ID: 1103597813

View in Genome Browser
Species Human (GRCh38)
Location 12:122034872-122034894
Sequence AGTGGAGTACACTTTGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 169}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103597805_1103597813 25 Left 1103597805 12:122034824-122034846 CCCGGGGTCTTCCTTCCTAACTC 0: 1
1: 0
2: 0
3: 25
4: 233
Right 1103597813 12:122034872-122034894 AGTGGAGTACACTTTGAGAAAGG 0: 1
1: 0
2: 1
3: 9
4: 169
1103597808_1103597813 10 Left 1103597808 12:122034839-122034861 CCTAACTCCTCTTGCGCTTTTGT 0: 1
1: 0
2: 1
3: 13
4: 135
Right 1103597813 12:122034872-122034894 AGTGGAGTACACTTTGAGAAAGG 0: 1
1: 0
2: 1
3: 9
4: 169
1103597806_1103597813 24 Left 1103597806 12:122034825-122034847 CCGGGGTCTTCCTTCCTAACTCC 0: 1
1: 0
2: 1
3: 18
4: 302
Right 1103597813 12:122034872-122034894 AGTGGAGTACACTTTGAGAAAGG 0: 1
1: 0
2: 1
3: 9
4: 169
1103597810_1103597813 3 Left 1103597810 12:122034846-122034868 CCTCTTGCGCTTTTGTGCTGGAG 0: 1
1: 0
2: 0
3: 5
4: 89
Right 1103597813 12:122034872-122034894 AGTGGAGTACACTTTGAGAAAGG 0: 1
1: 0
2: 1
3: 9
4: 169
1103597807_1103597813 14 Left 1103597807 12:122034835-122034857 CCTTCCTAACTCCTCTTGCGCTT 0: 1
1: 0
2: 1
3: 15
4: 174
Right 1103597813 12:122034872-122034894 AGTGGAGTACACTTTGAGAAAGG 0: 1
1: 0
2: 1
3: 9
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103597813 Original CRISPR AGTGGAGTACACTTTGAGAA AGG Intronic
900787379 1:4657134-4657156 AGATGAGTACATTTTGATAAAGG + Intronic
902753995 1:18537275-18537297 AGAGGAGGACCCTTTGAGAGAGG + Intergenic
905966385 1:42100986-42101008 AATGGAGAAAACTTTGTGAATGG - Intergenic
908520141 1:64933629-64933651 AGTGTAGTACAGCATGAGAAGGG - Intronic
909840546 1:80316456-80316478 TGTGAAGTACACTGTAAGAATGG + Intergenic
909866227 1:80675616-80675638 AGAGGAGAAAACTTTTAGAAGGG + Intergenic
915641671 1:157232283-157232305 AGTAAAGTACACTTGGAAAAGGG + Intergenic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
920254354 1:204644371-204644393 AGGGGTCTACCCTTTGAGAAAGG - Intronic
924876521 1:248111058-248111080 AGTGGATTACAGATTGGGAATGG - Intergenic
1065312652 10:24431247-24431269 ACTGGAGTAAACTTTGGAAAGGG - Intronic
1068021032 10:51584506-51584528 AGTAGGGTGCACTATGAGAATGG - Intronic
1070270766 10:74952391-74952413 AGTGGAGTACAGTTTCAGAGAGG + Intronic
1070926496 10:80226467-80226489 AGTAAAGTACACTTGGAAAAGGG - Intergenic
1070996634 10:80789332-80789354 AATGGAGTACTCTTTGTGAAGGG - Intergenic
1072268335 10:93751706-93751728 AGTGTAGCCAACTTTGAGAATGG + Intergenic
1073029762 10:100516327-100516349 TGTGGAGTTACCTTTGAGAAAGG - Intronic
1080249600 11:30218299-30218321 AGTTGAGGACACTTTGGGGAAGG - Intergenic
1082760978 11:57126620-57126642 AGTGGTGTTCATTTTCAGAATGG + Intergenic
1084971667 11:72775462-72775484 AGGGTAGTACATTTGGAGAATGG - Intronic
1087848673 11:103002973-103002995 GCTGGAATACAGTTTGAGAAAGG - Intergenic
1089910359 11:122092938-122092960 ACTGGAGTTCACTTTCAGGAAGG - Intergenic
1092575122 12:9774509-9774531 AGTAAAGTACACTTGGAAAAGGG + Intergenic
1096301706 12:50434186-50434208 AGAACAGTACTCTTTGAGAAGGG + Intronic
1096720028 12:53514328-53514350 AAGGGAGGACACTTTCAGAAAGG - Exonic
1098339880 12:69440987-69441009 AGAGGAGTAGACATTGAAAAGGG - Intergenic
1101423237 12:104566279-104566301 ACTGGAATAGACTTTGAGATAGG - Intronic
1102779233 12:115549258-115549280 CATGGAGTACACTGTGTGAAAGG - Intergenic
1102784829 12:115595940-115595962 AGTGGAGTCCACTGTGATGATGG - Intergenic
1103140501 12:118543868-118543890 AGAGGAGAACACTTGCAGAATGG - Intergenic
1103597813 12:122034872-122034894 AGTGGAGTACACTTTGAGAAAGG + Intronic
1104435472 12:128752915-128752937 AGGGGTGTTCACTTGGAGAAGGG - Intergenic
1104710445 12:130982104-130982126 AGTGGAGTCTTCTCTGAGAATGG + Intronic
1106184237 13:27394862-27394884 CTTGGACCACACTTTGAGAATGG + Intergenic
1106780757 13:33056971-33056993 AGTGGAATCCACTCTGAGGAGGG - Intronic
1106966011 13:35068865-35068887 AGTGGGGGCCACTTTTAGAAAGG + Intronic
1107122912 13:36814683-36814705 AGTGAAGTACACTTGGAAGAAGG - Intergenic
1107325157 13:39234184-39234206 AGGGGAGTACACGATGATAATGG - Intergenic
1108737663 13:53301639-53301661 AGTGGAGTATACTTTCAAACTGG + Intergenic
1112094293 13:96115376-96115398 AGGGGAGGAAACTTAGAGAATGG - Intronic
1113759027 13:112834826-112834848 AGTGCTGGACACTTAGAGAAGGG + Intronic
1118451736 14:65909013-65909035 ATTGGAGTACACTATTACAATGG - Intergenic
1119694435 14:76701514-76701536 GGTGGAGAAAACTTTGGGAAAGG - Intergenic
1119919454 14:78432819-78432841 AGTGGAGAAAACTTAGTGAAGGG + Intronic
1120097118 14:80401841-80401863 AGTGAAGTACACTTGGAAGAGGG + Intergenic
1120306106 14:82772774-82772796 AGAGGAGTGCACTAGGAGAAAGG - Intergenic
1121676969 14:95761356-95761378 AGCGGAGGACTCTTTGAGGAGGG + Intergenic
1130103239 15:80909841-80909863 AATGTAGTTCACTTCGAGAAAGG - Intronic
1130785941 15:87096761-87096783 GTTGGAGTACACTTTGAGCTTGG - Intergenic
1133023544 16:2977500-2977522 AGTGGTGTCCACTTCCAGAATGG + Intronic
1135569329 16:23536203-23536225 AGTGGAATACCCTGTTAGAAGGG - Intronic
1137429877 16:48410055-48410077 ATTTGAGTCCACTTTGGGAAGGG - Intronic
1140651376 16:77092254-77092276 AGTAGAATACATTTTGAAAAGGG - Intergenic
1148159601 17:45442360-45442382 AGTGGAGTGCAGTTGGTGAAGGG - Intronic
1149473836 17:56942043-56942065 AGTGGAGTACGCTGTGACACAGG - Exonic
1150561449 17:66299008-66299030 TGTGGAGTCCAAATTGAGAAGGG + Intergenic
1151035493 17:70793808-70793830 AGTGCACTGCACTTTGAGAAGGG + Intergenic
1153746013 18:8180446-8180468 AATAGAGTACACTTGGAAAAGGG + Intronic
1154407318 18:14105860-14105882 TGTTGAGTAAGCTTTGAGAATGG + Exonic
1155747584 18:29378572-29378594 AGTGAAGGACTCTTTGGGAATGG + Intergenic
1156204491 18:34871320-34871342 AGTTGAGTAGACTTGGAGGATGG + Intronic
1157510617 18:48269615-48269637 GGTGGATTTCACTTTGAGCATGG - Intronic
1159517532 18:69476649-69476671 ATTGGAGTTGACCTTGAGAAAGG + Intronic
1164820175 19:31243868-31243890 TGTGGAATACACTTGGAGGAGGG + Intergenic
1166084895 19:40467771-40467793 AGTGGAAGACACTTAGAGATGGG - Intronic
925687212 2:6484406-6484428 TGTGGATTACAGATTGAGAATGG + Intergenic
928290687 2:30034591-30034613 ATTGGGATGCACTTTGAGAACGG - Intergenic
928363600 2:30685208-30685230 AGTGCAGTTCACCTTCAGAATGG - Intergenic
930046990 2:47181128-47181150 TGTGGAGTACACCTGGAGGAAGG + Intergenic
933069181 2:77836272-77836294 AGTAAAGTACACTTGGAGGAGGG - Intergenic
933875855 2:86621785-86621807 AGTGGAATGTAATTTGAGAAAGG - Intronic
935934720 2:108169135-108169157 AGTGGGGTAAGCTTTCAGAAGGG - Intergenic
939035419 2:137125141-137125163 AGTGGAGAAGACTCTGAGATGGG - Intronic
939098855 2:137871231-137871253 AATGGAGTAGACATTTAGAAAGG - Intergenic
939389499 2:141547972-141547994 AGTGGCAGAGACTTTGAGAAAGG + Intronic
940145406 2:150540648-150540670 AGTGGAGTAAATTTTAAAAATGG - Intergenic
941718288 2:168786707-168786729 AGTAAAGTACACTTCGAGGAGGG - Intronic
942619556 2:177832967-177832989 AGTAAAGTACACTTGGAGGAGGG - Intronic
942775770 2:179580645-179580667 ATTGGAGCACACAGTGAGAAGGG + Intronic
944073268 2:195696897-195696919 AGTATAGTACACTTGGAAAAGGG + Intronic
944397856 2:199289866-199289888 ATGGGAGTACACCTGGAGAAGGG - Intronic
946963513 2:225010567-225010589 AGAAGAGCAGACTTTGAGAAAGG + Intronic
947502767 2:230683502-230683524 AGTGTGGCACCCTTTGAGAAGGG + Intergenic
1168942608 20:1726350-1726372 CGTGGAGGACTCTCTGAGAAAGG - Intergenic
1169429353 20:5522627-5522649 AGTAAAGTACACTTGGAAAAGGG - Intergenic
1171198026 20:23216480-23216502 TGTGGACCACACTTTGAGCAAGG - Intergenic
1175157508 20:56981523-56981545 AGTGGTTTACACTGTCAGAAAGG + Intergenic
1177743175 21:25178444-25178466 ATTGGAGTAATATTTGAGAAGGG + Intergenic
1178482503 21:32991747-32991769 TGTTGCCTACACTTTGAGAAAGG + Intergenic
1181547675 22:23612069-23612091 TGTGGAGTAGACTGTTAGAAGGG - Intronic
1183000257 22:34851028-34851050 AAAGGAGTACACAGTGAGAAAGG + Intergenic
949925005 3:9034018-9034040 AGTGGAGCACACTTTAGGAATGG - Intronic
950435346 3:12976153-12976175 AGTGGTGTACACTCTGGGAGTGG - Intronic
950907902 3:16555570-16555592 AGTGAAGTACACTTGGAAGAGGG - Intergenic
951528008 3:23672090-23672112 AGTGGAGGAGACTTGGAGGAAGG - Intergenic
951943519 3:28108985-28109007 AGTGGAGTAGACTATGGGATTGG - Intergenic
952163776 3:30723534-30723556 AGTGAAGAAAACTATGAGAATGG - Intergenic
952998202 3:38905698-38905720 AGTGGAGTATAAATTTAGAAAGG + Intronic
953228157 3:41039794-41039816 AGTGGAGTACAATATGGGAATGG + Intergenic
955608383 3:60731384-60731406 AGTAAAGTACACTTGGAGGAGGG + Intronic
956277063 3:67513943-67513965 GATGGAGTATACTTTGGGAATGG - Intronic
957674070 3:83344749-83344771 AGTAAAGTACACTTGGAAAAGGG + Intergenic
959925868 3:111921303-111921325 AGTGGAGAACATGTTGAGTAAGG - Intronic
963994146 3:151687248-151687270 AGTAAAGTACACTTGGAAAAGGG + Intergenic
966685516 3:182690247-182690269 TGGAGACTACACTTTGAGAACGG - Intergenic
966752330 3:183334377-183334399 AGTGGACAACACTTTGACTAGGG + Intronic
967587954 3:191237481-191237503 AGTGAAGTACACTTGGAAGAAGG + Intronic
967716922 3:192773164-192773186 GGTGGAGAACATTTTTAGAAAGG - Intergenic
968151158 3:196337740-196337762 AGTAAAGTACACTTGGAAAAGGG - Intronic
970316873 4:14837563-14837585 AGTGGAATGCACTTTGGAAATGG - Intergenic
974216907 4:58859386-58859408 AATGGAGTACAGCTTTAGAATGG + Intergenic
976328730 4:83803207-83803229 CGTGGAGTCCACTTTGAGAAGGG - Intergenic
977254607 4:94727193-94727215 AGTGAAGGCCACGTTGAGAAGGG - Intergenic
979183135 4:117755604-117755626 AGTAAAGTACACTTGGACAAGGG + Intergenic
981191580 4:141871249-141871271 AGTGAAGTACACTTGGAAGAGGG + Intergenic
982217605 4:153095600-153095622 TGTGGAGTTCACTTTCACAAGGG + Intergenic
986956255 5:13153749-13153771 AGGGGAGGAAACTTAGAGAATGG + Intergenic
987096819 5:14557577-14557599 AGTAAAGTACACTTGGAGGAGGG - Intergenic
987226121 5:15843205-15843227 AGAAGAATACACTTTGACAAAGG - Intronic
987878398 5:23710708-23710730 AGTGAAGTACACTTGGAAGAGGG + Intergenic
987953299 5:24704196-24704218 AATGGAGAACACAATGAGAAAGG - Intergenic
988092981 5:26567334-26567356 AGTAAAGTACACTTGGAAAAGGG + Intergenic
988650179 5:33140504-33140526 AGTAAAGTACACTTGGAAAAGGG + Intergenic
990721751 5:58703628-58703650 GGTGGACCTCACTTTGAGAATGG - Intronic
991463486 5:66884373-66884395 AGTGTTGTGCACTTTGTGAATGG - Intronic
991495715 5:67223893-67223915 AGTGCAGTCCACTTTGAAAATGG + Intergenic
991525139 5:67547977-67547999 AGAGGTGTTCACTTTTAGAAGGG + Intergenic
992738370 5:79746363-79746385 AGTTTAGTTCTCTTTGAGAATGG - Intronic
992869740 5:80994094-80994116 TGCGAAGTACACTTTAAGAAGGG + Intronic
994577613 5:101599520-101599542 AGTTTTGTACATTTTGAGAATGG - Intergenic
995331034 5:110946218-110946240 AGTAAAGTACACTTGGAAAAGGG - Intergenic
1000429992 5:161140066-161140088 TCTAGAATACACTTTGAGAAAGG + Intergenic
1003064077 6:2887912-2887934 AGTGAAGTACACTTAGAAAAGGG - Exonic
1004362853 6:14986458-14986480 AGTAAAGTACACTTGGAAAAGGG + Intergenic
1004528042 6:16427635-16427657 AGTTGAGGTCACTTTGAAAACGG - Intronic
1005282660 6:24291025-24291047 AGTGGAGCAGAGTTGGAGAATGG - Exonic
1006544290 6:34766550-34766572 AGTGGAGGACTTTTTGAGAATGG + Intronic
1006632415 6:35438882-35438904 AGTAAAGTACACTTGGAAAAGGG - Intergenic
1010601007 6:77826504-77826526 AAGGCTGTACACTTTGAGAAGGG - Intronic
1011560475 6:88608837-88608859 AGTGGAGCAGACTCTGAGCAGGG - Intergenic
1014547806 6:122753281-122753303 AGTGGAGAACACTTAGGGAGGGG - Intergenic
1021688943 7:23213824-23213846 AGTGAAGTACACTTGGAAGAGGG + Intergenic
1023541474 7:41271082-41271104 AGTCTAGTCCACCTTGAGAATGG - Intergenic
1024246107 7:47471659-47471681 GATGGAGCAGACTTTGAGAATGG - Intronic
1027752151 7:82162840-82162862 AGTGGAATACATTTTGACATTGG - Intronic
1030375380 7:108747353-108747375 AGAGGAATACATTTTTAGAAAGG + Intergenic
1033398496 7:140998918-140998940 AATGGGGTACAATCTGAGAACGG + Intergenic
1035694441 8:1584459-1584481 AGTGGAGGAGACTGTGAGAGAGG - Intronic
1040398985 8:47028900-47028922 AGTGAAGGACACTTTGTGTAAGG + Intergenic
1042861794 8:73321810-73321832 AGTTCAGTACACGTTAAGAATGG - Intronic
1045008255 8:97934975-97934997 ATTGGGGTACAGTTTGTGAAAGG - Intronic
1046337765 8:112812503-112812525 AGTGAAGTACATTTGGAAAAGGG - Intronic
1046513035 8:115222555-115222577 AGTAGAGTACACTTGGAAGAGGG - Intergenic
1048206134 8:132416837-132416859 AGTGCAGTAGGCTTTGTGAAGGG + Intronic
1049118649 8:140713598-140713620 CAAGGACTACACTTTGAGAATGG + Intronic
1051570785 9:18556460-18556482 AGTGGGCTACACTTAGATAAAGG - Intronic
1051799640 9:20918295-20918317 ACTGGAGTAAAATTTTAGAATGG - Intronic
1053363160 9:37503882-37503904 AGTGGAGTACGCAGTGAGGAAGG + Intergenic
1054946745 9:70804026-70804048 AGAACAGTACATTTTGAGAAAGG - Intronic
1055707559 9:79022869-79022891 AGTGGAGTACTCTGTGACATTGG - Intergenic
1056014091 9:82364122-82364144 TGTGATGTACACATTGAGAAAGG - Intergenic
1057524031 9:95783936-95783958 CGTGGAGCACAGTTTGGGAAAGG + Intergenic
1061554877 9:131361279-131361301 AGTAAAGTACACTTGGAAAAGGG + Intergenic
1185489425 X:509745-509767 AAAAGAATACACTTTGAGAAGGG - Intergenic
1186032916 X:5390184-5390206 TGTGGAGTAGAGTTTGAGAAAGG + Intergenic
1186384680 X:9097658-9097680 GGTGGAGAAGACTTTGTGAAGGG + Intronic
1186631278 X:11351590-11351612 AATGGAGTCCTCGTTGAGAATGG - Intronic
1188637066 X:32446999-32447021 ATTGGAGTACATTTTCCGAAGGG - Intronic
1188883351 X:35518153-35518175 AGTAAAGTACACTTGGAAAAGGG + Intergenic
1189996426 X:46643289-46643311 AGTGAAGAACACAATGAGAAGGG + Exonic
1190829815 X:54049681-54049703 AGTGTAGTCCACTGTGACAATGG + Intergenic
1192144266 X:68670583-68670605 AGTGGCCTACACTGTGAAAATGG - Intronic
1193320941 X:80120316-80120338 AGTGGAGCAGACTTGGAGGAGGG + Intergenic
1196717460 X:118824746-118824768 CGTGGGGGGCACTTTGAGAAGGG + Intronic
1198154596 X:133946482-133946504 AATACAGTACACTTTCAGAAAGG + Intronic
1198702014 X:139407057-139407079 ACTGTAATACTCTTTGAGAAAGG - Intergenic
1199082389 X:143591356-143591378 AGTAGAGTACACTTGGAAGAGGG - Intergenic
1202274215 Y:23098815-23098837 AGTGAAGTACACTTGGAAGAGGG - Intergenic
1202291811 Y:23321862-23321884 AGTGAAGTACACTTGGAAGAGGG + Intergenic