ID: 1103597272

View in Genome Browser
Species Human (GRCh38)
Location 12:122031362-122031384
Sequence CAGGGCTTGGCACTGTGTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 225}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103597255_1103597272 26 Left 1103597255 12:122031313-122031335 CCAGTGCGCCCGGCCTGCAAGTT 0: 1
1: 0
2: 16
3: 216
4: 1620
Right 1103597272 12:122031362-122031384 CAGGGCTTGGCACTGTGTTTTGG 0: 1
1: 0
2: 2
3: 31
4: 225
1103597256_1103597272 18 Left 1103597256 12:122031321-122031343 CCCGGCCTGCAAGTTGTGTCTTC 0: 1
1: 0
2: 4
3: 19
4: 240
Right 1103597272 12:122031362-122031384 CAGGGCTTGGCACTGTGTTTTGG 0: 1
1: 0
2: 2
3: 31
4: 225
1103597260_1103597272 13 Left 1103597260 12:122031326-122031348 CCTGCAAGTTGTGTCTTCTGGGC 0: 1
1: 0
2: 0
3: 12
4: 138
Right 1103597272 12:122031362-122031384 CAGGGCTTGGCACTGTGTTTTGG 0: 1
1: 0
2: 2
3: 31
4: 225
1103597263_1103597272 -9 Left 1103597263 12:122031348-122031370 CCGAGCGCCCCCCCCAGGGCTTG 0: 1
1: 0
2: 3
3: 23
4: 317
Right 1103597272 12:122031362-122031384 CAGGGCTTGGCACTGTGTTTTGG 0: 1
1: 0
2: 2
3: 31
4: 225
1103597257_1103597272 17 Left 1103597257 12:122031322-122031344 CCGGCCTGCAAGTTGTGTCTTCT 0: 1
1: 0
2: 2
3: 21
4: 225
Right 1103597272 12:122031362-122031384 CAGGGCTTGGCACTGTGTTTTGG 0: 1
1: 0
2: 2
3: 31
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103597272 Original CRISPR CAGGGCTTGGCACTGTGTTT TGG Intronic
900323659 1:2096934-2096956 CAGGGCTTGTCACTGAGCGTAGG + Intronic
900398161 1:2461796-2461818 CAGGGCTGGGGCCTTTGTTTGGG + Intronic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
901119764 1:6881589-6881611 CAGGGCTTGGCACGGTCTTTTGG + Intronic
901691404 1:10975635-10975657 CTGGGCTTGGCCCTGTGCTGAGG - Intronic
901911833 1:12465010-12465032 CATGGCTTGGCACCTTGCTTGGG - Intronic
902673982 1:17995622-17995644 CAGGGTGTGGCACTTTGTTATGG - Intergenic
904873716 1:33637282-33637304 CAGGGCTCTGCACTGGGTATTGG + Intronic
905792404 1:40797220-40797242 CAGGGCTTGGCCCTCTGTGCTGG - Intronic
905854370 1:41298278-41298300 CAGGGCCTGGCAGTGGGCTTAGG + Intergenic
905934595 1:41813434-41813456 TAGGTCTTGCCAGTGTGTTTGGG - Intronic
906191016 1:43899498-43899520 CAGAGCCTGGGCCTGTGTTTGGG - Intronic
906581931 1:46942292-46942314 CAGAACTTTGCACTCTGTTTAGG + Intergenic
907240144 1:53076792-53076814 CAGAGATAGGCCCTGTGTTTAGG + Intronic
907828311 1:58039448-58039470 CAAGGCATGGCACTTTGTCTTGG + Intronic
911769402 1:101720266-101720288 AAGTGTTTAGCACTGTGTTTAGG - Intergenic
915023403 1:152803636-152803658 CAGAGCTCTGCACTGTGTTCAGG + Intronic
915591803 1:156875114-156875136 CAGGGCGTGTGAGTGTGTTTGGG + Intronic
916344584 1:163773571-163773593 CAGAGCTTGGCACATTATTTTGG + Intergenic
916607642 1:166358877-166358899 CAGTGCTGGGCACTTGGTTTTGG - Intergenic
918080869 1:181206827-181206849 CAGGGCTTGGCACTGCTTGAGGG + Intergenic
918678578 1:187322142-187322164 CAGCTCTTAGCACAGTGTTTGGG + Intergenic
919755225 1:201062316-201062338 CAGGGCAGGGGACTGTGTGTTGG - Intronic
920809376 1:209267936-209267958 CTGGGATTGGGACTGTGTTTGGG - Intergenic
921904067 1:220477720-220477742 CAGGGCCTGAAACTGTGTTGGGG + Intergenic
923316459 1:232785186-232785208 CAGGGCTTGGCTTTGCGCTTGGG + Intergenic
923443483 1:234044237-234044259 AAGGGCATGGCACTGACTTTTGG - Intronic
1062926217 10:1317601-1317623 CAGGAGTTGGCAATGTTTTTGGG + Intronic
1064197483 10:13257751-13257773 AAGGGCTTTGCAATGTGGTTAGG - Intergenic
1066693661 10:38058792-38058814 CTGGTCCTGGCACTTTGTTTTGG - Exonic
1067213626 10:44282056-44282078 CAGGGCAGGGCTCTGTGTTTGGG - Intergenic
1067527299 10:47046466-47046488 CCTCGCTTGGCACTGTGTCTTGG - Intergenic
1070045871 10:72835810-72835832 CAGCACTTAGCACTGTGTTGTGG + Intronic
1070749264 10:78954376-78954398 CAGGGCCTGGCACAGTGCTCAGG - Intergenic
1070967248 10:80536984-80537006 CAGGATTTGGCACTGTGGCTTGG - Intergenic
1071478823 10:86047543-86047565 CAGGGTTAGGAACTCTGTTTAGG - Intronic
1073063918 10:100747580-100747602 CCCGGCTTGGACCTGTGTTTAGG + Intronic
1073098820 10:100996738-100996760 CAGGGGTTGTCCCTGTATTTGGG + Intronic
1075438768 10:122463068-122463090 CGGGGCTTGGCAGTGCGCTTGGG + Intronic
1079002926 11:16772930-16772952 CTGAGCTTGGCACTGGGTTGGGG - Intergenic
1079097189 11:17518552-17518574 CAGGGCTTGGCAAAATGTTGGGG + Intronic
1079584233 11:22105915-22105937 CAGGACTTGGCACAGTGTCATGG - Intergenic
1080578177 11:33618722-33618744 TAGGGCATCCCACTGTGTTTTGG + Intronic
1080653918 11:34243770-34243792 CAGGGCTTGGTCCTGGGTCTGGG - Intronic
1083612159 11:64009501-64009523 CAGGGCTTGGCTCTGCCTTCAGG - Intronic
1085040843 11:73325367-73325389 CAGGGCTGGGCCCTGTGCTTGGG + Intronic
1085128224 11:74016542-74016564 CAGGGCTTGGCTCTGTGTACAGG + Intronic
1085205601 11:74730542-74730564 GAGGGCAGGGCACTGTGTTTTGG - Intronic
1086933568 11:92720197-92720219 CAGGGTTAGGCACTATGTTAAGG - Intronic
1088297684 11:108318401-108318423 CAGGGCTGGGCACAGTGTGGTGG + Intronic
1089008459 11:115113042-115113064 CAGGGCTTGACACTGCTGTTAGG + Intergenic
1090242823 11:125196056-125196078 CATGGCTTGGCTCTGTCTTTAGG + Intronic
1091019581 11:132087470-132087492 CAAGGCTTGGAATTGAGTTTGGG + Intronic
1091145204 11:133273390-133273412 CAGGACTTGGAAGTGTGGTTTGG - Intronic
1091837755 12:3597672-3597694 CAGGGCCTGGCCCAGAGTTTGGG + Intergenic
1092008159 12:5087030-5087052 CAAGGCTTGGCAGTGTATTTGGG + Intergenic
1092667208 12:10815985-10816007 CAGGGCCTGGGACTGTGGGTTGG - Intergenic
1092958181 12:13569646-13569668 CAGTGCATGGCACTTTGTTATGG + Intronic
1093756590 12:22859776-22859798 CAGGGTTTGGCACTGGTTTCAGG + Intergenic
1095154010 12:38830876-38830898 CATGGCTTGGCATAGTGATTAGG - Intronic
1095627428 12:44333264-44333286 CAGGGCCTGGCATATTGTTTGGG - Intronic
1095680428 12:44968317-44968339 CAGTACCTGGCACTGTGCTTGGG - Intergenic
1096650990 12:53061913-53061935 CAGGGCTGGGCACTGGGTGGCGG - Exonic
1096737749 12:53669171-53669193 CTGGGATTGGAACTGTGTTTGGG - Exonic
1099968749 12:89478517-89478539 CAGTGCCAGGCACTGTGTCTGGG - Intronic
1100362293 12:93889847-93889869 CAGGGCTTGGGGCTTTGTTTTGG + Intronic
1101021012 12:100553803-100553825 CAGTGCTAGGCACTATGTCTGGG + Intronic
1101144625 12:101829841-101829863 CAGTACCTGGCACTGTGCTTGGG + Intronic
1101892643 12:108730970-108730992 CAGGCCTGGGGACTGGGTTTGGG - Intronic
1102340400 12:112116940-112116962 CAGGGCCTGGCACCTTGATTAGG + Intergenic
1102538649 12:113601697-113601719 CAGGGCTTGGATCTGTGGTCAGG + Intergenic
1103597272 12:122031362-122031384 CAGGGCTTGGCACTGTGTTTTGG + Intronic
1104426544 12:128682735-128682757 CAGTGTGTGGCACTGTGTTATGG - Intronic
1106078514 13:26481658-26481680 CAGGCTGTGGCACTGTGTTATGG - Intergenic
1106465530 13:30011059-30011081 CAGCACTTAGCACTGTGCTTGGG + Intergenic
1109862222 13:68215148-68215170 CAGCGCTTTGCACTGTACTTTGG - Intergenic
1113145662 13:107204356-107204378 CAGGCCTGGGCACTGTGTTCTGG + Intronic
1113333981 13:109360561-109360583 CAGGCCTTGGGTCTGTGCTTGGG - Intergenic
1113956441 13:114102044-114102066 CAAGGCTGGGGACTGTGTGTCGG - Intronic
1115434193 14:33354917-33354939 CAGAGGGTGGAACTGTGTTTGGG - Intronic
1115545336 14:34461427-34461449 TAGGGTTTGAAACTGTGTTTTGG - Intronic
1123058030 14:105581623-105581645 CAGGGCTGGGCACTGCGTCCTGG + Intergenic
1123931070 15:25171890-25171912 TGTGGCTTGGCTCTGTGTTTGGG + Intergenic
1124212151 15:27772016-27772038 CAGGCCTTGACGCTGTGCTTGGG - Intronic
1127349684 15:58138185-58138207 CAGGGCCCGTCACTGTGATTTGG + Exonic
1127969573 15:63947781-63947803 CAGGGCCTGGAAATGTGGTTAGG - Intronic
1128578366 15:68791527-68791549 CAGGGTTAGGCTCTGTGCTTTGG - Intronic
1128945070 15:71814257-71814279 CGGGGCCTGGCACTGTGCCTGGG - Intronic
1130966425 15:88700964-88700986 CAGGGCCTGGGGCTGTGTGTGGG - Intergenic
1132846967 16:2005138-2005160 CAGGGCCTTTCCCTGTGTTTGGG - Intronic
1135861739 16:26062352-26062374 CAGTGCTTGGCACTGTGATTGGG + Intronic
1136457970 16:30392904-30392926 CAGGGCCTAGGACAGTGTTTAGG + Intronic
1141508762 16:84499017-84499039 CAGGTCTTGGCCCTTTGCTTTGG - Intronic
1141531468 16:84649161-84649183 CTGGGATTGTCACTGTGCTTGGG + Intronic
1141841030 16:86574227-86574249 CAGGGAATGCCACTGTGTCTGGG + Intergenic
1142006597 16:87692297-87692319 CAGGGCCTGGAACAGTGCTTAGG - Intronic
1142075759 16:88116803-88116825 CAGGGCTGGGGACTGTGGGTCGG + Intronic
1149046585 17:52253491-52253513 AAAGGCTTGGCACTTTGCTTTGG + Intergenic
1149389573 17:56175502-56175524 AAGGGCTTTGCAATGTGTATAGG - Intronic
1149641231 17:58204251-58204273 CAGGGCCTTGCGCTGTCTTTTGG - Exonic
1150245132 17:63669060-63669082 AGGGGCTTTGCACTGTGTGTAGG + Intronic
1152348450 17:79769283-79769305 CAGGGCATGGAACTTTGTTGTGG + Intergenic
1152448449 17:80360690-80360712 CAGAGCTCAGCACTGTGTCTGGG - Intronic
1152656818 17:81523687-81523709 CAGGGCCTGGCACTGAGGTGGGG + Intronic
1152893784 17:82898034-82898056 CACGGCATGGCTCTGGGTTTTGG + Intronic
1152893789 17:82898065-82898087 CATGGCATGGCTCTGGGTTTTGG + Intronic
1152935083 17:83131998-83132020 CAGGGCTGGGCTCTGTTTCTCGG + Intergenic
1154065916 18:11106821-11106843 AATGGCTTGGGACTGTTTTTTGG + Intronic
1155268798 18:24119565-24119587 GAGGGCTTTGCACTGACTTTTGG - Intronic
1160139809 18:76311419-76311441 CAGGGCTTGTCATTGGGTCTCGG + Intergenic
1160243046 18:77136597-77136619 GAGGGCTTGGCCCTGGCTTTGGG + Intergenic
1162939924 19:14002946-14002968 GAAGGCTTGGGACTGTGTCTGGG + Intronic
1167703683 19:51065811-51065833 CTGGGCTTGGCCCTCTGCTTGGG + Intergenic
1167750168 19:51374643-51374665 CTGGGCTTGATACTGAGTTTGGG - Intergenic
1168182455 19:54671593-54671615 CAGGGCTTGGAACTGTCCATCGG - Intronic
1168261745 19:55198964-55198986 CAGGGCGTATCACTGTGTTCTGG - Intronic
925779048 2:7363269-7363291 CAGGGCTGTCAACTGTGTTTTGG + Intergenic
925981419 2:9180407-9180429 CAGGGCCTGGCTCTGTGTCCTGG + Intergenic
928300027 2:30116852-30116874 CAGGGCCAGGGACTGTGTCTGGG - Intergenic
930520236 2:52456768-52456790 CAGGACTAGGCAGTGTGTCTTGG - Intergenic
934526806 2:95057075-95057097 CAGGGTTTGGTACAGTGTCTGGG + Intergenic
934870926 2:97864692-97864714 AAGGGCTTCTCACTGTTTTTTGG - Intronic
935125088 2:100215769-100215791 CATGTCTTGGCACCTTGTTTAGG + Intergenic
936528414 2:113258141-113258163 GAGGACTTGGAAGTGTGTTTTGG - Intronic
937273836 2:120671797-120671819 CAGGGCTTGGCACTGAGTAGGGG + Intergenic
937635499 2:124151252-124151274 CAGGGCTTGGCATTGTTCTTAGG - Intronic
937930585 2:127201848-127201870 CAGGCCTGGGCTCTGCGTTTTGG - Intronic
938557808 2:132441534-132441556 CTGGGCTTGGTGCTGTGTGTGGG + Intronic
938574391 2:132590574-132590596 CAAGGGTAGGCACTGAGTTTGGG + Intronic
941198004 2:162474053-162474075 CAGCTCTTGGCACAGTGTCTAGG - Intronic
941760829 2:169241156-169241178 CAGGGCATGGCTCTGTGATCGGG - Exonic
944136538 2:196405894-196405916 CTGGGCTTGGCAATGTGTCAAGG - Intronic
944216688 2:197263375-197263397 CTGGGATTGCGACTGTGTTTGGG + Intronic
944511736 2:200472254-200472276 GCGGGCCTGGCCCTGTGTTTGGG + Intronic
944517087 2:200523020-200523042 AAGGGCTTGACACAGTGTCTAGG + Intronic
948074124 2:235152364-235152386 CAAGGCTTGGCTGTGTGTTTGGG + Intergenic
948601991 2:239112536-239112558 CTGGGCTGGGCTCTGTGTGTGGG + Intronic
1168922647 20:1553213-1553235 CATGGCCTGGCACTGTTGTTAGG - Intronic
1172205935 20:33162921-33162943 CAGGGCTGGGCACTGTGCCAGGG + Intronic
1172206523 20:33166649-33166671 CAGAGCCTGGCACTGGGCTTGGG - Intronic
1174130853 20:48342422-48342444 CAGGGCTTATCTGTGTGTTTGGG - Intergenic
1174187799 20:48719446-48719468 AAGGGGTGGGCACTGTGGTTGGG + Intronic
1174538781 20:51273425-51273447 CAGAGCTGGGCTCTGTTTTTTGG + Intergenic
1174547489 20:51336574-51336596 CAGCGCTTGGCATGGTGTTGGGG + Intergenic
1174566461 20:51468396-51468418 CAGGGCTTGGGAGTGGGTATGGG - Intronic
1175354872 20:58356600-58356622 CGGTGCTTGGCACTCTGGTTGGG + Intronic
1179119258 21:38527914-38527936 CAGGGTGTGGCACTTTGTTATGG - Intronic
1182609769 22:31537410-31537432 AAGGGCTTGGCAGTGGGTGTTGG + Intronic
1183327239 22:37200881-37200903 CTGGACTAGGAACTGTGTTTTGG + Intergenic
1183572067 22:38660982-38661004 CAGGGCCTTACAATGTGTTTTGG + Intronic
1184252204 22:43267233-43267255 CAGGGCCTGGCACAGGGTTAGGG + Intronic
953318659 3:41952129-41952151 CTGGGCTTGGCAATGATTTTTGG + Intronic
954681089 3:52346318-52346340 CAGGGCTTGGCAGTAAGTTGGGG + Intronic
955102705 3:55867309-55867331 CTGTGCTAGGCACTGTGTGTGGG - Intronic
955200513 3:56847930-56847952 CAGTGCTATGCACTGTGGTTAGG + Intronic
956765276 3:72479561-72479583 CAGGGCTGGGAACTGTGTTGTGG - Intergenic
960128319 3:114025062-114025084 CAGGTCTTAGCACTGTGTTCTGG - Intronic
961375543 3:126463028-126463050 CAGGGCTGGGCACTGTGCTGGGG - Intronic
961743879 3:129051043-129051065 CAGGGCTTGGCACTCAGTACAGG - Intergenic
962325617 3:134429628-134429650 CAGGGCTTGGCACCTTTCTTTGG - Intergenic
962768555 3:138591387-138591409 CAATGCTTGGAACTATGTTTTGG - Intronic
963837142 3:150068811-150068833 CAGAGCTTGGCACTTGGTTAAGG + Intergenic
966639060 3:182168958-182168980 TAGGGCTTTGCAATGTGTTTTGG - Intergenic
968300340 3:197608284-197608306 CAGGGATGACCACTGTGTTTTGG - Intergenic
968322006 3:197777992-197778014 GAGGGCTAGGCACTGTGGCTCGG - Intronic
968869502 4:3234506-3234528 CAGGGCTTTGGCCTGTGTCTGGG - Intronic
970314357 4:14815240-14815262 CAAGGCTAGGGGCTGTGTTTTGG + Intergenic
970373111 4:15428751-15428773 CTGGGAGTGGCACTGTGATTGGG - Intronic
971417078 4:26441747-26441769 CAGGGGATGGGACTTTGTTTTGG - Intergenic
973992945 4:56429582-56429604 CAGTGATTTGCTCTGTGTTTAGG - Intronic
975691972 4:76974332-76974354 CAGGGATTGGCAGAGTGTTGAGG - Intronic
976326982 4:83782863-83782885 CAGGGCATGGCCCTTTGTTTAGG + Intergenic
976497359 4:85745914-85745936 CAGGGGAAGGCACTGGGTTTTGG - Intronic
978372632 4:108044349-108044371 CAGGACTAAGCACTCTGTTTTGG - Intergenic
978845874 4:113271995-113272017 CAGGGCTTGGCATTTGCTTTAGG + Intronic
984255982 4:177390583-177390605 ATGGGCTTGGCACAGTGTTTAGG - Intergenic
985654926 5:1125897-1125919 CAGGGCCTGGCACTGTTGTCAGG - Intergenic
988906873 5:35799279-35799301 CAGGGCTTGGGCCTCTGCTTTGG + Intronic
988958857 5:36348926-36348948 CTGTGTTTGGGACTGTGTTTGGG - Intergenic
990189975 5:53249130-53249152 CAGGGATTGGTTCTGTGTTTTGG - Intergenic
990538126 5:56744205-56744227 CAGGGCTTGGCACAGAGTTAGGG - Intergenic
991982899 5:72251718-72251740 CATGGCTTGGATCTGTGGTTGGG + Intronic
992137301 5:73760055-73760077 CAGAGCCTGGCACTGTGGGTTGG + Intronic
992859845 5:80898929-80898951 CAGTGGTGGGCACTGTGTCTGGG + Intergenic
995447299 5:112259539-112259561 CATGGCTCTGCACTGTGTTTGGG - Intronic
995454262 5:112335151-112335173 CAGGGCTTGGCACAGAGTACAGG + Intronic
995518064 5:112974000-112974022 GAGGGCTAGGCCCTTTGTTTTGG - Intergenic
996800383 5:127396611-127396633 CGGGGCTTGCCACTGTGCTGCGG + Exonic
997576581 5:134982524-134982546 CATGGCTTTTCACTGTGTTTTGG - Intronic
997928599 5:138053661-138053683 CAGTGCCTGGCACTTTTTTTGGG - Intergenic
998645798 5:144060522-144060544 CAGGGCCTGTCAGTGTGTTGGGG + Intergenic
1000075225 5:157778307-157778329 CAAGGCTTGGCACTCTGCCTGGG + Intergenic
1001281819 5:170391432-170391454 CAGGGCTTGTCAATGCCTTTTGG - Intronic
1001434990 5:171693360-171693382 CAGGGCTCAGGCCTGTGTTTAGG - Intergenic
1001575065 5:172757961-172757983 CAGGGCTAGGCACATTGTTGAGG - Intergenic
1002290874 5:178199902-178199924 CTGGGCCTGGCACTGAGATTTGG - Intergenic
1002845399 6:940383-940405 CAGGCCTTAGCAGTGTCTTTTGG + Intergenic
1002923507 6:1590839-1590861 CATAGCTCAGCACTGTGTTTGGG - Intergenic
1003718012 6:8668378-8668400 CAGGGCTTTCCACTCTGTTTGGG - Intergenic
1007245682 6:40460505-40460527 CACGGCTTGGGAATGTGCTTTGG - Intronic
1007620721 6:43212918-43212940 CAGGGCTAGGCGCTGGGTCTAGG + Intronic
1009270895 6:61612637-61612659 AAGTGCTTGGCACAGTGTCTGGG - Intergenic
1012601985 6:101109972-101109994 CAGGGCTTTGCACCATGTCTGGG + Intergenic
1012752851 6:103184777-103184799 CAGGACTTGACACTCTCTTTGGG + Intergenic
1014813155 6:125907405-125907427 CAGTGCTGTGCTCTGTGTTTGGG - Intronic
1014919920 6:127202067-127202089 CAGGGCATGGCACTCGTTTTTGG - Intergenic
1016166599 6:140953307-140953329 CAGAGCTTGGCAAGATGTTTGGG - Intergenic
1017598008 6:156050251-156050273 CAGGCCTTGGCAATGAGTTTAGG + Intergenic
1018399260 6:163405802-163405824 CAGGCCCTGCCTCTGTGTTTGGG - Intergenic
1019081070 6:169430077-169430099 CAGGGCATGGGGCTGTGTCTTGG + Intergenic
1019149922 6:169998462-169998484 CAGGGCCTTGTACTGTGTTGGGG + Intergenic
1020027164 7:4907309-4907331 CAGGCCTTGGCGCTGTGCTCTGG + Exonic
1020254259 7:6493576-6493598 CAGGGCTTTGCACTGACTCTGGG + Intergenic
1020462285 7:8439357-8439379 CAGGGTGTGGCATTCTGTTTGGG + Intronic
1024098735 7:46007215-46007237 CAGTGCTCAGTACTGTGTTTGGG + Intergenic
1024217836 7:47263025-47263047 CAGGTCCTGGCACTCTGTGTGGG - Intergenic
1024598255 7:50958002-50958024 CAGGGCTTGGCTCTGAGGGTGGG - Intergenic
1024691577 7:51808813-51808835 CTGGGCTTGTCACTTTCTTTGGG + Intergenic
1030686101 7:112488518-112488540 AAGGGCTTAGCACAGTGTCTGGG - Intronic
1031784250 7:126008909-126008931 CAGGGCCTGTCAGTGTGTTGGGG - Intergenic
1031950916 7:127891258-127891280 CAGGGCTTTGCTCTGTGTCCAGG + Intronic
1033126614 7:138712388-138712410 CAGAGTTTGGCACTATGTGTTGG - Intronic
1034078781 7:148257578-148257600 CAGGGCTTGGCAATGTAGGTTGG + Intronic
1034407738 7:150916491-150916513 CAGGTATGGCCACTGTGTTTTGG - Intergenic
1035064804 7:156096711-156096733 CAGGGCTGGGACCTTTGTTTTGG - Intergenic
1035182250 7:157097808-157097830 AAGGGCTGGGCACTGTGATGAGG + Intergenic
1036296566 8:7542715-7542737 CAGAGCTTAGCTCTGTGTGTTGG + Intergenic
1036326000 8:7778304-7778326 CAGAGCTTAGCTCTGTGTGTTGG - Intergenic
1038090493 8:24247762-24247784 GAGAGCTTAGCACTGTGTTGGGG - Intergenic
1038793882 8:30692951-30692973 CTGGGCTTGGCACTGTACCTGGG + Exonic
1040601585 8:48890141-48890163 CAGAGCCTGGCATGGTGTTTGGG - Intergenic
1041033160 8:53758929-53758951 CAGGGATTGGCAACGTGATTTGG - Intronic
1042535482 8:69854484-69854506 CAGTGGTTGACACTGTCTTTGGG - Intergenic
1043538278 8:81230173-81230195 CAGGACTTGGCACTGGATATAGG - Intergenic
1045003275 8:97896519-97896541 CAGGGCTGGGCAGTGGGTTCAGG + Intronic
1046508516 8:115168315-115168337 CTTGGCTTGGAACTGTCTTTTGG - Intergenic
1047408026 8:124601457-124601479 CAGGGCTCGGGACTGTGTCATGG + Intronic
1049255222 8:141610153-141610175 CGTGACTTGGCACTGTGTTGAGG - Intergenic
1049395380 8:142397839-142397861 CATGCCTTGGCACTGTGTGCTGG - Intronic
1051974298 9:22930390-22930412 CAGATCTTAGCACTGTGTTTGGG - Intergenic
1054809986 9:69426986-69427008 CAGGGCTGGACACTCTGTGTTGG + Intergenic
1056763070 9:89428324-89428346 CAGGGCCAGGGACTGTGTTTGGG - Intronic
1057865290 9:98675342-98675364 CAGGACTTGTCACTGTGGTTAGG - Intronic
1058002143 9:99876700-99876722 CAGTGCTTTGCACTGTGCCTAGG - Intergenic
1059362384 9:113754943-113754965 GAGGGGAAGGCACTGTGTTTGGG + Intergenic
1060430974 9:123551384-123551406 CAGGTCGTGGCACCGTGTGTAGG - Intronic
1060778412 9:126393507-126393529 CTGGGCTTGTCACTGTTTTCTGG + Intronic
1061308451 9:129746405-129746427 CAGTGCTTAGCACAGTGTCTGGG + Intronic
1061777336 9:132974180-132974202 CAGGGCTTAGAACAGTGTTTGGG - Intronic
1062349527 9:136132278-136132300 CAGGGCTAGGGTCTGTGTTTTGG + Intergenic
1062588904 9:137264160-137264182 CAGGGCCTGGAGCTGTGTTTGGG + Intronic
1186564334 X:10646079-10646101 CAGGGAGTGGCAGTGTGGTTCGG - Intronic
1187711767 X:22061541-22061563 CAGGGCTGGGCACTTTATTGAGG + Intronic
1189142969 X:38626051-38626073 CAGTGCTTGGCATTGTGCCTGGG + Intronic
1192170097 X:68849094-68849116 CAGGGCTGGGCACTGTTCTAAGG - Intergenic
1193116400 X:77779686-77779708 CCAGGCATGGCACTGTGTTAGGG - Intronic
1194916130 X:99711387-99711409 CATGGATTGGCACTATATTTTGG + Intergenic
1197959419 X:131987999-131988021 GAGGGTCTGGCACTGTGTTAGGG - Intergenic
1198675405 X:139125689-139125711 CAGTGCCTGGCCCTGTGTTAGGG + Intronic