ID: 1103612646

View in Genome Browser
Species Human (GRCh38)
Location 12:122133535-122133557
Sequence CATGGTGAAGACAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 840
Summary {0: 1, 1: 0, 2: 6, 3: 68, 4: 765}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103612646 Original CRISPR CATGGTGAAGACAGGGAGGA AGG (reversed) Exonic
900285736 1:1899515-1899537 CATGGTGAGGTCAAGGACGAAGG + Intergenic
900641416 1:3689632-3689654 GGTGGGGACGACAGGGAGGAAGG + Intronic
900746557 1:4364854-4364876 CAGGAGGAAGACAGAGAGGAGGG - Intergenic
900780292 1:4613587-4613609 CATTCTGCAGACAGGGAGCATGG - Intergenic
901127443 1:6939569-6939591 CAGGCTGGAGACAGAGAGGACGG - Intronic
901276987 1:7999581-7999603 CAAGGTCAAGGCAAGGAGGATGG - Intergenic
901306206 1:8234846-8234868 CAAGGTGAAGACAGTGTTGATGG + Intergenic
901544732 1:9947406-9947428 CATGGAGCAGTGAGGGAGGAAGG - Intronic
901675375 1:10880381-10880403 CAAGGTGAAGAAGGGGAAGAAGG - Intergenic
902070547 1:13731433-13731455 CATGGTGAAATCAGAGAGAAGGG - Intronic
902206099 1:14869179-14869201 AAGGGTCAAGACAGGCAGGAAGG - Intronic
902281876 1:15380739-15380761 CATGGAGAAGTCAGGGAAGATGG + Exonic
903552972 1:24170727-24170749 GATGGTGGAGACAGTGAGAAAGG + Intronic
904358448 1:29956801-29956823 CATGGTGAAGCCAGGATGGGAGG + Intergenic
905098653 1:35498568-35498590 CAGAGTGGAGGCAGGGAGGAAGG - Intronic
905447134 1:38034773-38034795 CAGGGTGAAGAGAGGCAAGATGG - Intergenic
905815138 1:40944229-40944251 CACAGCGAAGAAAGGGAGGATGG - Intergenic
906178560 1:43798154-43798176 CATTGTGAAGACAGGAAAGGGGG - Intronic
906381276 1:45333404-45333426 CATGGAGAAGACGGGTAGGCAGG - Exonic
906638677 1:47427715-47427737 CAGGGAGAAGACAGAGAGTAGGG + Intergenic
906788889 1:48641472-48641494 GACTGTGAAGACAGAGAGGAGGG + Intronic
907752266 1:57273639-57273661 AGTGGAGAAGACAGGGAGGGAGG - Intronic
907760584 1:57354944-57354966 CGTGGAGAAGACAGGGCTGATGG - Intronic
908118116 1:60961002-60961024 CATGAGGTTGACAGGGAGGAGGG + Intronic
908281481 1:62541500-62541522 CAATGTGAAGACAATGAGGATGG + Intronic
908434471 1:64091733-64091755 CATGGAGAAGAAAGGAAGCAAGG - Intronic
908564899 1:65344385-65344407 CATGAAGAAGACAGGGAGGGTGG + Intronic
908672164 1:66559864-66559886 CTTGCTGGAGCCAGGGAGGAGGG + Intronic
908855418 1:68421346-68421368 CATGGAGGAGAAAGGGAGAAGGG - Intergenic
909876540 1:80811988-80812010 CATGGAGAAGAAATGGAGAAAGG + Intergenic
909877008 1:80819125-80819147 CATTGAGGAGAGAGGGAGGAAGG - Intergenic
910649692 1:89552725-89552747 CCTGGTGAACACAGGGAGCAGGG - Intronic
910741041 1:90516846-90516868 CATGATAGAGAAAGGGAGGACGG + Intergenic
910891432 1:92024436-92024458 GAGGGAGAAGAGAGGGAGGAGGG + Intergenic
911437053 1:97874094-97874116 GATGATGAAGACAATGAGGATGG - Intronic
912747620 1:112258497-112258519 CATGGTGCAGAGAGGAAGCAAGG - Intergenic
914232129 1:145772820-145772842 CATGGTAAGGAGAGGGAGAAAGG - Intronic
915190799 1:154148855-154148877 GATGGTGAAGGAAGGAAGGAAGG + Intronic
915444891 1:155968987-155969009 CAGAGTGAGGACAGGGAGCAAGG + Intronic
916317097 1:163461285-163461307 CTTTGTGAAGCCAGGTAGGAAGG + Intergenic
916795780 1:168165794-168165816 CATGATGATGGCAGGAAGGAAGG - Intergenic
917451547 1:175151479-175151501 AATGGTGGAGAAGGGGAGGAGGG + Intergenic
917697595 1:177542422-177542444 CAGGGTGGAGACTGGGAAGAGGG + Intergenic
919048981 1:192488978-192489000 CAAGGTGAAGACAAGGAGAGAGG + Intergenic
919773479 1:201178027-201178049 CCTGCTGAAGACAGGGATGGTGG + Intergenic
919804834 1:201375379-201375401 CAGGGTGAGGACAGTGAGGGAGG + Intronic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
919988328 1:202691345-202691367 CATGGTGAAGACATGTAGATTGG + Intronic
920086209 1:203419302-203419324 CATGTTCAAGGCAGGGAGAAGGG + Intergenic
920167002 1:204043142-204043164 CATGGAGGAGAGAGGGAGAAAGG + Intergenic
921073766 1:211683811-211683833 CAAGGTGCAAACAGGCAGGAGGG - Intergenic
921249140 1:213280150-213280172 GATAATGAAGACAAGGAGGAAGG + Intergenic
921827416 1:219688682-219688704 CATGGTGAGGAGAGGGAGGGTGG - Intronic
923342801 1:233021994-233022016 CAGGGTTAGGCCAGGGAGGATGG + Intronic
923482233 1:234396456-234396478 CAGGGTGAAGAGAGGGACGGAGG - Intronic
923482570 1:234397715-234397737 GAGGGGGAAGAGAGGGAGGAGGG + Intronic
923496643 1:234531415-234531437 CATGGGGAAGAAGGGGAGGTGGG - Intergenic
924119913 1:240785661-240785683 CATGGTGGAGAGAGGGATGGGGG + Intronic
924712095 1:246537905-246537927 CATGGTGACAAAAGGGAAGATGG - Intergenic
924743797 1:246814055-246814077 CATGGGGAAGAACGGGGGGAAGG - Intergenic
1063151951 10:3345138-3345160 CTTGTTAAAGACAGGAAGGAAGG - Intergenic
1063227842 10:4033125-4033147 CATGGTCAAGACTTGGAAGATGG - Intergenic
1063585178 10:7345843-7345865 CGCTGTGAAGACATGGAGGAAGG - Intronic
1063678710 10:8165376-8165398 CATGAAGAAGCCAGGGAGGTGGG - Intergenic
1064145608 10:12823956-12823978 CCTGGGGAAGACAGAGAGGAGGG + Intronic
1064165304 10:12980522-12980544 CACAGGGCAGACAGGGAGGAGGG + Intronic
1064666928 10:17662957-17662979 CAAAGTGAAGAGAGAGAGGAGGG - Intronic
1065167682 10:22997264-22997286 CAAGATGAAGCCAGGGTGGAAGG - Intronic
1065363179 10:24908702-24908724 CATGGAGCAGTGAGGGAGGAAGG + Intronic
1065799829 10:29342038-29342060 CCTGGAGAAGAAAGGGAGAAGGG + Intergenic
1065899818 10:30196092-30196114 GAGGGTGAAGGCTGGGAGGAGGG - Intergenic
1066444504 10:35469682-35469704 CAGGGAGAAGACAGGGAGATAGG + Intronic
1066618551 10:37321017-37321039 CATGGTAACAAAAGGGAGGATGG - Intronic
1066656348 10:37702229-37702251 CTGGCTGAGGACAGGGAGGAGGG - Intergenic
1067147771 10:43706130-43706152 CAAGGTGCTGATAGGGAGGATGG + Intergenic
1067825313 10:49567941-49567963 CAATGTGAAGACAGTAAGGATGG - Intergenic
1067897493 10:50200067-50200089 GAGGGTGAAGGCTGGGAGGAGGG - Intronic
1067926221 10:50511342-50511364 TCTGGTTAAGACAGTGAGGAAGG + Intronic
1067951482 10:50741970-50741992 GAGGGTGAAGGCTGGGAGGAGGG + Intronic
1068170927 10:53393630-53393652 CATGGTGCAGGGAGGGAGTAAGG - Intergenic
1068432163 10:56947887-56947909 CATGGGAAAGACTGGGAGCAAGG - Intergenic
1068561441 10:58519134-58519156 GATGGTGGAGGCAGGGAAGAGGG - Intronic
1069860616 10:71468890-71468912 CATGCTGAAGGCTGGGAGGGAGG - Intronic
1069984691 10:72275085-72275107 CTGGCTGAAGCCAGGGAGGAAGG - Exonic
1070148703 10:73792468-73792490 CGTGGAGAGGACAGGGTGGAGGG - Exonic
1070575284 10:77672841-77672863 CCTGGGGAAGGCAGGGAGGCCGG - Intergenic
1071480019 10:86058095-86058117 AGTGGGGAAGAAAGGGAGGAAGG + Intronic
1071710081 10:88041468-88041490 GATGGTGGTGAGAGGGAGGAGGG + Intergenic
1071751117 10:88477333-88477355 GATGGTGAAGTTAGGGATGAAGG + Intronic
1071751143 10:88477527-88477549 GATGGTGAAGACAGGGATGATGG + Intronic
1071761939 10:88617524-88617546 AACGGAGAAGACAGAGAGGAGGG + Intergenic
1072169654 10:92847601-92847623 CATGATCAAAGCAGGGAGGAAGG - Intronic
1072543267 10:96414451-96414473 CAGGGAGAAGACAGTGAGGAGGG - Intronic
1072808979 10:98445259-98445281 CCTGGGGAGGACAGGGAGGCAGG - Intronic
1073068945 10:100781356-100781378 CGTGATGAAGGTAGGGAGGAGGG + Exonic
1073191721 10:101655974-101655996 CATGGTGGGGACAGGCAGAAAGG + Intronic
1073824786 10:107308139-107308161 CAAGGTGAGAACATGGAGGATGG + Intergenic
1073826714 10:107332222-107332244 CATGGGGAAGGGAAGGAGGAAGG - Intergenic
1073979687 10:109140886-109140908 CAGGATGAAGAGAGGGAGGTGGG + Intergenic
1074509819 10:114101745-114101767 TATGGCGATGACAGGGAGCAGGG - Intergenic
1075623609 10:123946239-123946261 CATGATGGAGACCAGGAGGAGGG + Intergenic
1075923989 10:126235889-126235911 CAAGGGGAACACACGGAGGAGGG + Intronic
1076235756 10:128862728-128862750 GGTGGTGAAGAAATGGAGGAAGG + Intergenic
1076493610 10:130881783-130881805 AAGGGTGAAGACAAGCAGGAAGG - Intergenic
1076667676 10:132102402-132102424 CATGGGGTACAGAGGGAGGAAGG - Intergenic
1076704282 10:132292897-132292919 CATGGGGAAGGGAGGGGGGAGGG - Intronic
1077344212 11:2038978-2039000 CATGGAGGGCACAGGGAGGAGGG + Intergenic
1077837975 11:5941063-5941085 CAAGGTGGAGGAAGGGAGGAGGG + Intergenic
1078039805 11:7849427-7849449 GATGGTGACGACAGTGAGGTGGG - Intergenic
1078525148 11:12095042-12095064 CATGTTGATGAAAGGGAGGGAGG + Intronic
1078801537 11:14649770-14649792 TATGTTGAAGACAGAGGGGAGGG + Intronic
1079012683 11:16842341-16842363 CATGGAGCAGTGAGGGAGGAAGG - Intronic
1079662362 11:23055033-23055055 GATGGTGAAGAGTGGGAGGAAGG - Intergenic
1079789465 11:24717742-24717764 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1080084477 11:28261409-28261431 CATGGAGCAGTGAGGGAGGAAGG + Intronic
1080308142 11:30858880-30858902 CCTGGGGAAGACAGGCAGGTAGG - Intronic
1080637895 11:34139501-34139523 CCGGGTGGGGACAGGGAGGAGGG + Intronic
1081213402 11:40363407-40363429 GAGGGTGAAGGCTGGGAGGAGGG + Intronic
1081340760 11:41924424-41924446 CATTGTGGGGAGAGGGAGGAAGG - Intergenic
1081460933 11:43272432-43272454 CATGGGGAAGGCAGGGAGTTTGG + Intergenic
1081730095 11:45365713-45365735 GATAATGAAGAAAGGGAGGAAGG - Intergenic
1081737836 11:45416717-45416739 CATGGGGAAGAGAGGGAGGAAGG - Intergenic
1082007642 11:47428670-47428692 CAGGTTGATGACAGGGATGAAGG - Intergenic
1082029236 11:47592972-47592994 CTTGGTTAGGACAGGGAGGAGGG + Intronic
1082742328 11:56924499-56924521 GATGGGGAAGAAAGGAAGGAAGG + Intergenic
1082797767 11:57390369-57390391 GATGGTGGAGACATGGAGGAGGG - Intronic
1083844653 11:65324094-65324116 GATGGTGGAGACAGAGAGGAGGG + Intergenic
1083934491 11:65863225-65863247 AGTGGGGAAAACAGGGAGGAGGG + Intronic
1084305933 11:68283309-68283331 CCTCGTGCAGGCAGGGAGGAAGG - Intergenic
1084406203 11:68975053-68975075 CAGATTGAAGACAGGGAAGAGGG + Intergenic
1084489246 11:69469407-69469429 CAGGGGGAAGACATGAAGGAAGG + Intergenic
1084632910 11:70367240-70367262 CATCTGGAAGACAGGAAGGAGGG - Intronic
1085097982 11:73775996-73776018 CAAGGTCAAGAAGGGGAGGAAGG + Intergenic
1085237274 11:75024877-75024899 GATGGTGAAGATAGGGAGTGGGG + Intergenic
1085384680 11:76150250-76150272 CATGGTGAGGACAGCAAGGAAGG + Intergenic
1085778093 11:79383997-79384019 CATGGGGAAGAAAGGAAGGGGGG - Intronic
1085862547 11:80251615-80251637 CATGGGGAAGCCAGGAGGGAAGG - Intergenic
1086020530 11:82224152-82224174 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1088371042 11:109088954-109088976 GATGGTGAACACAGGAAGGTGGG - Intergenic
1088815841 11:113420179-113420201 GAGGAGGAAGACAGGGAGGAAGG - Intronic
1088961904 11:114676612-114676634 GATGGTGAGGAGAGGGAGAAAGG + Intergenic
1088981634 11:114869929-114869951 CATAGTGCAGAGTGGGAGGAAGG + Intergenic
1089302841 11:117508870-117508892 CATAGTGAAATCAGGCAGGAAGG + Intronic
1089579440 11:119472268-119472290 CAGCATGAAGACAGGGAGGATGG - Intergenic
1089597165 11:119587897-119587919 GAGGGTGAAGACAGAGAGAAGGG - Intergenic
1090351296 11:126110163-126110185 CGTGGGGAGGACTGGGAGGATGG + Intergenic
1091210583 11:133854799-133854821 CCTGGTGAGAACACGGAGGAGGG - Intergenic
1091278736 11:134370131-134370153 CCTGCTGAGGCCAGGGAGGAAGG - Intronic
1202827198 11_KI270721v1_random:94167-94189 CATGGAGGGCACAGGGAGGAGGG + Intergenic
1091477628 12:792018-792040 CATGGGGAATAAAGGCAGGAAGG - Intronic
1091934794 12:4426573-4426595 CCGGGTGAAAGCAGGGAGGAGGG + Intergenic
1092173939 12:6390353-6390375 CAGGGAGAAGAGAGGAAGGATGG + Intronic
1092969909 12:13683630-13683652 CATGGAGTAGTGAGGGAGGAAGG - Intronic
1092974473 12:13730965-13730987 CCTGGTGGAGACAGGGAAGGAGG - Intronic
1092975282 12:13738986-13739008 CATGGTGAAGACAGCACGGGAGG + Intronic
1093055712 12:14553860-14553882 CATGGAGCAGTGAGGGAGGAAGG + Intronic
1093481637 12:19610080-19610102 GAGGGTGGAGACTGGGAGGAGGG - Intronic
1093802247 12:23388510-23388532 GAGGGTGGAGAAAGGGAGGAGGG + Intergenic
1094202285 12:27806280-27806302 CATGGAGCAGTGAGGGAGGAAGG + Intergenic
1094205197 12:27832276-27832298 GAGGGTGAAGAGCGGGAGGAGGG - Intergenic
1094410475 12:30163364-30163386 CAGGGTGGAGACGGGGAGGTGGG - Intergenic
1095697649 12:45158962-45158984 GATGGTGAAGGGTGGGAGGAGGG - Intergenic
1095903768 12:47356274-47356296 AATGGAGAAAACAGTGAGGATGG + Intergenic
1096402511 12:51318992-51319014 AAGGGTGGAGCCAGGGAGGATGG - Intronic
1096666520 12:53169969-53169991 CATGGAGACGAGAGGGATGAAGG + Intronic
1096801612 12:54114198-54114220 AATGGTGATGACAGGGGGCAGGG + Intergenic
1097016494 12:55991040-55991062 CAGTGTGAAAACAGGAAGGAGGG + Intronic
1097176638 12:57147212-57147234 CAGGGGGAGGGCAGGGAGGAAGG - Intronic
1097297089 12:57978164-57978186 CATGGAGCAGTGAGGGAGGAAGG + Intergenic
1097812895 12:64037438-64037460 CATGGTGGAGATATGCAGGATGG - Intronic
1099169141 12:79342628-79342650 CATGGTGAAGACTATAAGGATGG + Intronic
1099195270 12:79608299-79608321 CAGGGGGATGGCAGGGAGGATGG + Intronic
1099254477 12:80298604-80298626 CCAGGTGAAGAGAGGGAGTAGGG + Intronic
1099451045 12:82806761-82806783 CAATGTGAAGACAACGAGGATGG - Intronic
1099516951 12:83608693-83608715 TAGGGTGAAGACTGGGAGGGGGG + Intergenic
1099793277 12:87363509-87363531 CCTGCTGAAGCCAGGGAGGCTGG - Intergenic
1100192715 12:92209803-92209825 GATAGTGAAGAGAGGGTGGAAGG - Intergenic
1100684398 12:96970899-96970921 CCTGGTGAAGAGGGAGAGGAAGG + Intergenic
1101091287 12:101288591-101288613 CATGGTCATGACAAGGAGGCTGG - Intronic
1101416671 12:104514414-104514436 CATGGTGAAGAGGATGAGGAAGG - Intronic
1101503030 12:105321448-105321470 CATGAAGAAGCCAGGGAGGTTGG - Intronic
1102078601 12:110080012-110080034 AAGGGAGAAGACAGGGAGAAAGG + Intergenic
1102107268 12:110336141-110336163 CATGGTGATGACAGACAGGTAGG - Intronic
1102759643 12:115374472-115374494 CATGGGGAAGGAAGGAAGGAGGG + Intergenic
1102901981 12:116646112-116646134 CACCGTGAGGACAGAGAGGAGGG + Intergenic
1102953284 12:117044354-117044376 GAGTGGGAAGACAGGGAGGAAGG - Intronic
1102974596 12:117197443-117197465 CACTGGGAAGCCAGGGAGGAGGG - Intergenic
1102983450 12:117260407-117260429 CATGGTGAATTAAGGCAGGAAGG - Intronic
1103204776 12:119120100-119120122 GATGGTGAAGGAAGGGAGGGAGG - Intronic
1103437491 12:120937976-120937998 CATGGAAATGAAAGGGAGGAAGG + Intergenic
1103446159 12:120996560-120996582 CAGGGTGCTGACAGGGGGGAGGG - Exonic
1103612646 12:122133535-122133557 CATGGTGAAGACAGGGAGGAAGG - Exonic
1103725271 12:122994669-122994691 GGTGGGGAAGACAGGAAGGAGGG + Intronic
1103863770 12:124034976-124034998 CCTGGTGAAGCCAGCGAGAAAGG + Intronic
1103878859 12:124150432-124150454 CCTGCTGAAGACAGGCAGGCTGG + Intronic
1104667678 12:130658954-130658976 CATGGTGGAGGAAGGGAGGTTGG - Intronic
1104667685 12:130658977-130658999 CATGGTGGAGGAAGGGAGGTTGG - Intronic
1104667692 12:130659000-130659022 CATGGTGGAGGGAGGGAGGCTGG - Intronic
1105210856 13:18255996-18256018 CAAGGAGGAGACAGAGAGGATGG + Intergenic
1105587277 13:21756858-21756880 CAGGGTGAAGTCAGGGGGCAGGG - Intergenic
1107664821 13:42677841-42677863 CAGGGTGAAGTCATGGGGGAGGG + Intergenic
1107871063 13:44746905-44746927 CTTGGGGAAGACAGAGAGGTAGG + Intergenic
1107938242 13:45363017-45363039 TGGGGTGGAGACAGGGAGGATGG - Intergenic
1108962379 13:56250252-56250274 CATGGTGAAGGCAATGAGTAGGG + Intergenic
1109006603 13:56885492-56885514 CATGGAACAGAGAGGGAGGAAGG + Intergenic
1109527948 13:63600924-63600946 GAGAGTGAAGAAAGGGAGGAGGG - Intergenic
1109903232 13:68802265-68802287 CATGCTGAAAACAGGGGCGAGGG - Intergenic
1110290419 13:73799256-73799278 GAAGGTGATGAAAGGGAGGAGGG + Intronic
1110669600 13:78161764-78161786 CAAGGTGAGGACAGGCAAGATGG + Intergenic
1110934596 13:81271585-81271607 GAAGGTGAAGACAGTGAGGTAGG + Intergenic
1110981036 13:81898664-81898686 GAGGGTGAAGGCTGGGAGGAGGG - Intergenic
1111770815 13:92593304-92593326 CATTTTGAAGGCAGGGAGTAAGG + Intronic
1112047721 13:95614708-95614730 CATAATGAAGGAAGGGAGGATGG - Intronic
1113397109 13:109958133-109958155 GAGGGTGGAGAGAGGGAGGAAGG - Intergenic
1113731583 13:112645378-112645400 GATGGCGAGGACAGTGAGGATGG + Intergenic
1113731622 13:112645567-112645589 CATGGCGAGGACGGCGAGGATGG + Intergenic
1113899105 13:113786309-113786331 GATGGTGATGACAGTGGGGAAGG - Intronic
1113899143 13:113786663-113786685 GATGGTGATGACAGTGATGATGG - Intronic
1113968223 13:114166837-114166859 CGTGGTGAGGAGAGGGAGCAGGG - Intergenic
1114307370 14:21436570-21436592 AATGGTGAAGACAGAGAAAATGG - Intronic
1114632110 14:24165745-24165767 CATGATGGAGAGAGGTAGGAGGG - Intronic
1114657353 14:24324077-24324099 CATGGCAAAGACAAGGAGGATGG + Exonic
1115214108 14:30997559-30997581 GAGGCTGAAGACAGGAAGGAGGG - Intronic
1115727336 14:36231672-36231694 CATGGGGCAGTGAGGGAGGAAGG + Intergenic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1116558690 14:46347590-46347612 GAGGGTGGAGAGAGGGAGGAGGG + Intergenic
1116635507 14:47389727-47389749 CAGGGTGAAAAAAGGGGGGAGGG + Intronic
1117619382 14:57568875-57568897 TATGGAGAAGAGAGGGATGAGGG + Intronic
1118101578 14:62610889-62610911 CAGGGAGAAGACTGGGAGGGTGG + Intergenic
1119041893 14:71282027-71282049 CCTGGGGAAGAGAGGGAGGTAGG - Intergenic
1119765918 14:77187567-77187589 CACGGAGCAGCCAGGGAGGAAGG + Intronic
1119956900 14:78808556-78808578 CCTGGTGAGGACTGGAAGGAGGG - Intronic
1120336101 14:83157065-83157087 AAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1120516951 14:85482098-85482120 CAAGGGGAAGAAAGGGAGCAGGG + Intergenic
1120769891 14:88367556-88367578 GAGGGTGGAGGCAGGGAGGAGGG - Intergenic
1121045593 14:90785407-90785429 CCTGGGGAAGACAGGCAGCATGG + Intronic
1121497404 14:94403423-94403445 CATGTTGAAGACCTTGAGGAGGG + Intergenic
1121620512 14:95344580-95344602 CAGGGTGGAAACAGGAAGGAGGG + Intergenic
1121752434 14:96368758-96368780 CATGGTGAAGGAAGGAAGGAGGG - Intronic
1121887642 14:97559273-97559295 CATGAAGGAGACAGGGAAGAAGG + Intergenic
1122693505 14:103542280-103542302 CCTGGGGAAGGCAGGGAGGCTGG + Intergenic
1122790706 14:104183065-104183087 CGGGGTCCAGACAGGGAGGACGG - Intergenic
1123121818 14:105920276-105920298 CAAGGTGTGAACAGGGAGGATGG - Intronic
1123147120 14:106142682-106142704 CATGGTGTGGACACTGAGGAAGG + Intergenic
1123149972 14:106171172-106171194 CATGGTGTGGACACCGAGGAAGG + Intergenic
1123168335 14:106347737-106347759 CTTGGGGAAGACTGGGAGAAAGG + Intergenic
1123223690 14:106879968-106879990 CATGGTGTGGACACTGAGGAAGG + Intergenic
1123404513 15:20011927-20011949 CAAGGTGTGAACAGGGAGGATGG - Intergenic
1123513846 15:21018574-21018596 CAAGGTGTGAACAGGGAGGATGG - Intergenic
1123583016 15:21732402-21732424 CATGGTGTGGACACTGAGGAAGG + Intergenic
1123619666 15:22174999-22175021 CATGGTGTGGACACTGAGGAAGG + Intergenic
1124051531 15:26201233-26201255 CTTGGTGAAGGCAGGGCGCATGG - Intergenic
1124422063 15:29531203-29531225 CCTTGAGAAGACAGGGAGGTAGG + Intronic
1124627092 15:31314419-31314441 CAGGGAGATGACAGGGATGATGG - Intergenic
1125040582 15:35181407-35181429 AATAGTGAACACAGGGAGGATGG - Intergenic
1125386687 15:39144423-39144445 GATGGTGAAGATAGTGAAGATGG - Intergenic
1125753768 15:42048589-42048611 CATGGGGATGACGGGGCGGAGGG + Intronic
1126429266 15:48563414-48563436 CAGGGAGCAGGCAGGGAGGAGGG + Intronic
1126748284 15:51849545-51849567 GATGGGGCAGTCAGGGAGGAAGG + Intronic
1127172974 15:56322855-56322877 CATGTTGAAGACAAGGTGGTGGG + Intronic
1127410747 15:58704044-58704066 CATGGAGCAGTGAGGGAGGAAGG + Intronic
1127687925 15:61366550-61366572 CAGGGTGAAGACTAGGATGAGGG + Intergenic
1128197812 15:65776010-65776032 CATGGAGAAAACAGTAAGGAAGG - Intronic
1128343365 15:66837895-66837917 CATGGTGGGGAGAGGGAGTATGG + Intergenic
1128378018 15:67091123-67091145 CATGGGCAGGGCAGGGAGGAAGG - Intronic
1128733129 15:70034273-70034295 AATGGTGCAGAGAGGGAGGCAGG + Intergenic
1128768737 15:70266528-70266550 TGCGGTGGAGACAGGGAGGAGGG - Intergenic
1129320244 15:74770760-74770782 CAAAGTGAGGACAGGTAGGAAGG - Intergenic
1129466559 15:75727464-75727486 CATGGTGAAAGCAGGGATGTGGG - Exonic
1129756910 15:78104247-78104269 CAGGGTCAGGGCAGGGAGGAGGG - Exonic
1130085785 15:80777827-80777849 CATGGTGAGGACTGGGGAGAGGG + Intergenic
1130205010 15:81867688-81867710 CATGGTGCAGAGAGGGTGGTTGG + Intergenic
1130885645 15:88090369-88090391 AATGCTGAAGAAAGGAAGGAAGG + Intronic
1131978520 15:97971534-97971556 CATGGTGAAGAGTGGAACGAAGG + Exonic
1132047305 15:98575194-98575216 GATGAAGAAGAGAGGGAGGAGGG - Intergenic
1132146158 15:99431286-99431308 GTTGGTGATGACAGGGATGAGGG - Intergenic
1132193572 15:99891728-99891750 TATATTGAAGGCAGGGAGGAAGG - Intergenic
1132340955 15:101078462-101078484 CAGGGTGCAGAGAGGAAGGAAGG - Intergenic
1132462572 16:62715-62737 CAGGGTGGACACAGGCAGGAAGG + Intronic
1132467713 16:85168-85190 CATGGTGCAGGCTTGGAGGATGG + Intronic
1132897142 16:2234459-2234481 CATGGTGGAGGCAGGGAAGGGGG - Intronic
1133507030 16:6422389-6422411 GAGGGGAAAGACAGGGAGGAGGG - Intronic
1133845765 16:9452355-9452377 CAGGGGGAAGGCAGGGAGTAGGG - Intergenic
1134647546 16:15882121-15882143 CATGGTGAAGGCAGGGGCCAAGG - Intronic
1134692038 16:16197493-16197515 CAGAGGGAAGAGAGGGAGGACGG + Intronic
1134777125 16:16863035-16863057 AGTGGTGGAGACAGGGAGGGAGG + Intergenic
1134819915 16:17238657-17238679 GATGCTGAAGACAAAGAGGAGGG - Intronic
1135084394 16:19463394-19463416 GAGGGTGAAAACAGGGAGGGAGG + Intronic
1135405197 16:22192562-22192584 CAGGGAGAAGAAAGAGAGGAAGG - Intergenic
1135671141 16:24376623-24376645 CATGGTGGGGAGAGGGAAGAAGG - Intergenic
1135732882 16:24909041-24909063 CACGGTGGAGACAGTGATGAGGG - Exonic
1136301353 16:29336445-29336467 CATGATGAGGACACGGTGGAGGG - Intergenic
1136353943 16:29731296-29731318 CATGGAGTAGTGAGGGAGGAAGG + Intergenic
1136871972 16:33815969-33815991 CATGGTGTGGACACTGAGGAAGG - Intergenic
1137023888 16:35454844-35454866 CATTGTGGTGACAAGGAGGATGG - Intergenic
1137275469 16:46930312-46930334 ACTGGGGAAGGCAGGGAGGATGG - Exonic
1137435058 16:48448136-48448158 CAAGCTGAACACAGGGAGGTGGG - Intronic
1137801040 16:51262205-51262227 CAGGAAGAAGACAGGGAGGAAGG - Intergenic
1137977316 16:53042514-53042536 AAAGATGAAGAAAGGGAGGAGGG - Intergenic
1138195823 16:55051458-55051480 CAGAAGGAAGACAGGGAGGAGGG + Intergenic
1138788619 16:59875386-59875408 TATGGTGGGGACAGGGAGTAAGG + Intergenic
1139263936 16:65622272-65622294 GATGTGGAAGAAAGGGAGGAGGG + Intergenic
1139325517 16:66149985-66150007 TATGGTCAAGACAGGGAAGAAGG - Intergenic
1139329534 16:66176642-66176664 CATGATGAAGTGATGGAGGAAGG + Intergenic
1139332654 16:66205539-66205561 AAGGGGGAAGACAGGCAGGAGGG + Intergenic
1140188855 16:72797336-72797358 CATGGGGAAGTGAGGAAGGAGGG + Exonic
1140754217 16:78053124-78053146 AGTGGTGAAGACAGGGAGGGGGG - Intronic
1141563430 16:84885432-84885454 CCTGGTTCAGACAGGGAGGCCGG + Intronic
1141867834 16:86762885-86762907 TTTTGTGCAGACAGGGAGGAAGG + Intergenic
1142076567 16:88121217-88121239 CATGGTGAAGGGGGGGAGGTTGG + Intergenic
1203094614 16_KI270728v1_random:1243417-1243439 CATGGTGTGGACACTGAGGAAGG - Intergenic
1203100200 16_KI270728v1_random:1300099-1300121 CATGGTGTGGACACTGAGGAAGG + Intergenic
1142766560 17:2067684-2067706 GAGGGTGGAGGCAGGGAGGAGGG + Intronic
1142822908 17:2486135-2486157 CAAGGTGAAGCTGGGGAGGAAGG + Intronic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1143092807 17:4459035-4459057 CATGGAGAAGGGAGTGAGGATGG - Intronic
1143102910 17:4514025-4514047 CATGGGGAAGGCAGGGACAAGGG - Intronic
1143260410 17:5594443-5594465 CAAGGCTAAGATAGGGAGGAGGG + Intronic
1143910634 17:10245917-10245939 CATGGTGGAGAGAGGGATGGAGG + Intergenic
1144443560 17:15305631-15305653 CCTGTTGAAGCCAGGGAGGGTGG - Intronic
1145016275 17:19400425-19400447 GAGGGTGAGGACAGGAAGGAAGG - Intergenic
1146643634 17:34561546-34561568 CATGGTGATGACAATGATGATGG + Intergenic
1146916636 17:36682290-36682312 CATGGAGCAGTGAGGGAGGACGG - Intergenic
1147498753 17:40942321-40942343 GAGGGGGAAGAGAGGGAGGAGGG - Intergenic
1147843222 17:43387425-43387447 GACGGTGATGGCAGGGAGGAAGG - Intergenic
1147911876 17:43860951-43860973 CTTGGACAAGACAGGAAGGAAGG + Intronic
1148747971 17:49928977-49928999 CATGCTGAGGACAGTGTGGAGGG - Intergenic
1148774493 17:50087979-50088001 GGTGGAGAGGACAGGGAGGAAGG - Intronic
1148810181 17:50285340-50285362 CCCTGTGAAGACTGGGAGGAGGG - Intergenic
1148841199 17:50498415-50498437 CTTGGTGGGGACTGGGAGGAGGG - Intergenic
1149117076 17:53110378-53110400 GATGGTGAAGACTGGCAGAAGGG + Intergenic
1149509970 17:57232297-57232319 CAGGGTGAGGAGAGGCAGGATGG + Intergenic
1149523807 17:57338805-57338827 GTAGGTGAAGACAGGGAGGCAGG - Intronic
1150225179 17:63520772-63520794 GATGGGGAGGACAGGAAGGAGGG + Intronic
1150645770 17:66976608-66976630 GAAGATGAAGGCAGGGAGGAGGG - Intronic
1150706955 17:67495524-67495546 GATGGTGGAGAGTGGGAGGAAGG - Intronic
1150750085 17:67853362-67853384 CAAGGTGAAGACAGAAAGGAAGG - Intronic
1151445962 17:74164205-74164227 CATGGGGAAGTCAGGGTAGAGGG - Intergenic
1152114849 17:78379062-78379084 CACGGTGTAGACGGGGAGCAAGG - Intronic
1152795630 17:82304712-82304734 CATGGGGAAGAGAGGAAGGGAGG - Intergenic
1153977200 18:10280073-10280095 GATGGAGAAGAAAGGGAGGGAGG - Intergenic
1155389755 18:25322382-25322404 CATGGTGGGGAAAGGGAAGAAGG - Intronic
1157319061 18:46620335-46620357 TCTGGTGAAGCCAGGGAGGGTGG + Intronic
1157995905 18:52555584-52555606 TATAGTGAAGACTGGGAGCATGG + Intronic
1158082893 18:53615422-53615444 CATGGCTAATACAGGGAGGAAGG - Intergenic
1158105659 18:53882633-53882655 CATGCTGGAGCCAGGGAGGCTGG - Intergenic
1158669742 18:59464088-59464110 CATGGTGGAGACAGTGGGGGAGG - Intronic
1158729010 18:60002609-60002631 CCTGAAGAAGACAGGGAGAATGG - Intergenic
1158886981 18:61837939-61837961 CTTGGTGAAGACAGGAGGGCAGG - Intronic
1159231517 18:65613308-65613330 GAAAGGGAAGACAGGGAGGAGGG + Intergenic
1159325969 18:66918312-66918334 GAAGGTGAAGAAAGGGAGGAAGG - Intergenic
1159987304 18:74858197-74858219 CATGAGGAAGGCAGGCAGGAAGG - Intronic
1160263268 18:77315599-77315621 CAGGGTGCAGGCTGGGAGGAGGG - Intergenic
1160758788 19:772121-772143 AAGGGGGGAGACAGGGAGGAGGG - Intergenic
1160854376 19:1209793-1209815 CTTGGTGGAGACAGGCAAGAAGG + Intronic
1160959852 19:1715664-1715686 CCTGGGGGAGGCAGGGAGGAGGG - Intergenic
1161302822 19:3551249-3551271 CAGGGTGAGGACATGGAGGGAGG + Intronic
1161431281 19:4233687-4233709 CAAGGGGGAGACAGGGAGGAGGG - Intronic
1161501034 19:4615815-4615837 CGAGGCGAAGAGAGGGAGGAGGG - Intergenic
1161604760 19:5208451-5208473 GGGGGTGAAGATAGGGAGGATGG - Intronic
1161644504 19:5444725-5444747 CAAGGGGGAGACAGGGAGGAGGG - Intergenic
1161664214 19:5565143-5565165 CAAGGGGGAGAGAGGGAGGAAGG - Intergenic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1162085614 19:8247254-8247276 CAAGGGGGAGAGAGGGAGGAGGG - Intronic
1162240446 19:9348876-9348898 CTTGGTGGAGACAGAGAGGCCGG - Intronic
1162536118 19:11263566-11263588 CATGCTGTAGACTGGGAGCACGG - Intergenic
1163076137 19:14893419-14893441 CATAATGAAGACAGGGTGGAGGG + Intergenic
1163591709 19:18197427-18197449 GGTGGGGAAGACAGGGAAGAGGG + Exonic
1163913295 19:20215578-20215600 CATGGTGAAGTCACTGAGGGTGG + Intergenic
1165072785 19:33265210-33265232 CATGGTTCACACAGGGAGCATGG + Intergenic
1165466592 19:35978527-35978549 CGTGGTGAAGTGAGGGAGGAGGG - Intergenic
1166856271 19:45783965-45783987 CATGCTGGGGACAGGGATGAGGG + Exonic
1166875357 19:45893633-45893655 CTGGGGGAAGACAGGGAAGATGG + Intronic
1166985882 19:46659857-46659879 CGAGGTGCAGACAGGCAGGAAGG + Intronic
1167033228 19:46977456-46977478 CCAGCTGAAGAGAGGGAGGAAGG - Intronic
1167116698 19:47492796-47492818 CAGGCTGAAGACAGGGTGGGGGG + Intronic
1167189220 19:47972431-47972453 GATGGTGGAGAGTGGGAGGAGGG - Intronic
1168460771 19:56555369-56555391 TATGGTGATGGGAGGGAGGATGG - Exonic
925001992 2:410369-410391 GATGGTGTGGACAGTGAGGATGG - Intergenic
925084248 2:1095034-1095056 CATGGTAGAGACAGCGAGGTGGG + Intronic
925618736 2:5769243-5769265 CATGGGGAAGTCAAGGAGGGAGG + Intergenic
925646861 2:6044820-6044842 CCTGGTGAAGAGTGGGAGGTGGG - Intergenic
925693509 2:6549579-6549601 CAGGAGGAAGAGAGGGAGGAAGG - Intergenic
926037302 2:9645787-9645809 CATGATGCAGGGAGGGAGGAGGG - Intergenic
926057492 2:9783006-9783028 CATGATGAAGCTAGTGAGGAAGG + Intergenic
926132400 2:10312216-10312238 GATGGTGATGACAGTGATGATGG - Intronic
926147587 2:10406066-10406088 CATGTTGATGACAGCAAGGAGGG - Intronic
926215823 2:10904799-10904821 CGTGGTGAAGACAGAGAGCAAGG + Intergenic
926235463 2:11039880-11039902 CATGGAGGAGGCAGGGAGGGAGG - Intergenic
926667852 2:15544352-15544374 AATGGTGAAGGGAGGGAGGAAGG + Intronic
926690686 2:15731285-15731307 CATGGGTAAGACAGGCTGGAGGG - Intronic
926877538 2:17498886-17498908 GAAGGTGAAGAGTGGGAGGAAGG - Intergenic
926965083 2:18401103-18401125 CGGGATGAAGACAGGGAGTATGG + Intergenic
927023155 2:19038712-19038734 CATAGGGAAGACAGAGAGGAAGG - Intergenic
927295853 2:21452384-21452406 CAGGGTGAATACAGGGAAGTGGG - Intergenic
927482356 2:23464435-23464457 CCTGTGGGAGACAGGGAGGAGGG - Intronic
928608381 2:32965482-32965504 CAGGGTTTAGACAGGAAGGAGGG - Intronic
928910694 2:36417936-36417958 AATGGAGAAGAAAGGCAGGAGGG + Intronic
928994844 2:37277892-37277914 AATGGTGAAGGAAGGGTGGATGG - Exonic
929059941 2:37913885-37913907 GAAGGTGAAGACAGTGAAGATGG - Intergenic
929135645 2:38621429-38621451 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
929586061 2:43115203-43115225 CCAGGTGAAGATGGGGAGGAAGG - Intergenic
929960605 2:46493424-46493446 CATGGTGAAGATGGGAAGGAGGG - Intronic
932275896 2:70452108-70452130 CATGGAGAGGGTAGGGAGGAAGG - Intronic
932323536 2:70839072-70839094 GAAGGAGAAGAGAGGGAGGAGGG + Intergenic
932667766 2:73710723-73710745 CAGGGTGGAGAGTGGGAGGAGGG + Intergenic
932766246 2:74472330-74472352 CTTGGTGGAGACGGGCAGGAGGG - Intronic
933109896 2:78383931-78383953 CATGCTGAAAACTGGTAGGATGG - Intergenic
933589699 2:84218591-84218613 CATGATACAGATAGGGAGGAAGG + Intergenic
933685692 2:85139726-85139748 GAGAGTGAAGACATGGAGGAAGG + Intronic
934518644 2:95005626-95005648 CATGCTGATGACAGAGAGGAAGG + Intergenic
934753081 2:96806700-96806722 AATTGTGAAGACATGCAGGATGG - Intronic
934767268 2:96886654-96886676 CCTGGCAAAGACAGGGAAGAAGG + Intronic
935580347 2:104750739-104750761 CAGGGTGAAGACAGGGAGGTGGG - Intergenic
935814834 2:106837921-106837943 CATGGAGAGGGCAGGGAGGCAGG + Intronic
936252545 2:110877764-110877786 GAGGGTGAAGACAGAGAGGAAGG + Intronic
936921164 2:117690164-117690186 CAGGGTGGAGGCTGGGAGGAGGG + Intergenic
936960037 2:118063258-118063280 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
937756313 2:125542901-125542923 CAATGTGAAGACAGGAAGGCTGG - Intergenic
937825380 2:126363538-126363560 CATGGCAGAGGCAGGGAGGAAGG - Intergenic
937986179 2:127639115-127639137 CATGGGGAAGGCAGAGATGAGGG + Exonic
938285882 2:130116494-130116516 CAGGGTGAAGGGTGGGAGGAGGG - Intronic
938429723 2:131222408-131222430 CAGGGTGAAGGGTGGGAGGAGGG + Intronic
938670079 2:133578241-133578263 GATGCTGAAGAAAGGGAGGGTGG - Intergenic
938932690 2:136100584-136100606 CACGCTGAACACAGGGATGAAGG + Intergenic
939754247 2:146090056-146090078 CAGGGTGAAGGAAGGGAGAAGGG - Intergenic
940041109 2:149361867-149361889 CATGGTGGAGAAAGGCAGGAGGG + Intronic
940206958 2:151213643-151213665 CATACTGAAGGCAGGGAAGAAGG - Intergenic
940738076 2:157476148-157476170 GAGGGTGGAGACGGGGAGGAGGG + Intronic
941318690 2:164027324-164027346 CAGGATGAAGAAAAGGAGGATGG + Intergenic
942202805 2:173589126-173589148 CATGATGAGGACAGGCAGGGTGG - Intergenic
942620420 2:177839158-177839180 CATGGTGATGGCAGGGAGGCTGG - Intronic
942728176 2:179033559-179033581 CATATTGAAGACTGGGAGTAGGG + Intronic
944049997 2:195456953-195456975 CATAGTGCATGCAGGGAGGAGGG - Intergenic
944094058 2:195946726-195946748 CCGGGTGAAGAGAAGGAGGAAGG - Intronic
944118426 2:196213661-196213683 CATAGTGAAGACAGGGAGAAAGG + Intronic
944997198 2:205307083-205307105 CTTGGTGAGGAAAGGGAGGCAGG - Intronic
945846490 2:214951250-214951272 TATAGTGAATACAGTGAGGAGGG - Intronic
946045304 2:216816071-216816093 CATGAGGAAGACAGGAAGGGAGG - Intergenic
946178273 2:217935170-217935192 CAGGGTGAGGAGGGGGAGGAAGG + Intronic
946396549 2:219446245-219446267 CCTGGTAAAGAAAGGCAGGAAGG - Intronic
946588574 2:221218081-221218103 CATGATGACCACAGGGACGAAGG + Intergenic
946716224 2:222556942-222556964 CAGGGAGAAGTCAGGGTGGATGG - Intronic
947584447 2:231344986-231345008 CACGGGGAAGACAAGGCGGAAGG + Exonic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947927844 2:233937319-233937341 GATGGTGTGGACAGGAAGGAAGG - Intronic
948027604 2:234790360-234790382 GAAGGTGAGGAGAGGGAGGAAGG + Intergenic
948087714 2:235265480-235265502 CAGGGTGAAGACAGGGAGGCTGG - Intergenic
948260923 2:236603960-236603982 CTTGGAGAAAGCAGGGAGGAAGG + Intergenic
948666356 2:239536995-239537017 CATGGTGCAGGCAGGCAGGCAGG - Intergenic
1168866279 20:1089738-1089760 AATGGAGCAGACAGGGAGGAAGG + Intergenic
1168987899 20:2066148-2066170 CATGTTCCAGACAGGGAGAATGG + Intergenic
1169247883 20:4038193-4038215 CTTGGAGAAGACAGGGGGGTGGG + Intergenic
1169378157 20:5083999-5084021 GATGGTGGAGAGTGGGAGGAGGG - Intronic
1170572599 20:17640959-17640981 GATGGAGAAGGCAGGGAGGCAGG + Intronic
1170586587 20:17739429-17739451 CATGGGGAATGCAGGGAGAAGGG - Intergenic
1170652405 20:18254899-18254921 CATTGTGAAGAAAAGGAGTAGGG + Intergenic
1170801730 20:19595994-19596016 CCTGGTGAAGAAGGGGAGTATGG + Intronic
1170833606 20:19864463-19864485 TTTGGTGAAGTCAGGAAGGAAGG - Intergenic
1170853126 20:20021948-20021970 GATGGTGGGGACAGGGAGGTGGG + Intronic
1170856542 20:20061702-20061724 CATGGGGAACACAGGGAGGCGGG - Intronic
1170864736 20:20143199-20143221 CCTCCTGAAGTCAGGGAGGAAGG - Intronic
1171156316 20:22877933-22877955 AATGGTGAACACAAGAAGGAGGG - Intergenic
1171291996 20:23987685-23987707 CAAGGAGGAGACAGAGAGGATGG + Intronic
1171540853 20:25954419-25954441 AATGGTGAAAACAAAGAGGAGGG - Intergenic
1171795087 20:29560268-29560290 AATGGTGATGACAGGGGGCAGGG - Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172283915 20:33727788-33727810 CATGTTAGAGACAGGGAGGAAGG + Intergenic
1172852303 20:37975371-37975393 CATGGAGTGGAGAGGGAGGAAGG + Intergenic
1173001852 20:39110587-39110609 CATGGTGCGAGCAGGGAGGAAGG - Intergenic
1173517309 20:43673908-43673930 CATGGGGAAGAGAGGGTTGATGG + Intronic
1173624460 20:44462084-44462106 AAGGCTGAAGACAGGCAGGAGGG + Exonic
1174205808 20:48837667-48837689 GAGGGTGAAGATTGGGAGGAGGG + Intergenic
1174318061 20:49718184-49718206 CAGAGTGAGGGCAGGGAGGAAGG - Intergenic
1174466695 20:50723295-50723317 CAAGGTGAGGACAGTGAGGCAGG - Intergenic
1174747316 20:53076262-53076284 GATGATGGAGACAGGAAGGAAGG + Intronic
1175099244 20:56566638-56566660 CTTGCTGAATCCAGGGAGGAGGG + Intergenic
1175196177 20:57244783-57244805 CCTGGGGAAGGGAGGGAGGACGG - Intronic
1175672317 20:60915544-60915566 CCTGGGGAGGGCAGGGAGGAGGG - Intergenic
1175906242 20:62380965-62380987 CATGGTGAAGACAGGCAGAGGGG - Intergenic
1175928210 20:62481088-62481110 CAGGGTGGAGACTGGGGGGAGGG - Intergenic
1175940431 20:62535235-62535257 CATGGGGAAGAAATGCAGGAGGG + Intergenic
1176113840 20:63422543-63422565 CATGGGGAAGAGACGGGGGAGGG + Intronic
1176361028 21:5996472-5996494 CTTGGTGAAGACAGAATGGAGGG - Intergenic
1177904508 21:26959123-26959145 CAAGTTGGAGACAGGGAGCAGGG + Intronic
1177940307 21:27402152-27402174 GATGGTGGAGATTGGGAGGAGGG - Intergenic
1177956597 21:27606235-27606257 CATGCTGGAGCCAGGGAGGCTGG - Intergenic
1178016745 21:28355542-28355564 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1178210247 21:30522558-30522580 GAAGGTGAAGAATGGGAGGAGGG + Intergenic
1178237576 21:30860430-30860452 CATATAGAAGACAGTGAGGATGG + Intergenic
1178929229 21:36803087-36803109 CATGGTGACAACCGGGTGGATGG + Intronic
1179762490 21:43542078-43542100 CTTGGTGAAGACAGAATGGAGGG + Intronic
1179874838 21:44262358-44262380 AAGGGTGAAGAAAGGGATGAGGG + Intergenic
1180104272 21:45607627-45607649 AATGGAGGAGAAAGGGAGGAGGG + Intergenic
1180712821 22:17851275-17851297 GCAGGTGAAGACAGGAAGGATGG + Intronic
1180820320 22:18822692-18822714 CAAGGTGACGGCAGAGAGGATGG + Intergenic
1181415004 22:22753073-22753095 CAAGGTGAGCACTGGGAGGACGG + Intronic
1181495356 22:23284490-23284512 CTGGGTGAACCCAGGGAGGAGGG - Intronic
1182266512 22:29120044-29120066 GATGATGGAAACAGGGAGGAGGG + Intronic
1182266531 22:29120127-29120149 GATGATGGAAACAGGGAGGAGGG + Intronic
1182266570 22:29120295-29120317 GATGATGGAAACAGGGAGGAGGG + Intronic
1182266577 22:29120324-29120346 GATGATGGAAACAGGGAGGAGGG + Intronic
1182266604 22:29120438-29120460 GATGATGGAAACAGGGAGGAGGG + Intronic
1182266609 22:29120467-29120489 GATGATGGAAACAGGGAGGAAGG + Intronic
1182705965 22:32280562-32280584 CATAGGGAAGAGAGGGAGGGAGG - Intergenic
1183570544 22:38650048-38650070 AATGGTGAAGACTGTGAGGAAGG - Exonic
1183722469 22:39570710-39570732 CCTGGGGAAGACAGAGAGGGTGG - Intergenic
1183977319 22:41520131-41520153 CAAGGAGAAGAAAGAGAGGAGGG - Intronic
1184036521 22:41920683-41920705 GCTGGTGAGGCCAGGGAGGAAGG - Intergenic
1184468475 22:44682554-44682576 CCTGGTGAAGACATGGAGGCCGG + Intronic
1184490322 22:44804544-44804566 CCTTGTGAGGACAGGGAGCACGG + Intronic
1184916887 22:47575427-47575449 CAAGGGAAGGACAGGGAGGAGGG - Intergenic
1184995018 22:48199213-48199235 CCTGGGGAAGACAGTGAGGGAGG + Intergenic
1185129628 22:49031820-49031842 TAGAGGGAAGACAGGGAGGAAGG - Intergenic
1185250630 22:49799850-49799872 CATGGTGAGGACAGGGCTGAGGG - Intronic
1203220375 22_KI270731v1_random:38259-38281 CAAGGTGACGGCAGAGAGGATGG - Intergenic
1203270450 22_KI270734v1_random:48567-48589 CAAGGTGACGGCAGAGAGGATGG + Intergenic
949596621 3:5554623-5554645 GAGGGTGAAGGCTGGGAGGAGGG + Intergenic
949789238 3:7774695-7774717 CATGTTTAAGAGAGGGTGGATGG + Intergenic
949838756 3:8297637-8297659 CATGGCAAAGAGAGGGAGGGGGG + Intergenic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
950677521 3:14563623-14563645 GAGGGAGAAGGCAGGGAGGAGGG + Intergenic
950692574 3:14671924-14671946 CATGGGGGCGACAGGGAGGTGGG - Exonic
952422276 3:33143003-33143025 CATGAGGAAGACAGGGATGAAGG - Exonic
952546362 3:34423962-34423984 AACAGTGAAGACAGGGATGATGG - Intergenic
952687513 3:36167290-36167312 GAGGGTGAAGAATGGGAGGAGGG - Intergenic
953565945 3:44032211-44032233 CATGATCAATATAGGGAGGAGGG + Intergenic
953695923 3:45159133-45159155 GAGGGTGAAGAATGGGAGGAGGG - Intergenic
954495477 3:50955680-50955702 GAGGGTGAAGAGTGGGAGGAAGG + Intronic
954698943 3:52441779-52441801 CAGGGTGAGAACAGGGAGGGTGG - Intronic
954797563 3:53169243-53169265 TGTGGTGAAGCCAGGGAGGCAGG + Intronic
954797659 3:53169670-53169692 CATTGTTGAGACAGGGAGGCTGG + Intronic
955029953 3:55206298-55206320 CATGTGTAAGAAAGGGAGGAGGG - Intergenic
955946290 3:64197698-64197720 CAGAGTGAAGGCTGGGAGGAGGG + Intronic
956050102 3:65238605-65238627 TGGGGTGAAGACAGGGAGGGAGG - Intergenic
956883112 3:73531346-73531368 CGTGGAGAAGCCAGGGAGAAAGG - Intronic
957201853 3:77146278-77146300 GAGGGTGGAGAGAGGGAGGAAGG + Intronic
959438918 3:106352457-106352479 GAGGGTGAAGAATGGGAGGAAGG - Intergenic
959526382 3:107381904-107381926 GAAGGTGAGGACAGGGAGGGTGG - Intergenic
961537810 3:127580526-127580548 CACGGAGAGGACAGGAAGGAAGG - Intronic
961631131 3:128299618-128299640 CATGGGGAAGGCCTGGAGGAAGG + Intronic
961910261 3:130307603-130307625 CAGGGAGAAGAATGGGAGGAGGG + Intergenic
963263554 3:143216717-143216739 AATGATGAAGGAAGGGAGGAGGG - Intergenic
963860779 3:150308154-150308176 GTTGGTGGAGGCAGGGAGGAGGG + Intergenic
964419197 3:156483469-156483491 CATGCTGAACACAGATAGGAGGG - Intronic
964526022 3:157616044-157616066 CCTGATGGAGACAGGGAGGAAGG + Intronic
964776928 3:160289301-160289323 GAGGGTGAAGAGTGGGAGGAGGG + Intronic
966216018 3:177503439-177503461 CATGGGGCAGTGAGGGAGGAAGG + Intergenic
967963885 3:194945560-194945582 CAAGGAGAAGAGAGGGGGGAAGG + Intergenic
968076380 3:195817844-195817866 CATGGTGAAAGCAGGGAGGTGGG + Intergenic
968336444 3:197917703-197917725 AATGGGGAAGACAGGGGAGAAGG - Intronic
968829521 4:2925663-2925685 CAGGGAGAAGGCAGGGAGGGAGG + Intronic
969101997 4:4776413-4776435 CCTGGGGAACACAGGAAGGAAGG - Intergenic
969256380 4:6004754-6004776 GATGGTGATGACAGTGATGACGG + Intergenic
969326025 4:6444310-6444332 CCTGGTGGAGACAGGGATGGAGG + Intronic
969616501 4:8255957-8255979 CAGGGGGAGGACAGGGAGGCAGG - Intergenic
970581454 4:17477608-17477630 CCTGGTAGAGAAAGGGAGGATGG - Intronic
971097396 4:23423419-23423441 CAGGCAGAAGACAGTGAGGATGG + Intergenic
971236147 4:24844128-24844150 TATGATGAAGACAGAGAGGCAGG - Intronic
971769845 4:30882158-30882180 GAAGGGGAAGAGAGGGAGGAAGG - Intronic
972020936 4:34313196-34313218 CATGGCTAAGAGAGGGAGAAAGG + Intergenic
973377018 4:49293606-49293628 CATGGTGAGGACAGGGAAATGGG + Intergenic
973647218 4:52961749-52961771 CATGCACAAGACAGGAAGGAGGG + Intronic
973709081 4:53608958-53608980 GAGGGTGGAGAAAGGGAGGAGGG + Intronic
974454207 4:62105262-62105284 CAGGGTGAAGGGTGGGAGGAGGG - Intergenic
974570176 4:63635629-63635651 AAGGGTGAAGAGTGGGAGGAGGG + Intergenic
977368492 4:96102964-96102986 CATGATTAAGGAAGGGAGGAAGG - Intergenic
977651562 4:99475820-99475842 CAGGGTGGAGAGTGGGAGGAAGG - Intergenic
977655400 4:99515545-99515567 GAGGGTGGAGACTGGGAGGAGGG + Intronic
978688382 4:111477429-111477451 GATGGTGACGAGAGGTAGGAAGG - Intergenic
978837090 4:113163978-113164000 CATGGGGAGGACAAGGGGGAGGG - Intronic
979533143 4:121790524-121790546 CATGGTGGAGACATGGGGCAGGG - Intergenic
979586108 4:122419378-122419400 GATGGTGGAGAGTGGGAGGAGGG + Intronic
980707480 4:136519154-136519176 CATGGTGACGAGAGGGAGAGGGG + Intergenic
981237540 4:142436062-142436084 CCTGCTGAAGCCAGGGAGGCTGG + Intronic
981480825 4:145237504-145237526 CATGGTTAAGGCATGGGGGAAGG + Intergenic
981605895 4:146539887-146539909 GAAGGTGAAGGCTGGGAGGAGGG - Intergenic
981692568 4:147526044-147526066 AATAGTGAAGACACAGAGGAAGG + Intronic
981878291 4:149576294-149576316 CAGGGTGGAGAGTGGGAGGAGGG - Intergenic
982473951 4:155827323-155827345 CATGAAGAAGACAGGATGGAGGG + Intergenic
982659191 4:158186736-158186758 TATGGTAAGGACAGGGATGATGG - Intergenic
982861224 4:160451847-160451869 CATGGTAGAGACAGAAAGGAAGG + Intergenic
983252513 4:165360761-165360783 AATAGTGAAGACAGGGTGGCAGG - Intergenic
983279887 4:165667039-165667061 CAGGAGGAAGACAGGAAGGAAGG + Intergenic
983875073 4:172866052-172866074 CAAGGTGAAGGCAGTAAGGATGG - Intronic
984050994 4:174865113-174865135 CATGGAGAACACAAGGAGAAAGG + Intronic
984487462 4:180388985-180389007 GACAGTGAAGACAGAGAGGAAGG + Intergenic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985626485 5:991588-991610 CATGGTGAGCTCAGGGAGGTGGG + Intergenic
986174053 5:5336963-5336985 CATGGGCAGCACAGGGAGGAGGG + Intergenic
986285522 5:6355657-6355679 CATGGGGCAGACAGGAAAGAAGG - Intergenic
986347490 5:6848352-6848374 CATGGAGCAGTGAGGGAGGAAGG + Intergenic
986831821 5:11588883-11588905 CGTGGTGCAGGGAGGGAGGAGGG - Intronic
988195041 5:27993967-27993989 CAAAATGAAGCCAGGGAGGATGG + Intergenic
988339247 5:29948916-29948938 CATGGAGCAGTGAGGGAGGAAGG - Intergenic
988737587 5:34038267-34038289 TAAGGTGAGCACAGGGAGGATGG + Intronic
989108202 5:37883126-37883148 TAGGATGAAGAGAGGGAGGAAGG + Intergenic
989303342 5:39920795-39920817 CATGGTGAAGCCAGGCATGGTGG + Intergenic
989596131 5:43157869-43157891 CATTATGAAGACAGAGAAGATGG - Intronic
990109022 5:52300373-52300395 AATAGTAAATACAGGGAGGAAGG + Intergenic
990295660 5:54399031-54399053 AATAGTGAACAGAGGGAGGAAGG - Intergenic
990998782 5:61761093-61761115 GAGGGTGAAGGGAGGGAGGAGGG + Intergenic
991147843 5:63327935-63327957 CCTGGAGAAGGCAGTGAGGAAGG - Intergenic
991360038 5:65810456-65810478 CATGATGCATACAGGGAGGGAGG - Intronic
991572240 5:68067301-68067323 AATTGTGAAGACAGGGAGAAGGG + Intergenic
993493118 5:88576328-88576350 CATTTTGAAGAAAGAGAGGAGGG - Intergenic
993551991 5:89284630-89284652 GGTGGTGATGACAGAGAGGAGGG - Intergenic
993823779 5:92655404-92655426 CATGGAGAATAAAGGGAAGAGGG - Intergenic
994190598 5:96865158-96865180 CATTTAGAAGACAAGGAGGATGG - Intronic
994513088 5:100733146-100733168 CATGGAGCAGTGAGGGAGGAAGG - Intergenic
994635052 5:102334470-102334492 GAAGGAGAAGACAGGGAGAAAGG + Intergenic
995349388 5:111157535-111157557 CATGCTAAAGACAGGAAGGTAGG - Intergenic
995549753 5:113269084-113269106 GATGGAGAAGACAGGGATGAAGG + Intronic
996189014 5:120515489-120515511 ACTGGTGAAGAAAGGGATGATGG + Intronic
996635099 5:125679597-125679619 CATGTTAAAGACAAGGAGTATGG + Intergenic
997238266 5:132288112-132288134 CATGATGTCGGCAGGGAGGATGG + Intronic
997341030 5:133144735-133144757 CTTGGTCAACACAGTGAGGAGGG + Intergenic
997427261 5:133811887-133811909 CCAAGTGAAGACAAGGAGGAGGG - Intergenic
997511365 5:134457011-134457033 GATGGTGATGACAGTGACGATGG + Intergenic
997667286 5:135641821-135641843 CATGGTGATGAAGGGGATGATGG - Intergenic
998207210 5:140166434-140166456 TAGGGTGCAGACAGGGAGGCAGG + Intergenic
998220448 5:140273823-140273845 CATGTTGGAGACAGAGGGGAAGG + Intronic
999045163 5:148459332-148459354 CATGCTTCTGACAGGGAGGAGGG + Intronic
999253251 5:150195107-150195129 CCTGGGGATGAGAGGGAGGAAGG - Intronic
999378501 5:151103692-151103714 CCTGGTGGAGCCAGGCAGGAGGG + Exonic
999475907 5:151898712-151898734 CAGATTGAAGACAGGGAGGTGGG + Intronic
999546196 5:152631233-152631255 CATCTTCATGACAGGGAGGATGG - Intergenic
999652641 5:153782767-153782789 CAGGCGGAAGACGGGGAGGAAGG + Intronic
1001298956 5:170519722-170519744 CAAAGTCAAGAAAGGGAGGAAGG + Intronic
1001311349 5:170613103-170613125 CCAGGTGGAGACAGGGTGGAAGG - Intronic
1001494031 5:172175380-172175402 TATGGTGGAGAGAGGGAGAAGGG + Intronic
1001785334 5:174407688-174407710 CATGGTAAAGAGAGGAAGAAGGG - Intergenic
1001938786 5:175726812-175726834 AAGGTGGAAGACAGGGAGGAGGG + Intergenic
1002075590 5:176706386-176706408 CAAGGTGCAGACTAGGAGGATGG + Intergenic
1002316418 5:178347092-178347114 CGCGGTGAGGACAGGGAGGGAGG - Intronic
1002642429 5:180636572-180636594 GATGGTGAAGTCATGGAGAAGGG - Intronic
1002950978 6:1810648-1810670 CAGGGAACAGACAGGGAGGAGGG + Intronic
1003172665 6:3732656-3732678 CACGGTGAGGACAGTCAGGATGG - Intronic
1003337441 6:5187228-5187250 CAGGGTGAAGACAGGGTGGCTGG + Intronic
1003532223 6:6947162-6947184 CATTGTGAAGACAAGGATGAAGG + Intergenic
1003661556 6:8067024-8067046 CAGGGTGGGGACAGGGAGGAAGG - Intronic
1004057832 6:12158825-12158847 CCTGGTGGAGACAGGGGAGATGG + Intronic
1005123164 6:22413379-22413401 CAGGGTGAAGGCATGGAGGGTGG + Intergenic
1005943276 6:30577413-30577435 AGTGGTGAAGAAAGGGAAGAAGG + Exonic
1006389858 6:33751872-33751894 CCTGGAGAAGGCTGGGAGGAGGG + Intergenic
1006900431 6:37497008-37497030 GATGGTGAAGCCACAGAGGAAGG + Intronic
1006902241 6:37510727-37510749 CATGGTGTGCACAGGGAGGAGGG + Intergenic
1007220584 6:40275769-40275791 CAGGGTAAAGAAAGGGAGTAGGG - Intergenic
1007494995 6:42253709-42253731 CCTTGTGATGACAGGCAGGAAGG + Intronic
1007967265 6:46014804-46014826 CCTGATGCAGACAGGGATGAAGG - Intronic
1008808490 6:55462324-55462346 CATGGTGAGCATAGGAAGGAAGG - Intronic
1009815918 6:68734610-68734632 TATTGTGAACACTGGGAGGATGG + Intronic
1009938357 6:70260003-70260025 CAAGGCAAAGACAGGGAGGATGG - Intronic
1009946473 6:70347156-70347178 CTTGGTGAAGAGGGGGTGGAAGG + Intergenic
1010192693 6:73209907-73209929 AATGGAGAAGACAAGGATGAAGG + Exonic
1011390483 6:86847009-86847031 CATGATGAAGACAGAGACCAGGG + Intergenic
1012494410 6:99818749-99818771 CATGGTGATGGCAGGCATGATGG + Intergenic
1012988867 6:105904460-105904482 CATGGAGCAGTGAGGGAGGAAGG - Intergenic
1013015195 6:106154691-106154713 CATGGAGGGGAAAGGGAGGATGG + Intergenic
1013464517 6:110406095-110406117 CATGGTGAAGATATGGAAGAGGG - Intronic
1013686891 6:112595441-112595463 CAAGGTAAAGACAGGCAGTAAGG - Intergenic
1013964990 6:115944868-115944890 GAGGGTGAAGGTAGGGAGGAAGG - Intronic
1015121953 6:129709801-129709823 ACTGGTGAAGACAGAGAAGAAGG - Intronic
1015536432 6:134271754-134271776 GAGGGTGAAGAGTGGGAGGAGGG - Intronic
1015695660 6:135977049-135977071 CCTGGTCAACACAGGGAGGGAGG + Intronic
1015763073 6:136685882-136685904 CAAGGTGCTCACAGGGAGGAGGG - Intronic
1015836636 6:137427051-137427073 CATGGAGAAGTCAGGAAGGCCGG + Intergenic
1016320527 6:142839640-142839662 CCTGGTGAACTCAGGGAGCATGG - Intronic
1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG + Intronic
1017007176 6:150036439-150036461 CATGGTGAACACAGTGAGCCTGG - Intergenic
1017787617 6:157769529-157769551 CCAGGGGAAGACAGAGAGGAAGG + Intronic
1017816301 6:158018947-158018969 CATGGTGATGACCGTGAGGATGG + Intronic
1018699728 6:166416790-166416812 GATGGTGAAGGCATGGTGGAGGG - Intronic
1019353474 7:566447-566469 CATGGTGAAGATGGTGATGATGG - Intronic
1019410696 7:905325-905347 CATGGAGGAGACAGGGAGATAGG + Intronic
1021588630 7:22237048-22237070 CCTGGTGAAGGCAGGGACAAGGG - Intronic
1021889932 7:25177950-25177972 GAGGGTGGAGAGAGGGAGGAAGG - Intronic
1022339666 7:29456404-29456426 CATGGTGAAGAAAGAGAGAGGGG + Intronic
1022797698 7:33745305-33745327 GATGGTGAAGACAGAGAGAAAGG + Intergenic
1023073308 7:36458990-36459012 CATTGGGAAGGCAGAGAGGAGGG + Intergenic
1023960459 7:44922067-44922089 CCTGGTGAGGAAGGGGAGGAGGG - Intergenic
1025234075 7:57221956-57221978 CATGGAGAAGCAATGGAGGACGG + Intergenic
1025814688 7:64900575-64900597 AATGGTGAGGAAAGGGAGGATGG - Intronic
1026018670 7:66692316-66692338 CATGGGTAAGAGAGGGAGGCAGG - Intronic
1026881732 7:73910382-73910404 CATGGGTAAGAGAGGGAGGCAGG + Intergenic
1027334780 7:77138073-77138095 TATGGTGGAGATAGAGAGGAAGG + Intronic
1027334963 7:77140512-77140534 CATGGTGGAGTTAGAGAGGAAGG + Intronic
1027540668 7:79460191-79460213 CATGGAGAGGAAAGGGAGGAAGG + Intergenic
1027542966 7:79491731-79491753 CAGTGTGAAGACAAGGAAGATGG - Intergenic
1028290049 7:89054828-89054850 AATGAGGATGACAGGGAGGAAGG - Intronic
1028459168 7:91071821-91071843 CCTGCTGAAGCCAGGGAGGCTGG + Intronic
1028584362 7:92438349-92438371 CATCTTGAAGACAGGAAGTATGG - Intergenic
1028734970 7:94198404-94198426 CATGATTAAGTCAGGGATGAGGG - Intergenic
1028764954 7:94543901-94543923 CATGATGAAGACAGTGATGTAGG + Intronic
1029425990 7:100494209-100494231 CATGGGGAAGGGAGGAAGGAAGG + Exonic
1029490642 7:100868244-100868266 CAGGGTGCTGACGGGGAGGAGGG - Intronic
1029780835 7:102730601-102730623 CATGGTGGAGTTAGAGAGGAAGG - Intergenic
1029781021 7:102733029-102733051 TATGGTGGAGATAGAGAGGAAGG - Intergenic
1029790119 7:102834027-102834049 CATGATGAAGGAAGGAAGGAAGG + Intronic
1030301307 7:107977114-107977136 CATGGAGAAGGAAGGGAGGGAGG - Intronic
1030327885 7:108240702-108240724 GAGGGTGACTACAGGGAGGAAGG - Intronic
1030776957 7:113545685-113545707 GATGGTGAAGGGTGGGAGGAGGG + Intergenic
1031523673 7:122797713-122797735 CAGGGTGGAGGCAGGGAGGAGGG + Intronic
1031719243 7:125149663-125149685 CATTGTGTTGGCAGGGAGGAAGG + Intergenic
1031819562 7:126483175-126483197 CATGATGAAGGAAGGAAGGAAGG - Intronic
1031819590 7:126483476-126483498 CATGATGAAGGAAGGAAGGAAGG - Intronic
1032859822 7:135866319-135866341 CATGGTGATGATGAGGAGGAGGG - Intergenic
1032919914 7:136534083-136534105 CCTGCTGAAGCCAGGGAGGCTGG + Intergenic
1033133747 7:138767827-138767849 GATGGTGGGGACAGGGATGAGGG - Intronic
1033590289 7:142802974-142802996 CAAGATGAGGACAGAGAGGAAGG + Intergenic
1033606858 7:142933829-142933851 CCTGGGGAAGAAAAGGAGGAGGG + Intergenic
1033969772 7:147025325-147025347 CAGGGAGAAGAAAGGGGGGAGGG + Intronic
1034006602 7:147478984-147479006 CAGGGTGACGACAGGAAGAAAGG + Intronic
1034065830 7:148135958-148135980 CATTGGGAAGAGAGGGAGGAAGG + Intronic
1034260054 7:149749653-149749675 CAGGGGGATGACAGGAAGGAGGG - Intergenic
1034451835 7:151141365-151141387 CATGGCATAGACAGGCAGGAAGG - Intronic
1034679060 7:152914458-152914480 GATGGTGATGACAGTGATGATGG - Intergenic
1034929196 7:155147905-155147927 CAGGGGGAAGAGAGAGAGGAGGG - Intergenic
1035016379 7:155770017-155770039 CATGCGTAAGACAGGGAAGATGG + Intronic
1035046725 7:155972737-155972759 CAGGGAAGAGACAGGGAGGAAGG + Intergenic
1035238697 7:157516491-157516513 CAGGGTGCTGACAGGGAGGGTGG + Intergenic
1035666246 8:1382280-1382302 CAACGTGAAGACGGGGATGAAGG - Intergenic
1035755294 8:2026527-2026549 CATGGTGGAGACACAGGGGACGG + Intergenic
1035828477 8:2669276-2669298 CATGGTGCAAACTGGGAGAATGG - Intergenic
1036111821 8:5911135-5911157 CATGGAGTGGAGAGGGAGGAAGG + Intergenic
1036573189 8:9999709-9999731 CCTGATGAATACAGGGAGTAAGG + Intergenic
1037808171 8:22069827-22069849 CATGCTGATGGCAGGGAGGCTGG - Intronic
1037862594 8:22416359-22416381 CACTGTGAAGACAGGGAGATGGG - Intronic
1038400329 8:27279649-27279671 CAGGGTGTAGACAGGGGAGAGGG + Intergenic
1038461285 8:27719379-27719401 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1038570546 8:28658345-28658367 GAGGGTGAAAACAGGGTGGATGG - Intronic
1039315609 8:36368394-36368416 CATGGTCGAGACAGAGTGGAGGG - Intergenic
1039724567 8:40202057-40202079 AATGGTGAGGACAGGGAGGACGG + Intergenic
1039913565 8:41843529-41843551 CATGGTGCAGACAGGGCAGCTGG + Intronic
1040596115 8:48839358-48839380 AATGGAGAAGACAGGCAGGCCGG - Intergenic
1040803545 8:51369911-51369933 CATGTTGAAGACTCGGAGGAGGG - Intronic
1040830540 8:51671766-51671788 CGTGATGAAGTCAGTGAGGATGG - Intronic
1040862239 8:52011174-52011196 CCAGGTGAAGACAGAGAAGAGGG + Intergenic
1040959758 8:53019218-53019240 CCTGCTGAAGCCAGGGAGGCTGG + Intergenic
1042249644 8:66743045-66743067 ATTGGTGGAGGCAGGGAGGATGG - Intronic
1042624845 8:70746909-70746931 AAGGGAGAAGACAGGGAGGAGGG - Intronic
1043233310 8:77830223-77830245 CCTGCTGAAGCCAGGGAGGCTGG + Intergenic
1045079180 8:98605566-98605588 CAGGGCGAAGACAGAGAGGGAGG - Intronic
1045322197 8:101090790-101090812 CATGGTGGGGACAGTGGGGATGG + Intergenic
1045328873 8:101138047-101138069 CATGGAGCAGCAAGGGAGGAAGG - Intergenic
1045582620 8:103498531-103498553 CCTGGGGAACAGAGGGAGGAGGG + Intergenic
1045591391 8:103602448-103602470 GAGGGTGAAGAGTGGGAGGAGGG - Intronic
1046919390 8:119712035-119712057 CATGGAGCAGTGAGGGAGGAAGG + Intergenic
1047546376 8:125821682-125821704 CATGGTGGAGAGAGAGAGCAAGG + Intergenic
1047794651 8:128242255-128242277 CACAGTGAAGACTGGTAGGAGGG - Intergenic
1047843914 8:128785421-128785443 CCAGGTGAAGACAGGGATGTTGG + Intergenic
1047927468 8:129695594-129695616 CATGCTGACCACAGGGAGGTGGG - Intergenic
1048339053 8:133524989-133525011 CGTGGTGAATGGAGGGAGGAGGG + Intronic
1048699150 8:137068135-137068157 GGTGGTGAAGTCAGTGAGGATGG + Intergenic
1049032233 8:140046459-140046481 GCTGCTGGAGACAGGGAGGAAGG - Intronic
1049253569 8:141602307-141602329 TATGCTGAAGGTAGGGAGGAGGG + Intergenic
1049370345 8:142261317-142261339 GATGGAGGAGAGAGGGAGGAGGG + Intronic
1049468928 8:142766717-142766739 AAGGGTGAGGACAGGGAGGGAGG - Intronic
1049620184 8:143594627-143594649 CAGGGAGAAGTCAGGGAGGTGGG + Intronic
1049675491 8:143887166-143887188 CAAGGAGAGGACAGGGAGAAGGG - Intergenic
1049974110 9:845639-845661 GAGGCTGAAGGCAGGGAGGAAGG - Intronic
1050756893 9:9015815-9015837 CTTGCTGAAGTCAGGGAAGATGG - Intronic
1050838998 9:10122796-10122818 GATGGTTAAGTCAGGGTGGAAGG - Intronic
1051671628 9:19516300-19516322 CATGATGAAGAGAAGGACGATGG + Exonic
1052917301 9:33933212-33933234 GAGGGTGAAGACAGGTAGGAGGG + Intronic
1053011263 9:34635108-34635130 TATGGTGAGGACAGGGGAGAAGG + Exonic
1053299220 9:36936741-36936763 CAGGGTGGGGACAGGGAGGTGGG + Intronic
1053317248 9:37062492-37062514 TGTGGTGAAGACCGGGAGGCTGG + Intergenic
1053791166 9:41687296-41687318 AATGGTGATGACAGGGGGCAGGG + Intergenic
1054153985 9:61627476-61627498 AATGGTGATGACAGGGGGCAGGG - Intergenic
1054179514 9:61898990-61899012 AATGGTGATGACAGGGGGCAGGG + Intergenic
1054473769 9:65558596-65558618 AATGGTGATGACAGGGGGCAGGG - Intergenic
1054658024 9:67681831-67681853 AATGGTGATGACAGGGGGCAGGG - Intergenic
1055398607 9:75899530-75899552 CGGGGTGAGGAGAGGGAGGAGGG - Intronic
1056030285 9:82546219-82546241 CATGGTTAAGACAGGGAGTTTGG + Intergenic
1056435826 9:86575364-86575386 CATGGTAAAGGCAGGAAGGGTGG + Intergenic
1056719949 9:89063028-89063050 CATGGTGAAAGCAGGGTTGAGGG + Intronic
1056768443 9:89459709-89459731 CCAGGTGGAGACAGGAAGGAAGG - Intronic
1057165475 9:92921784-92921806 AAGGAGGAAGACAGGGAGGAAGG - Intergenic
1057412187 9:94826452-94826474 CATGGTGGGGAAGGGGAGGAGGG + Intronic
1057704756 9:97388704-97388726 CATGGTGAAGGCAGCTGGGATGG - Intergenic
1057794104 9:98143401-98143423 CAGGGTGGAGACTGGGAGGCAGG + Intronic
1058048902 9:100386937-100386959 CTTGGGGGAAACAGGGAGGAGGG + Intergenic
1058174356 9:101720848-101720870 GAGGGTGAAGAGTGGGAGGAGGG + Intronic
1058301885 9:103384992-103385014 AAAGGTGAAGACTGAGAGGATGG + Intergenic
1058645021 9:107123422-107123444 GATGGTTAAGACATGGAGAATGG + Intergenic
1058767370 9:108194908-108194930 CCAGGTTAAGACAGGGAGAATGG - Intergenic
1058948479 9:109881028-109881050 GAGGGTGAAGGGAGGGAGGAGGG - Intronic
1059354252 9:113687145-113687167 GAAGAGGAAGACAGGGAGGAGGG + Intergenic
1059354328 9:113687410-113687432 GATGGGGAAGGGAGGGAGGAGGG + Intergenic
1059421376 9:114194553-114194575 CATGGCAAAGGCAGGGAGGTGGG + Intronic
1060048380 9:120359009-120359031 CCTGGTGGAGCCAGGGAGGAAGG + Intergenic
1060298141 9:122356822-122356844 CCTGGTGGAGAAAGGGTGGAGGG + Intergenic
1060536880 9:124397179-124397201 CATCTTTAAGACAGGGATGATGG + Intronic
1060822434 9:126669245-126669267 GAGGGTGGAGACAGGGATGAGGG + Intronic
1060899913 9:127248210-127248232 CATGGAGAAGAGAGGTTGGAAGG + Intronic
1061804680 9:133131351-133131373 CAGGGTGAGTACAGGGAGGTAGG - Intronic
1061840876 9:133357944-133357966 CACAGTGAAGAGAGGGATGATGG + Intronic
1062053598 9:134459422-134459444 CAGGGTGAGGTCAGGGAGAATGG + Intergenic
1185840085 X:3381179-3381201 CAACGTGAAGACAGTGAGAATGG + Intergenic
1186005464 X:5066001-5066023 CAGGAGGAAGACAGGGAGGGAGG + Intergenic
1186852705 X:13596324-13596346 CATGGAGCAGTGAGGGAGGAAGG - Intronic
1187083918 X:16021933-16021955 CATGGGGAAACCAAGGAGGAGGG + Intergenic
1187472160 X:19579150-19579172 GATGGTGAAGACACGCTGGAAGG + Intronic
1187584010 X:20639798-20639820 CATGGTGAAGGTGGGGAGGGGGG - Intergenic
1187595172 X:20763283-20763305 CAAGGTGGAGGGAGGGAGGAGGG - Intergenic
1187942361 X:24394402-24394424 CAAGGGGGAGACATGGAGGAAGG + Intergenic
1187970660 X:24654782-24654804 CATGAAGAAGGAAGGGAGGAAGG + Intronic
1188329415 X:28850526-28850548 TAGGGGGAAGAGAGGGAGGAAGG - Intronic
1188422202 X:30003862-30003884 GGTGGTGGGGACAGGGAGGAGGG - Intergenic
1188755986 X:33964333-33964355 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
1189018987 X:37315022-37315044 TTTGCTGAAGACAAGGAGGAAGG - Intergenic
1189591766 X:42520103-42520125 CAAGTTGAAGAAAGGGAAGAAGG - Intergenic
1189762289 X:44333869-44333891 CATGTTCAAGACAAGCAGGAAGG - Intronic
1189845378 X:45131697-45131719 CATGGAAAAGACAGAGAGAAAGG - Intergenic
1189956444 X:46279510-46279532 AATGGTGAAGAGATGGAGGTCGG + Intergenic
1190245757 X:48689063-48689085 CAAGGTGAGGACAGGCAGGATGG + Exonic
1192262898 X:69518176-69518198 CATGGTCCAGACAGTGATGATGG + Intronic
1192358616 X:70424965-70424987 CATGGTGAAGGCCTGGGGGAAGG - Exonic
1192927026 X:75765854-75765876 GAAGGTGAAGATTGGGAGGAGGG + Intergenic
1193552760 X:82918633-82918655 GATGGTGAACAGTGGGAGGAGGG - Intergenic
1193827979 X:86250050-86250072 GATGGTGGAGGGAGGGAGGAGGG + Intronic
1194238413 X:91413603-91413625 AACGGTGAAGGCTGGGAGGAGGG + Intergenic
1194289726 X:92055697-92055719 GATGGTGAAGGGTGGGAGGAGGG - Intronic
1194446718 X:93996632-93996654 GATGGTGGAGAGTGGGAGGAGGG - Intergenic
1194504526 X:94715860-94715882 CAAGGTGGAGAGTGGGAGGAGGG + Intergenic
1195356487 X:104044254-104044276 CATTTTCGAGACAGGGAGGAAGG - Intergenic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1195983112 X:110601058-110601080 CTTGCTGGAGACAGGGAGGCTGG + Intergenic
1196556784 X:117097000-117097022 CATGGTGGAGAGTGGTAGGAGGG + Intergenic
1197403933 X:126027567-126027589 CCTGGTGGAGCCAGGGAGGCTGG - Intergenic
1197730214 X:129803561-129803583 GATGGTCAGGACAGGGAGAATGG + Exonic
1197971852 X:132122609-132122631 AATGGTGAAGACAGACAGGAAGG - Intronic
1198274304 X:135087047-135087069 CATGGGGCAGAAAGGGAGGCAGG + Intergenic
1198314629 X:135453169-135453191 CATGGGGCAGAGAGGGAGGCAGG - Intergenic
1199856807 X:151765960-151765982 CATAGTGATGGCAGGGAGGATGG - Intergenic
1200078321 X:153562942-153562964 CATGGTGGACAGAGGGAGCAAGG + Intronic
1202070320 Y:20985460-20985482 CCTGATGGAGACAGGGAGGCTGG - Intergenic