186050-11186072 GGCTCTGCAAGGTGGGCAGGAGG - Intronic
950613156 3:14139002-14139024 TGCTCTGCCAGATGGGCAGAAGG + Intronic
951706085 3:25545711-25545733 TGCTGGGCAGGGAGGAGAGAGGG - Intronic
952710627 3:36428727-36428749 TGATCAGCAAGGAGGCCAGAGGG + Intronic
952868819 3:37878984-37879006 AGCTCTGCAGAGAGGGCCTAGGG + Intronic
953196802 3:40742083-40742105 TGGCCTGCAGTGAGGGCAGTGGG + Intergenic
954407803 3:50355242-50355264 TGCTCTGAGGAGAGGGAAGAAGG - Exonic
954462718 3:50636893-50636915 TACTCTGCAGAGAGGCCAGTGGG + Intronic
955263951 3:57423577-57423599 TGCTATGCTGTGAGGGGAGAGGG + Intronic
956462560 3:69485850-69485872 GCCACTGCAGGGAGGGCACAGGG - Intronic
956657438 3:71566220-71566242 TGCTTTGCAGGTTGGGAAGAGGG - Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
959017384 3:101150660-101150682 TCCTCTGCAGGGAGGAGACAGGG + Intergenic
959446768 3:106450050-106450072 TGATCTCCAGGGAGTGCTGAAGG + Intergenic
960943868 3:122952892-122952914 AGTTCTGAAGGGAGGACAGAGGG - Intronic
960963166 3:123086035-123086057 TGCTCTGCAGGGTGTGATGAGGG + Intronic
961035424 3:123638407-123638429 TCCTGTGCAGGGTGGGCAGGGGG + Intronic
961166192 3:124765500-124765522 TGTTCTGCAGGGAGGGTGCAGGG - Intronic
961348464 3:126280937-126280959 TGGTCTGTAGGGATAGCAGATGG - Intergenic
962114053 3:132483158-132483180 TGCTCTGCAGGCTGGCCAGGTGG + Intronic
962272259 3:133986504-133986526 TGCAGGGCAGGGAGGGCAGGAGG + Intronic
962756734 3:138470577-138470599 TGCTCTCCAGGCAGGGCTCAGGG - Intronic
962875609 3:139533961-139533983 GGCTCTGCGGGGGTGGCAGAAGG - Intronic
963124698 3:141804347-141804369 TGCCATGGAGGGAGGGGAGATGG - Intronic
963143940 3:141972663-141972685 TTCTCTGCAAAGAGGGCTGAGGG - Intronic
963526318 3:146418969-146418991 TGCTCTGGAGAGAAGGCAAAGGG - Intronic
965006471 3:163032666-163032688 TGCTGTGGAGGCAGGGCAGCAGG - Intergenic
967975924 3:195034806-195034828 TGCTCTGCATGGAGGGATGCAGG + Intergenic
968579137 4:1381588-1381610 AGATATGCAGGGTGGGCAGATGG - Intronic
968603981 4:1522872-1522894 TGCTAGGGATGGAGGGCAGATGG - Intergenic
968609088 4:1549043-1549065 TGCACTGCAGGCAGCCCAGAGGG + Intergenic
968755329 4:2412913-2412935 GACTCAGCAGGCAGGGCAGACGG - Intronic
969315933 4:6381289-6381311 TGCCCTGCAGCCAGTGCAGAGGG - Intronic
969669170 4:8580334-8580356 AGCTGTGCAGGCGGGGCAGAGGG - Intronic
970705958 4:18802817-18802839 TGCTCTGAATGGAGGAAAGATGG + Intergenic
972357797 4:38297318-38297340 TGATTTTCAGGGAGGGAAGAAGG - Intergenic
972496433 4:39638984-39639006 TGCTCGGCAGGCGGGGCAGCTGG - Exonic
972927091 4:44022928-44022950 TGCTCTGCTTGGTGAGCAGATGG + Intergenic
975733414 4:77359043-77359065 TGCCATGGAGGGAGGGAAGAAGG - Intronic
976998784 4:91468353-91468375 TGGTGTGCAGGGAGGGGAGAGGG + Intronic
977003890 4:91541369-91541391 TGGTGTGCAGGGAGGGGAGAGGG - Intronic
979698992 4:123646148-123646170 TGCTCTCCTGGGAGGGGAAAAGG + Intergenic
979711528 4:123785735-123785757 TGCTCTGCAGGTCAGGCAGCAGG - Intergenic
980537569 4:134148696-134148718 TGCTGTGCAATGAGGGTAGAAGG - Intergenic
980722525 4:136716914-136716936 TGCAGGGAAGGGAGGGCAGAGGG - Intergenic
981113382 4:140960568-140960590 TGCCCTCTAGGGAGGGAAGAGGG + Intronic
983981497 4:174002532-174002554 TACTGAGCAGGGAGGGAAGAGGG - Intergenic
984002266 4:174263860-174263882 TGCTCTGGTGGGAGGTCAGATGG - Intronic
984860364 4:184232316-184232338 TGATCTCCAGGGAGGGGAAAGGG - Intergenic
989033969 5:37150325-37150347 TGCTCCTCAGGGAGAGCACATGG - Intronic
990003799 5:50922802-50922824 TGCACTGCAGGCAGCCCAGAGGG - Intergenic
990286936 5:54310096-54310118 TCCTCTGCGGAGAGCGCAGAGGG + Intronic
992737199 5:79734205-79734227 TGTTCTACAAGGAGGTCAGAAGG - Exonic
992774874 5:80080371-80080393 TGCTCTGCAGAGAAGCCTGAGGG + Intronic
993187248 5:84635889-84635911 GTCTCTGCAGGGAGGGCTCAGGG - Intergenic
995831799 5:116362077-116362099 TGTTCTGGAGGAAGGACAGAGGG + Intronic
995836091 5:116401137-116401159 TGTTTTGCAGTGGGGGCAGAAGG - Intronic
997013738 5:129906027-129906049 TGGTCTTCAGGAAGGGAAGACGG + Intronic
997411676 5:133695766-133695788 TGGTTTGCAGGGAGGGGAGGGGG - Intergenic
997526926 5:134559645-134559667 GTCTCTGCAGGGTGGGCAGATGG + Intronic
997574457 5:134963314-134963336 TGGTGTGCAGGGAGAGAAGAGGG + Intronic
998041950 5:138956182-138956204 TGCCATGCACTGAGGGCAGAGGG + Intronic
998385748 5:141756267-141756289 TGCTGGGGAGGGAGAGCAGAGGG + Intergenic
998415197 5:141941093-141941115 GGCTCCACAGGGAGGGCACACGG - Exonic
999093416 5:148957208-148957230 GGCTGTGCAGGGCTGGCAGAGGG - Intronic
999202541 5:149826516-149826538 AGCTCTGCTGGGTGGGCAGAGGG + Intronic
999253275 5:150195172-150195194 CGCCCTGCACGGTGGGCAGAGGG + Intronic
999410722 5:151347502-151347524 TGCTCTGGAAGGAGGGAAGCAGG + Exonic
1000967581 5:167677033-167677055 TAGTCTGCATGGAGCGCAGAGGG - Intronic
1001026603 5:168229705-168229727 GGCTCTGCAGGGAGGTCACCTGG - Intronic
1001089610 5:168727663-168727685 TTTCATGCAGGGAGGGCAGAGGG - Intronic
1001098417 5:168794386-168794408 GGCTCTGCAGGGAGGACAGTAGG - Intronic
1001288652 5:170441156-170441178 TGCTGGGCTGGGAGGGCAGCTGG - Intronic
1002214950 5:177624537-177624559 TGCTTTGCAGGGGAGGGAGAGGG + Intergenic
1002286619 5:178166550-178166572 TGGTCTGCAGTGAGGGAAGGTGG + Intergenic
1002535919 5:179875285-179875307 AGCTGTGCAGTGAGGGCTGAGGG + Intronic
1002635045 5:180603132-180603154 GGCCCGGCAGGGCGGGCAGAGGG - Exonic
1002759623 6:191546-191568 AGCTCTTCAGGGAGGGCTGGGGG + Intergenic
1003133615 6:3416458-3416480 TTCTCTCCAAGGAGAGCAGATGG - Intronic
1003165178 6:3671274-3671296 TGCTGTACAGTGAGGGCAGAGGG - Intergenic
1003310520 6:4965953-4965975 TGGGCTGCAGGGGTGGCAGAAGG - Intergenic
1004589688 6:17037370-17037392 TGCTCTTCAGGAAGGGGATATGG - Intergenic
1004650231 6:17600838-17600860 AGCTCTGCGGGGAGGGCTGGGGG - Exonic
1005499335 6:26416442-26416464 TGTGGTGCAGGGAGGGCAGAGGG - Intergenic
1007174080 6:39884556-39884578 TGCCTTGCAAGGAAGGCAGAAGG + Intronic
1007203567 6:40131333-40131355 CCCTCTGCAGGAAGGGCAGTGGG - Intergenic
1007712140 6:43831220-43831242 TGCTCTGAAGGGTGGGGACAGGG + Intergenic
1007937390 6:45745162-45745184 TGATCTGCAGGCTGTGCAGATGG + Intergenic
1008231738 6:48991015-48991037 TGCTGGGCAGAGTGGGCAGAAGG + Intergenic
1008281180 6:49598401-49598423 TGATCAGCAGGGAGGGGAGGGGG + Intergenic
1008772280 6:54992849-54992871 TGGTCAGCAGGGAGTGGAGAGGG - Intergenic
1010462927 6:76133792-76133814 GTCTCTGCAGGGATGGCAGATGG + Intergenic
1010675902 6:78742570-78742592 TGCGGTGCAGGGAGGGGAGAAGG + Intergenic
1013015193 6:106154684-106154706 TGCTGTGCATGGAGGGGAAAGGG + Intergenic
1013594024 6:111645143-111645165 TCCTCTCCAGGCAGGGCAGCAGG - Intergenic
1015696425 6:135985271-135985293 AGCTCAGCTGTGAGGGCAGATGG - Intronic
1015699832 6:136023563-136023585 TGCTCTGCTCGAAGGGCAGAAGG - Intronic
1017003043 6:150008910-150008932 TGGACTGCAGGGAGGCCAGGAGG + Intergenic
1017525777 6:155240419-155240441 TGCTCAGCAGGGATCTCAGAGGG - Intronic
1017607201 6:156147029-156147051 CGCTCTGCAGGAAGGCGAGACGG + Intergenic
1019154998 6:170032760-170032782 TGCTCTGCAGGGCAGGCTGCAGG + Intergenic
1019462531 7:1168405-1168427 TGCTCTGCAGTCAGGGGAGAGGG + Intergenic
1019745777 7:2699794-2699816 AGCTCTGCAGGGAGGGGAGGAGG + Intronic
1019979829 7:4613463-4613485 AGATCTGCAGGGAGCTCAGATGG - Intergenic
1020261301 7:6532012-6532034 TGCTCTGCCAGGAGAGAAGAGGG + Intronic
1022993288 7:35729212-35729234 TGCTCTGCAGAGTGGGAGGAGGG + Intergenic
1024256560 7:47544168-47544190 TCCTCTGAAGGGAGGGAAGGGGG - Intronic
1024344630 7:48300684-48300706 TTCTCTGCAGCCAGGGAAGAGGG - Intronic
1024475516 7:49804377-49804399 TGGTCTGCTGGGAGAGCTGAGGG + Intronic
1025638906 7:63349471-63349493 AGCTGTGCAGGGAGGTCAGGAGG + Intergenic
1025643793 7:63398621-63398643 AGCTGTGCAGGGAGGTCAGGAGG - Intergenic
1026303840 7:69123096-69123118 TGTTCTGCAGGGAGCACAGCCGG - Intergenic
1026742079 7:72985028-72985050 TGCACTGCAGGGAGAGGAGTAGG + Intergenic
1026801924 7:73405456-73405478 TGCACTGCAGGGAGAGGAGCAGG + Intergenic
1026852681 7:73734993-73735015 TGCTGGGAAGGGAGGGCAAAGGG + Intergenic
1027101656 7:75380049-75380071 TGCACTGCAGGGAGAGGAGTAGG - Intergenic
1027615456 7:80417695-80417717 TGCTTTGAAGGGAGCGGAGAAGG - Intronic
1027975723 7:85153103-85153125 GGCTCTGCAGGGAGGACTGTGGG - Intronic
1029643498 7:101836481-101836503 TGCTGAGCAAGGAGGGCAGGTGG - Intronic
1031045790 7:116885919-116885941 TCCACTCCAGGGAGGGGAGAAGG - Intronic
1031278343 7:119761763-119761785 TGCTCTCTAGAGAGAGCAGAAGG - Intergenic
1033556503 7:142492576-142492598 TTCTCTGCAGAGAGGCCTGAGGG + Intergenic
1033558869 7:142512030-142512052 TTCTCTGCAGAGAGGCCTGAGGG + Intergenic
1034421804 7:150994648-150994670 AGCTATGCAGGGAAGGCTGAGGG + Intronic
1036424228 8:8628494-8628516 GGCTCACCAGGGAGGGCAGAAGG - Intergenic
1036470406 8:9047742-9047764 TGCTCTGTTGGAAGGGGAGAGGG - Intronic
1037451931 8:19024360-19024382 TGCTCTGCAGGGAGTGATGAAGG + Intronic
1037773029 8:21814036-21814058 TGCTCGGCAGGGGCGGCAGGGGG - Intergenic
1038176446 8:25185101-25185123 TCCTCTCCAGGGAGCGCCGATGG + Intronic
1038184831 8:25263855-25263877 TGCCCAGGAGGGACGGCAGAAGG + Intronic
1038285341 8:26201395-26201417 TGGTCAGCAGGAAGGGGAGATGG - Intergenic
1039147654 8:34466775-34466797 GGCTCTGGGGTGAGGGCAGAAGG + Intergenic
1039474004 8:37829832-37829854 GTCCCTGCAGGGTGGGCAGAGGG - Exonic
1041904084 8:63012767-63012789 TGCAATGGAGGGAGGGAAGATGG + Intergenic
1042956908 8:74260642-74260664 TGCTCTTCAGGGAGAACACACGG + Intronic
1043274932 8:78381223-78381245 TGGGGTGCAGGGAGGGCGGAGGG - Intergenic
1043372569 8:79611778-79611800 TGCGGTGCAGGGAGGTAAGACGG + Intronic
1044366129 8:91348006-91348028 TGCTCTGCAGGGAGCTCGGGAGG + Intronic
1044712693 8:95072858-95072880 TACACAGCAGGGAGGGCAGTGGG + Intronic
1044803840 8:95984387-95984409 TGCCTAGCAGGGAGTGCAGATGG + Intergenic
1046795310 8:118365154-118365176 TGGTCAGAAGGGAGGGAAGATGG - Intronic
1048426795 8:134330540-134330562 AACTCTGCAGGGAGAGCAAATGG + Intergenic
1048832883 8:138493568-138493590 TGCTATGCAGATAAGGCAGATGG + Intronic
1049392727 8:142380443-142380465 TGAACTGCATGGAGGGCAGAGGG + Intronic
1049795106 8:144493633-144493655 TCCTGGGCAGGGAGGCCAGAGGG + Intronic
1050053951 9:1632427-1632449 TGCTCTGTAGAGACTGCAGAGGG - Intergenic
1052818566 9:33121215-33121237 TGCTCACCATGGAGGGCAGAAGG + Intronic
1053274106 9:36770550-36770572 TGCCCTACAGGCTGGGCAGAGGG + Intergenic
1053513337 9:38708232-38708254 TGCCCTGCAGCGAGAGCACAGGG - Intergenic
1054789942 9:69247334-69247356 TGTGCTGCAGGGAGGAGAGAGGG + Intronic
1057047951 9:91900292-91900314 GGGGCTGCAGGAAGGGCAGACGG + Intronic
1057330101 9:94106313-94106335 AGCTCTGCCTGGAGAGCAGAAGG + Intronic
1057420163 9:94905862-94905884 ATTTCTGCAGGGAGTGCAGAAGG + Intronic
1057765137 9:97910070-97910092 TGCCCTGCTGGAAGGGCTGATGG - Exonic
1060006219 9:120002207-120002229 TGCTCTGCTAGGAGGGCACAAGG - Intergenic
1060075301 9:120585352-120585374 TGCTCTTCAGAGAAGGCAGTGGG - Intergenic
1060244382 9:121931807-121931829 TTCTCTGCTGAGAGTGCAGAGGG - Intronic
1060933089 9:127501078-127501100 AGCTCTGCAGGGGGAGCGGATGG - Exonic
1061263182 9:129491156-129491178 TGATTTGCAGGAAGGGCAGCAGG - Intergenic
1061409544 9:130411795-130411817 GGGGCTGCAGGGAGGGGAGAAGG + Intronic
1061502393 9:131011520-131011542 TGCTCTGCAGAGCGGGCTCACGG - Intronic
1061609801 9:131739208-131739230 AGCTCTGCAAGGAGGGCAGGTGG - Intronic
1061666580 9:132163576-132163598 TCCTCGGCAGGGGCGGCAGAGGG - Intronic
1061986698 9:134134434-134134456 TGCTTTGCCTGGAGGGCTGAAGG + Intergenic
1062196273 9:135275928-135275950 GGCTCTGGAGGGAGGGCACTTGG + Intergenic
1185648084 X:1629288-1629310 GGCTCTGCAGAGAGGACAGGAGG + Intronic
1186077121 X:5892771-5892793 TGCTGAGCGGGTAGGGCAGAGGG + Exonic
1186525526 X:10244641-10244663 TGCTGTGCTGGCAGGTCAGAGGG + Intergenic
1188973105 X:36640998-36641020 GGCTCTGGAGGGAGGGTAGAAGG - Intergenic
1188993592 X:36854369-36854391 GGCTCTGGAGGGAGGGAAAATGG + Intergenic
1189286584 X:39855998-39856020 TGTTTTGCTGGGGGGGCAGAGGG - Intergenic
1190136965 X:47806641-47806663 TGATCTGGAGAGAGGGAAGAGGG - Intergenic
1190290763 X:48990729-48990751 AGCTCTGCAGGGAAGGATGAGGG + Exonic
1190742791 X:53301279-53301301 TGCTTTGCAGGGAAGGGAGCAGG - Intronic
1193230891 X:79044830-79044852 AGCCCTTCAGGGAGGGGAGAGGG - Intergenic
1195301796 X:103536972-103536994 GGCTCAGCAGGGAAGGGAGAGGG + Intergenic
1197350993 X:125382963-125382985 TGATCTGGAGGGAGAGCACAAGG - Intergenic
1198842741 X:140876468-140876490 TCATCTCCAGGGAGGGGAGAGGG + Intergenic
1199895317 X:152120837-152120859 TGCTCTGCAGGGGGTGCGGCTGG - Intergenic
1201465828 Y:14279467-14279489 TGCACAGCAGGGATGGAAGAGGG + Intergenic