ID: 1103601756

View in Genome Browser
Species Human (GRCh38)
Location 12:122058928-122058950
Sequence AACTCTCTGGAGTCCACGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103601746_1103601756 25 Left 1103601746 12:122058880-122058902 CCATAGCTCCAGGAAGAGTTTGG 0: 1
1: 0
2: 0
3: 12
4: 170
Right 1103601756 12:122058928-122058950 AACTCTCTGGAGTCCACGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 103
1103601753_1103601756 -10 Left 1103601753 12:122058915-122058937 CCATAGGTCCTCAAACTCTCTGG 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1103601756 12:122058928-122058950 AACTCTCTGGAGTCCACGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 103
1103601749_1103601756 17 Left 1103601749 12:122058888-122058910 CCAGGAAGAGTTTGGGTGTGAGG 0: 1
1: 0
2: 3
3: 25
4: 236
Right 1103601756 12:122058928-122058950 AACTCTCTGGAGTCCACGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103601756 Original CRISPR AACTCTCTGGAGTCCACGCT TGG Intronic