ID: 1103596831

View in Genome Browser
Species Human (GRCh38)
Location 12:122029357-122029379
Sequence CAACCCCCGTGGTGACAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 76}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103596831 Original CRISPR CAACCCCCGTGGTGACAGGG TGG Intronic
900092438 1:926225-926247 CCTCCCCGGTGGAGACAGGGGGG + Intronic
900476513 1:2878784-2878806 CAGCCCCCAAGGGGACAGGGAGG + Intergenic
901492271 1:9602621-9602643 CAAACGGCGTGGTGAGAGGGGGG - Intronic
902876713 1:19344784-19344806 CAAACAACGTGGTGACAGGAGGG + Intronic
904716055 1:32468414-32468436 CAATCACTGTGGTCACAGGGTGG + Intronic
917058040 1:171004776-171004798 AAACCCACCTGGTGACAAGGAGG - Intronic
917477868 1:175384427-175384449 GCACCCCCTGGGTGACAGGGTGG + Intronic
923526470 1:234776685-234776707 CTACTCCCGTGGTGAGAAGGTGG + Intergenic
1062909796 10:1205215-1205237 CAACCCCCGAGCTCAAAGGGAGG + Intronic
1067750294 10:48967240-48967262 CAATCCCCGTGGGAACAAGGAGG - Intronic
1069688549 10:70334804-70334826 CAACCGCCTTGGTGCCAGAGGGG - Intronic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1078049132 11:7946410-7946432 CAACTCCACTGGTGACAGAGGGG + Intergenic
1078339961 11:10491585-10491607 GAACTCCCGTGGTGGCAGTGAGG + Intronic
1084981621 11:72831961-72831983 CTACCCCCGTGGTAGCAGGCAGG - Intronic
1089257080 11:117199697-117199719 AAACCACCGGGGTGAGAGGGAGG + Intronic
1100665278 12:96745259-96745281 CAACCACTGTGGAGACAGTGTGG - Intronic
1103596831 12:122029357-122029379 CAACCCCCGTGGTGACAGGGTGG + Intronic
1105422439 13:20264864-20264886 CAACCCCATAGGTGACAGGGTGG - Intergenic
1106456875 13:29935440-29935462 CAGCCCACTTGGTGACAGTGAGG + Intergenic
1112369322 13:98781487-98781509 GAACCCCTGTGGTGTGAGGGAGG + Intergenic
1118325716 14:64779089-64779111 CTACCCCCGTGGGGCCAGGTGGG + Intronic
1121181295 14:91931113-91931135 CAACCCCCGTCCTCACAGGTAGG + Intronic
1121536970 14:94697607-94697629 CAGCCCCCTTGGTTACAGTGCGG - Intergenic
1128082528 15:64865060-64865082 CACCAGCCCTGGTGACAGGGTGG + Exonic
1132560703 16:592287-592309 CAACCCCCGAGTTGAGAGAGTGG - Intronic
1133001069 16:2852063-2852085 CACCCCCCATGGGGACAGGTGGG + Intergenic
1135571101 16:23549902-23549924 CCAGCCCCGTGGTGACCTGGGGG - Intronic
1138143189 16:54586097-54586119 CAACGCCCGTGCTGCCAGGGCGG - Intergenic
1141496542 16:84414348-84414370 CAACCCCAGTGGGCACAAGGTGG - Intronic
1142022359 16:87791754-87791776 GACCCCCCGTGTTGACATGGGGG + Intergenic
1142412080 16:89921980-89922002 CTTCCCTCGTGGAGACAGGGAGG + Intronic
1144817003 17:18041210-18041232 CACCCCCCGGGGTGTGAGGGTGG + Intronic
1148335476 17:46838044-46838066 CAACCCCTGTGTTGAGGGGGTGG + Intronic
1151774472 17:76190025-76190047 CAGCCCCAGTGTTCACAGGGTGG + Intronic
1152467221 17:80473171-80473193 CAGCCCCCGGGCTCACAGGGCGG - Intronic
1157690344 18:49676939-49676961 CAACCCCTGGGGTGAGAGTGAGG - Intergenic
1162024969 19:7888628-7888650 CACCCCACGAGGTGGCAGGGTGG + Intronic
1163782368 19:19257275-19257297 CACTCCCCGTGGTCACATGGAGG - Exonic
1166206673 19:41274373-41274395 CAACCCCTGTGTGTACAGGGCGG - Intronic
1166333940 19:42094258-42094280 CAACCCCACTGGTAAAAGGGTGG - Intronic
1167577630 19:50325440-50325462 CAACCCCTGTGGAGGAAGGGGGG - Intronic
928308543 2:30191272-30191294 CTACCGCCTTGGTGACAGAGCGG + Intergenic
928364333 2:30689868-30689890 CATCCCTCCTGGTGACGGGGTGG + Intergenic
928676247 2:33654561-33654583 CAACACCCGGGATGACAGGTTGG - Intergenic
940771551 2:157844345-157844367 CAAACCCAGTGGGGACAGGGTGG - Intronic
1170341713 20:15336025-15336047 CAACCCTATTGGTGAAAGGGTGG - Intronic
1174852509 20:54008373-54008395 CCACCCCAGTGGGGAGAGGGAGG - Intronic
1175757444 20:61538670-61538692 CCACCCTCCTGGGGACAGGGAGG - Intronic
1176039120 20:63055128-63055150 CAACCCCAGTGGGGACTGAGAGG + Intergenic
1183380622 22:37488895-37488917 CTACCCCAGTGGTGACAGACTGG + Intergenic
949187205 3:1206446-1206468 ACACCCTGGTGGTGACAGGGAGG - Intronic
953033228 3:39191299-39191321 CCACCCTGGTGGTGACAGGATGG - Intronic
960950434 3:122995407-122995429 CAGCCCCTGGGATGACAGGGTGG + Intronic
962073703 3:132058186-132058208 AAACCCATGTGGTGACAGTGAGG + Intronic
963956182 3:151256468-151256490 CACTCCCTGTGGAGACAGGGTGG - Intronic
969365294 4:6690563-6690585 CCATCTCCGTGGTGATAGGGCGG + Intergenic
973293056 4:48489653-48489675 CAGTCCCAGTGGTGACCGGGAGG - Intergenic
980072801 4:128261283-128261305 CAACCACTGTGGTGGGAGGGGGG - Intergenic
981550782 4:145938456-145938478 AAACCCCCGTGGGGGCAGAGAGG + Exonic
998062205 5:139127664-139127686 CAACAGCCCTGGTGACAGGGAGG + Intronic
999185026 5:149700859-149700881 CCACACCAGTGGGGACAGGGAGG - Intergenic
1000446784 5:161331817-161331839 CAATCACTGTGGTGACAGTGTGG + Intronic
1002086749 5:176780638-176780660 CAACCCAGGTGGGGACAGAGTGG - Intergenic
1003504525 6:6728729-6728751 CAATCCCCGTGGCCACAGGGTGG - Intergenic
1007364713 6:41383357-41383379 CAAGCCCTGTGAGGACAGGGAGG - Intergenic
1007431565 6:41780084-41780106 CAAGCCCGGAGGGGACAGGGCGG + Intronic
1012860308 6:104551547-104551569 CACCCCACCAGGTGACAGGGAGG + Intergenic
1018352241 6:162971932-162971954 CGAGCGCCGTGGTGACAGAGTGG - Intronic
1040004984 8:42612528-42612550 TAATCCACGGGGTGACAGGGAGG - Intergenic
1049632483 8:143666081-143666103 CATCCCCCGCGCTGTCAGGGAGG - Intergenic
1053292716 9:36892173-36892195 CAGTCCCCGTCGTGGCAGGGAGG - Intronic
1059165469 9:112072892-112072914 CAGCCCCCTTGGAGCCAGGGGGG + Intronic
1059253907 9:112911431-112911453 CATCTCCTGGGGTGACAGGGAGG + Intergenic
1061137095 9:128741284-128741306 CAACGGCCGAGGAGACAGGGAGG + Intronic
1062287645 9:135780179-135780201 CAGCCCCCGTGTGGACAAGGTGG - Intronic
1185629807 X:1507759-1507781 CTACCCCTGTGGTGACGGGAGGG + Intronic
1186977419 X:14923076-14923098 CAACCCGGGATGTGACAGGGTGG + Intergenic
1187009649 X:15266615-15266637 CAACCCTGGTGGGGTCAGGGTGG - Intronic
1196460303 X:115922939-115922961 CAACCACCGTGGGGGTAGGGAGG + Intergenic
1198049120 X:132931446-132931468 CTACACCAGTGGTGACTGGGGGG - Intronic
1202604357 Y:26626437-26626459 CAGCCATCGTGGTGACATGGTGG + Intergenic