ID: 1103612982

View in Genome Browser
Species Human (GRCh38)
Location 12:122135340-122135362
Sequence GCCAGGGTGAGGAGGGCCCT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 1, 1: 0, 2: 6, 3: 43, 4: 518}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103612973_1103612982 11 Left 1103612973 12:122135306-122135328 CCAGTCCAACGTGGTCATTGCGC 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1103612982 12:122135340-122135362 GCCAGGGTGAGGAGGGCCCTAGG 0: 1
1: 0
2: 6
3: 43
4: 518
1103612971_1103612982 18 Left 1103612971 12:122135299-122135321 CCGTGTCCCAGTCCAACGTGGTC 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1103612982 12:122135340-122135362 GCCAGGGTGAGGAGGGCCCTAGG 0: 1
1: 0
2: 6
3: 43
4: 518
1103612968_1103612982 24 Left 1103612968 12:122135293-122135315 CCTCCACCGTGTCCCAGTCCAAC 0: 1
1: 0
2: 0
3: 13
4: 157
Right 1103612982 12:122135340-122135362 GCCAGGGTGAGGAGGGCCCTAGG 0: 1
1: 0
2: 6
3: 43
4: 518
1103612969_1103612982 21 Left 1103612969 12:122135296-122135318 CCACCGTGTCCCAGTCCAACGTG 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1103612982 12:122135340-122135362 GCCAGGGTGAGGAGGGCCCTAGG 0: 1
1: 0
2: 6
3: 43
4: 518
1103612974_1103612982 6 Left 1103612974 12:122135311-122135333 CCAACGTGGTCATTGCGCCTGCT 0: 1
1: 0
2: 0
3: 7
4: 37
Right 1103612982 12:122135340-122135362 GCCAGGGTGAGGAGGGCCCTAGG 0: 1
1: 0
2: 6
3: 43
4: 518
1103612972_1103612982 12 Left 1103612972 12:122135305-122135327 CCCAGTCCAACGTGGTCATTGCG 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1103612982 12:122135340-122135362 GCCAGGGTGAGGAGGGCCCTAGG 0: 1
1: 0
2: 6
3: 43
4: 518

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103612982 Original CRISPR GCCAGGGTGAGGAGGGCCCT AGG Exonic
900302978 1:1987137-1987159 GCCCGGGTGAGGGGGGCTCTGGG - Intronic
900318870 1:2072736-2072758 TCCAGGGTCAGCAGGGCCATAGG + Intronic
900339596 1:2181685-2181707 GCCAGGGGCTGGAGGACCCTGGG + Intronic
900360790 1:2287906-2287928 GCCAGGGCCAGGAGCGCCCAGGG - Intronic
900595342 1:3477797-3477819 GCCGGGGTGAGCAGGTCCCCAGG - Intronic
901040498 1:6360340-6360362 GCCTGGGTGGGGAGGGCTCAGGG - Intronic
901080270 1:6580131-6580153 GCCTGGGTGAGGAGGGCGCGGGG + Exonic
901088661 1:6627227-6627249 GCCTGGGTGAGATGGGCCCCTGG - Intronic
901207631 1:7505923-7505945 ACCTGGGTGAGGAGGCCTCTCGG - Intronic
901635733 1:10669328-10669350 GCGAGGGTGAGGAGGGGACGGGG - Intronic
901873033 1:12149444-12149466 CCCAGGTTCAGAAGGGCCCTGGG + Intergenic
902069602 1:13723108-13723130 GCCAAGGAGAGAAGGGGCCTGGG - Intronic
902159568 1:14519233-14519255 GGCAAGGAGAGGAGGGCCCAAGG + Intergenic
902330944 1:15731026-15731048 GGCAGGGTGAAGAAGGGCCTGGG - Intronic
902373282 1:16018248-16018270 GCAGTGGTGAGGAGGCCCCTGGG - Exonic
903215154 1:21839613-21839635 GCCATGGTGAGGAAGGGCCCTGG + Intronic
903574565 1:24330912-24330934 GCCAGGGCGAGGAAGCCCTTAGG - Intronic
903853332 1:26321101-26321123 GCCAAGGTGGGAGGGGCCCTTGG - Intergenic
903856981 1:26343445-26343467 GACAGGGTGATGAGGCCCTTGGG - Intronic
904493347 1:30873452-30873474 GCCAGGGTGAGGAGAGGGCTGGG + Intronic
904825971 1:33274003-33274025 GCCAGGGTAAGGAGGCTCCACGG - Intronic
905186389 1:36200039-36200061 GACAGGGTGAGGAAGCCCCCAGG - Intergenic
905627717 1:39499320-39499342 GCCAGCGCAGGGAGGGCCCTGGG + Intronic
905646423 1:39627601-39627623 ATCAGAGTGAGGAGGCCCCTTGG + Intronic
905668707 1:39777788-39777810 GCCAGCGAAGGGAGGGCCCTGGG - Intronic
905733107 1:40309974-40309996 GCCAGGGTGAGGAAGGTCCTAGG - Exonic
905859855 1:41342882-41342904 GCCTGGCTTTGGAGGGCCCTGGG + Intergenic
905928069 1:41766080-41766102 GGCAGGTTCAGGTGGGCCCTGGG + Intronic
906686367 1:47765895-47765917 GCCGAGGTCAGGAGGGCCCAAGG + Exonic
907245472 1:53105809-53105831 GCCCAGGACAGGAGGGCCCTGGG + Intronic
907280733 1:53345638-53345660 TACAGGGTGATGAGGGCCATGGG - Intergenic
907289958 1:53407308-53407330 ACCAAGGTGAGGATGGCCATGGG + Intergenic
907951326 1:59186758-59186780 ACCAGGGTGGGGAGGTCACTGGG - Intergenic
908697000 1:66854956-66854978 TCCAGGGTTAGCAAGGCCCTAGG - Intronic
909377957 1:74961577-74961599 GCCAGTGTGATGTGGGCACTGGG - Intergenic
912499972 1:110115160-110115182 AACAGGGGCAGGAGGGCCCTTGG - Intergenic
912511934 1:110195527-110195549 TGCAGGGTGGGCAGGGCCCTGGG - Intronic
913240601 1:116826316-116826338 GCCAGGGTGTGTAGGGACCTGGG - Intergenic
914335388 1:146710426-146710448 GCCTGGATGATGAAGGCCCTGGG - Intergenic
914986030 1:152457846-152457868 GCAAGGGTGAGGTGTGGCCTAGG + Intergenic
915467306 1:156105116-156105138 GCCAAAGTGAGGTGGGCTCTTGG + Intronic
915990716 1:160512700-160512722 ACCAGGGTGGGGAGGGACCCAGG + Intronic
917154733 1:171984340-171984362 GCCTGGATGTGGAGGGCCCGTGG - Intronic
918047079 1:180948063-180948085 GCGAGGGTGCCGGGGGCCCTGGG - Exonic
919379945 1:196847659-196847681 TTCAGGGTGATGAGGGCCCCTGG + Intronic
919465677 1:197919931-197919953 GCAAGGCTGAGGAGGGCGCGCGG - Intronic
919910358 1:202107182-202107204 GCCAGGGTTAGAAGGAGCCTAGG - Intergenic
919997563 1:202767349-202767371 GCCACTGTGAGGAGGGCCCTGGG - Intronic
920725238 1:208428692-208428714 GCTAGGGTGAGGCAGGCCGTAGG + Intergenic
921320057 1:213930019-213930041 GAGAGGGAGAGGAGGGTCCTTGG - Intergenic
922416373 1:225427039-225427061 GCCAGGGTGAACAGGCCCCCGGG - Intronic
922790002 1:228306120-228306142 GGCTGGGTGGGGGGGGCCCTGGG + Intronic
922796167 1:228340884-228340906 GCCAGGTTGGGGAGGGCCAGGGG + Exonic
923519677 1:234725916-234725938 GCCAGGGTGTGTGGGGCCCGGGG - Intergenic
923724044 1:236491170-236491192 GGCAGGGAGAGGAAGGCCGTCGG - Intergenic
924068767 1:240254544-240254566 GCCAGGGGTAGGGGGGACCTGGG - Intronic
924816759 1:247448687-247448709 GCCAGGGTGAGGAAGACACCAGG + Exonic
924916872 1:248578729-248578751 GCCAGAGTCATGAGGGCCTTGGG + Intergenic
1062812378 10:476653-476675 GAGAGGGTGTGGAGGGGCCTGGG - Intronic
1062876059 10:943772-943794 GCCCGGGTCGGGAGGGCCCGGGG + Intergenic
1064008377 10:11715580-11715602 GCCTGGGTTTGGAGGGCACTTGG + Intergenic
1064271515 10:13870411-13870433 GCAAGGGAGAGGATGGTCCTTGG - Intronic
1066281584 10:33923289-33923311 GACATGGAGAGGAGGGACCTTGG - Intergenic
1067077256 10:43195165-43195187 GCCATGGTCAGTAGGGCCCAGGG + Exonic
1067216851 10:44310739-44310761 GGCAGGGCGAGAAAGGCCCTCGG + Intergenic
1067741181 10:48897101-48897123 GTCGGGGTGAGAAGGCCCCTGGG - Intronic
1069924414 10:71838345-71838367 GCCAGGGAGGGGAGGGCCTGGGG + Intronic
1070157518 10:73844767-73844789 GTGAGGGTGAGGAGGGGCATGGG - Intronic
1070534012 10:77361878-77361900 GCAAGGCTGAGGAGGTGCCTGGG - Intronic
1070541501 10:77418559-77418581 GACAGGGTGTGGATGCCCCTGGG - Intronic
1070773344 10:79095660-79095682 GCTACCGTGAGGAGGCCCCTCGG + Intronic
1070794117 10:79207141-79207163 GCCAGGGCAGGGAGGGGCCTAGG - Intronic
1071473890 10:86008191-86008213 GCCAGAGTGAGCAGGGCCTTAGG + Intronic
1072666888 10:97400276-97400298 GCGAGGGTCGGGAGGGCCATAGG - Intronic
1072737592 10:97889423-97889445 GCCAGGGTGAAGAGGGGCTGTGG + Intronic
1073121569 10:101125247-101125269 GTCTGGGGGAGCAGGGCCCTGGG + Intronic
1073445726 10:103579165-103579187 GACAGACTGAGGAGGGCCCCAGG - Intronic
1074690906 10:116003274-116003296 GCCAGTGTGACCACGGCCCTTGG + Intergenic
1075065473 10:119286506-119286528 GGAAGGCTGAGGGGGGCCCTGGG - Intronic
1075424276 10:122329354-122329376 GCCAGGGGGAGATGGGGCCTCGG - Intronic
1075646845 10:124102430-124102452 ACCAGGGTATGGAGGGCCCTTGG - Intergenic
1075687183 10:124372410-124372432 GCCGGGGAGAGCATGGCCCTGGG + Intergenic
1075927311 10:126262825-126262847 GGCAGGGTGGGAAGTGCCCTTGG - Intronic
1076305103 10:129460806-129460828 GCCCTGGTGAGGAGGGGGCTGGG - Intergenic
1076344236 10:129769461-129769483 GACAGGGTGAGGGGGACCCAGGG - Intergenic
1076787790 10:132759699-132759721 TGCAGGGTGAGGAGGGCGCCGGG - Intronic
1076814838 10:132909603-132909625 GCCAGATGGAGGAGGGGCCTTGG - Intronic
1076894409 10:133302775-133302797 GCCAAGGTGAGCACTGCCCTTGG - Exonic
1076923358 10:133467019-133467041 GCCAGGGATGGGAGGGCACTGGG + Intergenic
1077161258 11:1113652-1113674 GCGAGGAAGAGGAGGGCGCTGGG - Intergenic
1077185792 11:1234796-1234818 GCCAGGGTGAGGTGGGGCCGTGG + Intronic
1077254010 11:1572572-1572594 GCCCGGGTGACGGGGGGCCTGGG - Intergenic
1077274863 11:1699932-1699954 GCCATGGTGAGACGGGGCCTGGG - Intergenic
1077284250 11:1758813-1758835 AGCAGGGTGAGGAGGGGTCTGGG - Intronic
1077352116 11:2097837-2097859 GCCAGAGTGGGGAGGGCCGGGGG - Intergenic
1077535384 11:3121684-3121706 GCCAGTGGGCGGAGGGCGCTGGG - Intronic
1077659579 11:4055632-4055654 GCCAAGGTCAGGAGGGGACTGGG + Exonic
1081579051 11:44339484-44339506 GCCTGAGACAGGAGGGCCCTGGG + Intergenic
1082261036 11:50076440-50076462 GCCAGTGTGAGGTAGGACCTGGG + Intergenic
1083309400 11:61776718-61776740 GCCAGGGAAAGGGTGGCCCTGGG + Intronic
1083693842 11:64429491-64429513 GTGAGGGTGAGCAGGGCCCCTGG + Intergenic
1083803038 11:65057803-65057825 GTCAGGGTGGGGAGAACCCTGGG + Intronic
1083881954 11:65553282-65553304 GGGAGGGTGAGGAGGGAACTGGG + Intronic
1083956190 11:65984183-65984205 GTCAGGGTGAGTAGGGGGCTGGG + Intergenic
1084323937 11:68388360-68388382 ACCAGGGCTAGGAGGGGCCTTGG - Intronic
1084440565 11:69170368-69170390 GGCTGGGTGAGGGGGGACCTGGG - Intergenic
1084450347 11:69233131-69233153 GTCAGTGTGAGGTGGGGCCTGGG + Intergenic
1084658994 11:70536158-70536180 GCCAGGGTAAGGAGGTCTCCTGG - Intronic
1084659044 11:70536429-70536451 GCCTGGGTGGGGACAGCCCTGGG - Intronic
1084693370 11:70739626-70739648 GCCAGGGTCAGCTGGGCCCCAGG + Intronic
1084813100 11:71627630-71627652 GGCAGAGTGAGCAGGGCCATCGG - Intergenic
1085415767 11:76318289-76318311 GCCAGGGTGAGCAGGGGCCTGGG + Intergenic
1088226855 11:107629959-107629981 TCGAGGGTGAGGAGGACACTAGG + Intronic
1088738685 11:112749168-112749190 GCCAGGGAGAGGAGGGAGCAAGG + Intergenic
1088837539 11:113590538-113590560 GCCAGGGTGAGGTGGGCTAATGG + Intergenic
1089058423 11:115606708-115606730 GTCAGAGTCAGGAGGACCCTGGG - Intergenic
1089138368 11:116267320-116267342 GCCAGCTTGAAGAGAGCCCTGGG + Intergenic
1089273281 11:117315918-117315940 GCCAGGGCCTGCAGGGCCCTGGG + Exonic
1090390558 11:126384677-126384699 GGGAGGGGGAGGAGGCCCCTAGG - Intronic
1090644638 11:128757907-128757929 ACCTGGGTGAGGAGGGACTTTGG - Intronic
1090739409 11:129643527-129643549 TCTAGGGTGAGGTTGGCCCTAGG + Intergenic
1090801911 11:130178465-130178487 GGCTGCGTGGGGAGGGCCCTGGG + Intronic
1091392370 12:133447-133469 GGGAGGCTGAGGAGGCCCCTGGG + Intronic
1091445334 12:541804-541826 GGCAGGGAGAGGAGGGCCGAGGG - Intronic
1091759297 12:3076955-3076977 GCCTGGGCCAGGAAGGCCCTTGG + Intergenic
1091768762 12:3138252-3138274 GCCAGGGAGACGAGAGCCCTGGG + Intronic
1092096164 12:5843669-5843691 GTCAGGGTGAGGAGGGAACGCGG + Intronic
1092294856 12:7189787-7189809 GCAAGGGTGGGGAGGGCCCAGGG - Intronic
1094407247 12:30129925-30129947 GCCAGGGACAGGCGGCCCCTTGG + Intergenic
1095990323 12:48029913-48029935 GCCAAGGTGATGAGGGGCCAGGG + Intergenic
1096096190 12:48937278-48937300 GCCATGCTGTGGGGGGCCCTGGG + Exonic
1096637968 12:52973357-52973379 GCATGGGGGATGAGGGCCCTGGG + Intergenic
1096674411 12:53218849-53218871 GCCTGGGTGCGGACGGCCCGGGG - Intronic
1096791306 12:54046921-54046943 GCCAGGGCGAGGAGGCCTCTGGG + Intronic
1100591621 12:96035321-96035343 GCCCGGGAGAGGCGGGCACTGGG + Intronic
1102008123 12:109601665-109601687 GTCAGGGTCAGGAGGACCCTTGG + Intergenic
1102073206 12:110038830-110038852 GCCACAGTGAGCAGTGCCCTTGG - Exonic
1102167664 12:110819636-110819658 GCCTGGGTGAAGCAGGCCCTGGG - Intergenic
1102214013 12:111147473-111147495 GCCAGGGAAAGGGGGCCCCTTGG - Intronic
1102220440 12:111190867-111190889 GTGAGTGTGAGGAGGGTCCTTGG - Intronic
1102493778 12:113305283-113305305 CCCAGGCTGAGCAAGGCCCTTGG - Intronic
1103377637 12:120469329-120469351 GCCGGGGGGAGGGGAGCCCTGGG + Intronic
1103612982 12:122135340-122135362 GCCAGGGTGAGGAGGGCCCTAGG + Exonic
1103713474 12:122929716-122929738 GCAGGGGTAAGGAGTGCCCTGGG + Exonic
1103793903 12:123490355-123490377 ACCTGGGTGGGAAGGGCCCTTGG - Intronic
1104168651 12:126258453-126258475 GGGAGGGTCAGGAGTGCCCTGGG - Intergenic
1104301566 12:127569494-127569516 GGCAAGGTGAGGAGGGTCTTTGG + Intergenic
1104472032 12:129037000-129037022 CCCAGGGAGAAGAGGGCCATGGG + Intergenic
1104485112 12:129144545-129144567 GACATGGTGAGGAGGCACCTGGG + Intronic
1104854500 12:131895448-131895470 GCCAGGTTGAGGATCGCGCTGGG - Intronic
1105370290 13:19796166-19796188 GCCAGGGTGACCAGACCCCTGGG + Intergenic
1105794287 13:23834726-23834748 GGCAGGGCCACGAGGGCCCTGGG - Intronic
1108310750 13:49187599-49187621 GCCACTGTGAGGAGGGCCCTGGG - Intronic
1108345021 13:49537118-49537140 ACCAGGGTGAGCAGGTGCCTCGG + Intronic
1108437719 13:50417076-50417098 GCCAGGACCAGGTGGGCCCTGGG + Intronic
1111912647 13:94329330-94329352 CCCAGGGTGCGGTGGGCCCTGGG - Intronic
1113591333 13:111503352-111503374 GGGAGGCTGAGGAAGGCCCTTGG + Intergenic
1113908280 13:113830394-113830416 GCCACGGGGAGGAGGGGCCCAGG - Intronic
1113908307 13:113830469-113830491 GCCACGGGGAGGAGGGGCCCGGG - Intronic
1113908335 13:113830544-113830566 GCCACGGGGAGGAGGGGCCCGGG - Intronic
1113908363 13:113830619-113830641 GCCATGGGGAGGAGGGGCCCGGG - Intronic
1113908391 13:113830694-113830716 GCCATGGGGAGGAGGGGCCCGGG - Intronic
1113908418 13:113830770-113830792 GCCATGGGGAGGAGGGGCCCGGG - Intronic
1113908449 13:113830845-113830867 GCCCCGGGGAGGAGGGCCCCAGG - Intronic
1115330406 14:32190676-32190698 GCCAGGGTTGGGGGGGCACTCGG - Intergenic
1118163973 14:63317800-63317822 GCCAGAAGGAGGAGGGCCATGGG + Exonic
1118168406 14:63360571-63360593 GCCATGGTGAGGAGGTCCACAGG + Intergenic
1118710289 14:68513315-68513337 GACAGGGTGAGGCTGGGCCTGGG + Intronic
1118778338 14:68988646-68988668 GCCAGGTGGAGTGGGGCCCTGGG - Intergenic
1118994152 14:70821950-70821972 CCCAGGGGGAGGAGGGGCCCAGG + Intergenic
1119205605 14:72791449-72791471 ACCAGGGAGAGCAGTGCCCTGGG + Intronic
1119320383 14:73726813-73726835 GGCAAGGTGAGGAGGGGCCTGGG - Exonic
1119377230 14:74204502-74204524 GCCAGAGTGAGGGGGGCAGTGGG - Intergenic
1119420793 14:74506644-74506666 GCCAGGGAAGGGAAGGCCCTGGG - Intronic
1119660802 14:76450357-76450379 GCCATGGTGAGGGGTGCACTTGG + Intronic
1121491668 14:94365370-94365392 GCCAGGGTGCTGGGGGCCCCAGG - Intergenic
1121866094 14:97364124-97364146 CCCAAGGTGGGGAGGGCCCTAGG + Intergenic
1122357598 14:101132830-101132852 GACAGGGTGTGGGGGCCCCTCGG - Intergenic
1122405695 14:101499542-101499564 TCCATGGTGAGGAGGGATCTAGG - Intergenic
1122601871 14:102925538-102925560 GCCCGAGTGAGGGGGGCACTGGG + Intronic
1122629118 14:103099327-103099349 GCCACGGTGCCGAGGGCCCTGGG + Intergenic
1122802193 14:104237010-104237032 TCCAGGGTCAGCAGGGTCCTGGG + Intergenic
1123044146 14:105503253-105503275 CCCAGGGTGCGGTGGGCCCGGGG + Intergenic
1123066286 14:105621075-105621097 GCAAGGGTGAGGATAGCCCAAGG - Intergenic
1123070428 14:105640127-105640149 GCAAGGGTGAGGATAGCCCAAGG - Intergenic
1123075019 14:105663787-105663809 GCAAGGGTGAGGATAGCCCAAGG - Intergenic
1123076505 14:105669893-105669915 CCCAGGGTGCAGAGGCCCCTCGG + Intergenic
1123089664 14:105736915-105736937 GCAAGGGTGAGGATAGCCCAAGG - Intergenic
1124200955 15:27678127-27678149 TCCAAGGTGAGGAGGATCCTGGG - Intergenic
1124227376 15:27905499-27905521 GCCAGGGGGAACTGGGCCCTGGG + Intronic
1124355314 15:28991163-28991185 GACAGGCAGAGGAGGGCCCTTGG - Intronic
1127264701 15:57352120-57352142 GCCAGGCTCAGTAGGTCCCTGGG + Intergenic
1127395006 15:58537538-58537560 GCCAGAGCATGGAGGGCCCTGGG - Intronic
1128224888 15:65994655-65994677 GCCAGGGGCAGGAGGGACCTGGG + Intronic
1128234264 15:66056827-66056849 GACAGGGTGAAGGGGGACCTTGG - Intronic
1128480888 15:68036794-68036816 GGCAGGGTGGGTAGGCCCCTGGG - Intergenic
1128551811 15:68602599-68602621 GCCAGGCTGATCAGAGCCCTGGG - Intronic
1128767063 15:70257717-70257739 TCCAGGGTGAGGAGGGCATGTGG + Intergenic
1128834033 15:70794790-70794812 GCAAGGGTCAAGAGGGCCCCAGG + Intergenic
1129312120 15:74720194-74720216 GCTAGGGTTAGGAGGTCCTTAGG - Exonic
1129709600 15:77813877-77813899 GGCAGGGTGGGGAGGGCGCTGGG - Intronic
1129780778 15:78269255-78269277 GCTGGGGTGAGGAGGGCACATGG + Intronic
1131104886 15:89726858-89726880 GCCAGGGTGTGGGGGGCGGTGGG - Intronic
1131150459 15:90044332-90044354 GCCAGAGTGGGGAGGCCCGTGGG - Intronic
1131442682 15:92470851-92470873 GCCAGAGGGAGGAGGGCTCAAGG - Intergenic
1132406431 15:101544127-101544149 GCCAGGCAGCGGAGGGCTCTGGG - Intergenic
1132546479 16:535630-535652 GGCAGGGTGCGGAGGGCCCCGGG - Intronic
1132609393 16:807681-807703 CCCAGGGCGTGGCGGGCCCTCGG + Intronic
1132651639 16:1023847-1023869 GGCAGCAGGAGGAGGGCCCTCGG + Intergenic
1132888039 16:2191027-2191049 GCCAGGATGCGGGGGGCCCCAGG - Intronic
1132971970 16:2693588-2693610 GGCAGGGTGGGGACGGCCATCGG - Intronic
1133068915 16:3232693-3232715 GCCAGGCTGAGAAGGGCTCAAGG + Intronic
1133239971 16:4408431-4408453 CCCTGGGTCAGCAGGGCCCTCGG - Intronic
1134125600 16:11613828-11613850 GGCAGGGTGAGGCCGGCTCTCGG - Intronic
1134606008 16:15571716-15571738 GACAGGGTGAGGGAGGCCCCTGG - Intronic
1135842827 16:25892279-25892301 GCAGGAGTGAGGAGGGCCCCAGG + Intronic
1136395003 16:29987792-29987814 GCCAGTGTGTGGATGGCCCACGG - Exonic
1136462190 16:30418420-30418442 GCCGGGGCGAGGAGGAGCCTGGG - Exonic
1137556001 16:49470707-49470729 GCCTGGGAGAGGAGGCTCCTGGG + Intergenic
1137625159 16:49903109-49903131 GCCCGGGTCTGGAAGGCCCTGGG + Intergenic
1138194291 16:55040968-55040990 GACAGGGTGGGCAGGGCCCTGGG - Intergenic
1138205209 16:55119688-55119710 CCCAGGGTGAGGGAGGCCCAGGG - Intergenic
1138429931 16:56962207-56962229 CCCAGAGAGAGGAGTGCCCTGGG + Intronic
1139531677 16:67545604-67545626 GGCAGGGTGAGGAGCCCCCGAGG - Intronic
1139998235 16:71000802-71000824 GCCTGGATGATGAAGGCCCTGGG + Intronic
1141040898 16:80671421-80671443 GCCAGGTGCAGGAGGGGCCTGGG - Intronic
1141620314 16:85233889-85233911 GGCAGGGGTAGGAGGGCCCTGGG - Intergenic
1141755447 16:85987769-85987791 GCCGGGGTGAGGAGAGCCGGGGG - Intergenic
1141873674 16:86806835-86806857 CCCAGGGTGGGCAGGGCCCCGGG + Intergenic
1141926703 16:87174552-87174574 GCCAGGCTGAAGAGGGCGGTAGG - Intronic
1142124587 16:88403851-88403873 ACCAGGCTGAGGAGTGTCCTGGG - Intergenic
1142359968 16:89621307-89621329 GGCAGGGTGAGGAGGGATGTGGG + Intronic
1142418169 16:89954326-89954348 GACAGCATGAGCAGGGCCCTGGG + Exonic
1143628731 17:8125287-8125309 ACCAAGGTGCGGAGGGCCGTTGG - Intergenic
1143786664 17:9260756-9260778 TCCAGGGTGAGGAGGGTGCCAGG - Intronic
1144652640 17:17017164-17017186 GCCAGGGCCAGCAGGGCCCTTGG + Intergenic
1144659340 17:17058287-17058309 GCCAGGGGGAGCAGGGACCCAGG + Intronic
1144850496 17:18241710-18241732 GCCAGGGTGAGGCGGGGCAGAGG + Exonic
1145867946 17:28252858-28252880 GTGAGCCTGAGGAGGGCCCTTGG + Intergenic
1146125460 17:30227891-30227913 GCCTGGGAGAGGATAGCCCTGGG + Intronic
1146373836 17:32281344-32281366 CCCAGGCTGGGGAGGGCCGTGGG - Intronic
1147948792 17:44095574-44095596 GCCAGGGACAGGAGGGGGCTGGG + Intronic
1148515192 17:48210479-48210501 GCCTTGGTGAGGTGGGCCCAGGG + Intronic
1148792656 17:50182265-50182287 GCCAGGCTCAGGATGTCCCTGGG + Intergenic
1148830679 17:50428980-50429002 GCCATGGTGAGGAATGCGCTTGG + Intronic
1148907573 17:50921024-50921046 GCCAGTTTGGGGAGGGGCCTGGG - Intergenic
1149609367 17:57948986-57949008 GCCAGGGTGAGGCAGGAACTGGG - Intronic
1149979471 17:61298360-61298382 GACTGGGTGGGGAGGGGCCTGGG - Intronic
1151448314 17:74181602-74181624 CCCAGGGTGGGGAGGGGGCTTGG - Intergenic
1151557890 17:74855802-74855824 ACCATGCAGAGGAGGGCCCTTGG - Intronic
1151969395 17:77450111-77450133 GTGAGGGTGGGGAGGGCCGTGGG + Intronic
1152079584 17:78178428-78178450 GCCATCCTGAGGAAGGCCCTGGG - Intronic
1152314957 17:79574841-79574863 GACAGTTTGAGGAGGGCTCTGGG - Intergenic
1152436164 17:80277812-80277834 ACCATGGTGAGGAGGGTGCTAGG + Intronic
1152582410 17:81172089-81172111 GCCAGAGTGAGGAGGAACCTTGG - Intergenic
1152657360 17:81526197-81526219 GCCAGGCTGAGGAGGAGCCCAGG - Intergenic
1152743643 17:82029478-82029500 GCCAGAGAGAGAAGGGCCCTGGG + Intronic
1152862481 17:82704061-82704083 GCCAGTGTGAGTAGGGCACGTGG - Intergenic
1153457391 18:5295780-5295802 GCCAGGGTGCGGAAGGGGCTGGG - Intronic
1157393043 18:47318870-47318892 GGAAGGGTGAGGAGGGCACATGG + Intergenic
1157491683 18:48127959-48127981 GCCTTGGGGAGGAGGCCCCTTGG - Intronic
1157893352 18:51440297-51440319 GTATGGGGGAGGAGGGCCCTTGG + Intergenic
1159941641 18:74413017-74413039 GCCACGGAGATGAGGGTCCTGGG - Intergenic
1160003798 18:75053232-75053254 GACGGGGTGAGGCGGGACCTGGG - Intronic
1160697598 19:492190-492212 CCCAGGGAGAGGCGGGGCCTGGG - Intronic
1160821779 19:1062346-1062368 GCCTGGGTCGGGTGGGCCCTGGG - Intronic
1160844618 19:1160948-1160970 CCCAGGGTGGGCAGGGCCCGAGG + Intronic
1160914662 19:1490898-1490920 GCCAGGGCGAGGAGAGGCGTGGG - Exonic
1161353394 19:3805991-3806013 GCGAGGGAGAGGAGGGCGCAGGG - Exonic
1161383120 19:3977000-3977022 CCCAGTGTGAGAAGGGCTCTGGG - Intronic
1161768010 19:6217419-6217441 CCCAGAGTGGGGAGGGCCCTGGG - Intronic
1161983838 19:7643671-7643693 GCCTTGGAGAGGTGGGCCCTGGG + Intronic
1162033169 19:7925950-7925972 GCCAGGGTGAGGGGCGCGCCGGG - Exonic
1163420631 19:17211936-17211958 GCCACGGTGGGGAGGGGGCTCGG - Exonic
1163553925 19:17982210-17982232 GCCAGGGTCGGGAGGGGCCCAGG - Intronic
1163632729 19:18425456-18425478 GCCAGGGTGAGCAGGTTCCAGGG - Intronic
1163638931 19:18450749-18450771 GCCAGGGGGTCGTGGGCCCTCGG + Exonic
1163699057 19:18778041-18778063 GACAGGGCGAGGAGGGTCGTGGG - Exonic
1163721456 19:18900046-18900068 GGCAGGGTGAGGAGCCCCCTGGG - Intronic
1163795984 19:19338183-19338205 GCCTGGGGGAGGAGGGCCTCGGG - Intronic
1164556490 19:29256690-29256712 CCCAGGGCCAGGAGGGCACTGGG - Intergenic
1164801223 19:31078444-31078466 GCCAGGATGAGATGGGCCATTGG + Intergenic
1164822530 19:31261141-31261163 GCCAGGGGTGGGAGAGCCCTTGG - Intergenic
1165131523 19:33635334-33635356 GCCTGGGGGAGGAGAGCTCTGGG + Intronic
1165153963 19:33776665-33776687 ACCAAGCTGGGGAGGGCCCTGGG - Intergenic
1166194232 19:41195550-41195572 GCCAGGCTGAGGGAAGCCCTGGG + Intronic
1166270251 19:41709129-41709151 CCCAGGCTGTGGAGGGCCCTGGG + Intronic
1166407518 19:42531620-42531642 GCCTGGGTGAAGAGGGCCTGAGG + Intronic
1166744015 19:45131342-45131364 GGCAGGGTGTGGGGAGCCCTGGG - Intronic
1166748654 19:45154108-45154130 GCGAGGGTGTGGAGGGCACCGGG + Intronic
1166788212 19:45382148-45382170 GCCCGGGTGGGGGGGGCCCGAGG + Intronic
1167257035 19:48436834-48436856 GCCAGAGTGAGGGGGGGCTTGGG + Intronic
1167418590 19:49389953-49389975 GCCATGATGAGGAGAGACCTAGG + Intronic
1167572989 19:50301764-50301786 GCCTGGGTGAGGAGGATGCTGGG + Exonic
1167887821 19:52516430-52516452 TCCATGGTGAGGAGGGCCGCAGG + Intergenic
1168250383 19:55138116-55138138 GACTGAGGGAGGAGGGCCCTGGG + Intronic
1168267422 19:55230421-55230443 GTCAGGGTGATGAGGGCAATGGG + Exonic
925350921 2:3200280-3200302 GCCAGGCTGGGCAGGGACCTGGG - Intronic
925429452 2:3778487-3778509 ACCAGGGAGCAGAGGGCCCTGGG + Intronic
926049771 2:9737454-9737476 ACTAGGGTGAGTAGGGCACTAGG - Intergenic
927074580 2:19565058-19565080 TCCAGGCTTAGGAGAGCCCTGGG + Intergenic
927520682 2:23696280-23696302 GGCGGGGTGAGGAGGGGCCTGGG - Intronic
927808863 2:26171032-26171054 GCCAGGCTGGGGAAGGGCCTCGG + Intergenic
927894871 2:26775228-26775250 GCCAGGCTGAGAAGGGCTCAGGG + Intronic
927962562 2:27250106-27250128 GCCAGGGACAGGGAGGCCCTGGG + Intergenic
928085737 2:28345222-28345244 GCGAGGCTGAGGGGGCCCCTGGG - Intergenic
928376506 2:30778824-30778846 TCCCGGGTGAGGGGGACCCTGGG + Intronic
929536118 2:42785067-42785089 GCCAGGGTGCTGTGTGCCCTTGG + Intronic
929557719 2:42936082-42936104 CCCAGTGTGAGGGGGGCACTGGG - Intergenic
929952722 2:46428827-46428849 CCCAGGGTTTGGAGGGCCCCAGG - Intergenic
929979385 2:46664492-46664514 GCCAGGGTGAGGTGGGGCTGGGG - Intergenic
931150511 2:59567820-59567842 GCAAGTGGCAGGAGGGCCCTTGG - Intergenic
931322386 2:61183614-61183636 GCCAAGGTCAGGGAGGCCCTTGG + Intronic
932451406 2:71812993-71813015 GCCAGAGGGAGGAGGGGCCTGGG - Intergenic
932456027 2:71850597-71850619 CCCGGGGAGAGGAAGGCCCTAGG + Intergenic
932703557 2:74006547-74006569 GGCCTGGTGAGGAGGGGCCTGGG + Intronic
933636764 2:84716859-84716881 GCCAGGGTGAGGATGGAGCTGGG + Intronic
933724419 2:85418545-85418567 GCCCAGGTCCGGAGGGCCCTCGG + Intergenic
933794058 2:85906109-85906131 GACATGGTGAGTAGGGCACTGGG - Intergenic
936837585 2:116726911-116726933 GCCAGGGAGATGAGAGACCTAGG + Intergenic
937279983 2:120711159-120711181 GACAGGGGTGGGAGGGCCCTTGG + Intergenic
937932997 2:127220035-127220057 GCCAGGTTGGCGAGGGTCCTCGG + Intronic
938053010 2:128192242-128192264 GGCAGGAGGAGGAGGGTCCTAGG - Exonic
940596892 2:155805989-155806011 GCCAAGGAGAGGAGGGCCTCAGG - Intergenic
942386232 2:175446357-175446379 GCCAGGGGAAGGAGGGACTTCGG - Intergenic
944159386 2:196642625-196642647 GCCAAGGTCAGGAGAGTCCTTGG - Intronic
945307195 2:208269629-208269651 GCCAAGGTGATGAAGGTCCTGGG - Intronic
945347203 2:208732248-208732270 GACAGGGTCAGGAGGACACTAGG - Intronic
946251871 2:218418966-218418988 GTCAGGCTGTGGAGGGCTCTGGG + Intergenic
946396008 2:219444113-219444135 GGCAGGGTGAGGAGAGGCCGGGG - Intronic
948793979 2:240392832-240392854 GCCAGGGAGGGGAGCGCCCGGGG - Intergenic
949009798 2:241671972-241671994 GGCAGGGTGAGGAGGGCAGGGGG - Intronic
949018108 2:241724908-241724930 GACATGGGGAGGCGGGCCCTGGG + Intronic
1168922296 20:1550265-1550287 GCTAGGGAGAGGAGGTCCATGGG - Intronic
1168997798 20:2145835-2145857 GCCAGGGAGAGGGGGGTGCTGGG - Exonic
1171210782 20:23315335-23315357 GCCAGGGTGTGGAGGAGCCTTGG - Intergenic
1171256195 20:23690644-23690666 GCCAGGGTGGGGCGGGCACGAGG - Intergenic
1171272594 20:23828323-23828345 GCCAGGGTGGGGTGGGCACGAGG - Intergenic
1172250290 20:33474744-33474766 GCCAGAGGGAGGAGGACCTTCGG + Intergenic
1172385751 20:34532926-34532948 GGCAGGATGAGCAGGGTCCTGGG + Intronic
1172481544 20:35274696-35274718 ACCAGGGCCAGCAGGGCCCTAGG + Exonic
1172764307 20:37343022-37343044 GCCAGGGTCACCAGGGCACTAGG + Intergenic
1173576089 20:44113681-44113703 GCCAGGGCCAGGAGAGGCCTCGG - Intronic
1173847603 20:46197918-46197940 GCTTGGGTCAGGAGGGGCCTGGG + Intronic
1174455422 20:50645434-50645456 GCCAGGGCGAGGTGGGGCCGGGG + Intronic
1175190799 20:57211098-57211120 GTCAGGGTGCTGAGGGCCCCCGG - Intronic
1175507425 20:59495754-59495776 GCGAGTGTGAGGACAGCCCTGGG - Intergenic
1175802775 20:61810568-61810590 GGCAGGGTGAGGCGGGCACACGG - Intronic
1175992608 20:62796972-62796994 GCCAGGGTGTGGAGGGGCTGTGG - Intronic
1176044277 20:63084286-63084308 CCCCGGGCGAGGAGGGCACTGGG - Intergenic
1176080410 20:63269769-63269791 GCCAGGACCAGGTGGGCCCTGGG - Intronic
1176125165 20:63471884-63471906 CCCAGGCTGAGGAGGGGGCTGGG + Intronic
1176137205 20:63529488-63529510 GCCCTGCTGAGGAGGGGCCTGGG - Exonic
1176159323 20:63640553-63640575 GCCCTGGTGGGGAGGGGCCTGGG + Exonic
1178065866 21:28903662-28903684 GCCAGGCTGAGGAGGCTGCTGGG + Intergenic
1178662835 21:34521482-34521504 GGCCAGGTGAGCAGGGCCCTCGG - Exonic
1178958303 21:37042634-37042656 CCCTCGGGGAGGAGGGCCCTGGG - Intergenic
1179106393 21:38404453-38404475 GACAGGGAGAGCAGGGCCCGGGG + Intronic
1179543686 21:42100723-42100745 GGGAGGGTGAGGAGGGCACGGGG - Intronic
1179543715 21:42100791-42100813 GGGAGGGTGAGGAGGGCACAGGG - Intronic
1179543728 21:42100825-42100847 GGGAGGGTGAGGAGGGCACGGGG - Intronic
1179543743 21:42100859-42100881 GGGAGGGTGAGGAGGGCACGGGG - Intronic
1179543758 21:42100893-42100915 GGGAGGGTGAGGAGGGCACGGGG - Intronic
1179780385 21:43696415-43696437 GCTAGGGTGAGGCGGGCACAGGG + Intergenic
1179876769 21:44272670-44272692 GCCAGGGTGAGGATGCGCCTCGG + Intergenic
1179914305 21:44466652-44466674 GCCACGGTGAGCAGTGCCCAGGG + Intergenic
1180258684 21:46651335-46651357 GCCGGGGTAGGGAGGGCCCTGGG + Intronic
1180702554 22:17789548-17789570 GCCAGGGTGAGGCAGGCACCGGG + Exonic
1180897985 22:19351183-19351205 GCCAGGTTGTGGAGGGCCGTCGG + Intronic
1180955402 22:19739125-19739147 CACAGGGTGTGGGGGGCCCTGGG + Intergenic
1181028858 22:20140549-20140571 GCCAGGGTGGGCAGGGGGCTGGG - Intronic
1181038941 22:20182901-20182923 GGCAGGGGTGGGAGGGCCCTGGG + Intergenic
1181540214 22:23569009-23569031 TCCTGAGAGAGGAGGGCCCTGGG + Intergenic
1181802770 22:25358223-25358245 ACCAGGGCTAGGAGGGACCTTGG + Intronic
1182245354 22:28953134-28953156 ACCAGGGTGTCAAGGGCCCTAGG + Intronic
1182446910 22:30395089-30395111 GCCAAGGTGTGGACGGGCCTGGG - Intronic
1182922742 22:34095151-34095173 GCCAGGGTGAGTTGGACCATAGG - Intergenic
1183306222 22:37084570-37084592 GCCAGGGTGGAGAGGGCTGTGGG - Intronic
1184067155 22:42127419-42127441 GCTGGGGTGAGGAGGGCGCCAGG + Intronic
1184069880 22:42141124-42141146 GCTGGGGTGAGGAGGGCGCCAGG + Intergenic
1184913124 22:47549308-47549330 GCCCGAGAGAAGAGGGCCCTGGG - Intergenic
1185098801 22:48826549-48826571 GCCAGGGAGACAAGGGGCCTAGG - Intronic
1185134844 22:49063681-49063703 GCCAGGGTGTGCAGAGCCCCTGG + Intergenic
1185161063 22:49230162-49230184 GCCAGGGTGAGAAAGGGCCAGGG + Intergenic
1185268830 22:49918979-49919001 TCCAGGGTGAGGGCGACCCTGGG - Intronic
1185281973 22:49976070-49976092 GCCAGGGTGGGGACAGGCCTTGG + Intergenic
1185334491 22:50265565-50265587 CCCTGGGTGAGGACTGCCCTGGG - Exonic
949922064 3:9010603-9010625 TCCAGGGCTAGGAGGGCACTGGG - Intronic
950017040 3:9761614-9761636 ACGTGGGTGCGGAGGGCCCTGGG - Exonic
950707820 3:14793874-14793896 CCCAGGGTGGCGAGGGGCCTGGG - Intergenic
951988518 3:28649177-28649199 GCCAGAGTAACGAGGGCTCTGGG - Intergenic
952968609 3:38636781-38636803 GCCAGGGTGAGGAGGGCTCAGGG + Intronic
953419618 3:42744304-42744326 ACCAGGGTCAGAAGGACCCTAGG - Intronic
953906408 3:46870489-46870511 GGCAGAGTGGGGAGAGCCCTGGG - Intronic
953998116 3:47536219-47536241 GGCAGGGTGAGGGTGGCCCCCGG + Intergenic
954108492 3:48421630-48421652 GCCCTGGTGGGGAGGGCTCTGGG - Intronic
954300781 3:49699719-49699741 GCCAGTGTGAGGAGGACGGTGGG - Exonic
954579624 3:51696253-51696275 GCCAGGGCTAGGAGGACCCCAGG + Intronic
954638742 3:52085556-52085578 GCCAGGGCAAGGAGGCTCCTAGG - Intronic
954646931 3:52137375-52137397 GCCATGCTGAGGGAGGCCCTGGG - Intronic
954793885 3:53151703-53151725 GCCAAGGTCAGGAGTGTCCTGGG - Intergenic
955460989 3:59183056-59183078 ACCAGGGTGAGATGGGCCATTGG + Intergenic
958044428 3:88266639-88266661 GTCAGGCTCAGGAGGGCTCTGGG + Intergenic
958712594 3:97736081-97736103 ACCAGGGTGTGAAGGGCACTGGG - Exonic
961450641 3:127000889-127000911 GCCAGTGTGAGCGGGGCACTGGG - Intronic
963238662 3:142981229-142981251 GCCAGGGAGAGAAGGCTCCTTGG - Intronic
963275043 3:143321397-143321419 GCAAGGGTCAGGAGGATCCTTGG - Intronic
964732552 3:159882871-159882893 GCCAGGAGCAGGAGGGCACTTGG - Intronic
966496323 3:180585661-180585683 GCCAGGATGAGGAAACCCCTAGG - Intergenic
967811629 3:193765766-193765788 GCCACAGTGAGGAGGGCTCAGGG + Intergenic
968630510 4:1648484-1648506 GCCGCGGTCAGGAGGGCTCTGGG + Intronic
968844899 4:3035535-3035557 GCCAGGACGAGCAGGGCCCTAGG + Intronic
969494732 4:7520055-7520077 GCCCTGGTGATGAGGGCCCTTGG + Intronic
969788692 4:9477160-9477182 GGCAAGGGAAGGAGGGCCCTGGG + Intergenic
969794968 4:9520491-9520513 GGCACGGTGAGCAGGGCCATCGG - Intergenic
970431148 4:15990317-15990339 GCCATGGTGACGAGGAACCTGGG - Intronic
971015917 4:22488552-22488574 GCAAGCGTGAAGAGGGCCATGGG + Intronic
971258707 4:25036465-25036487 GCCAGGGTCCTGAGGGCCTTTGG - Intergenic
972960642 4:44448403-44448425 GCGAGGGTGCGCAGGGCCCCGGG + Exonic
975800716 4:78057260-78057282 GCCTGGGTGAGGAGGGCTGCGGG - Intergenic
981315266 4:143335684-143335706 GCCAGAGTGATGGGGGCGCTTGG - Intergenic
982746025 4:159104122-159104144 GCCAGGGTGCGGAGCGGCCCCGG + Intergenic
985523765 5:391524-391546 GGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523780 5:391573-391595 GGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523807 5:391671-391693 GGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523822 5:391720-391742 GGCAGGGCGAGGAGGGCGCAGGG + Intronic
985523837 5:391769-391791 GGCAGGGCGAGGAGGGCGCAGGG + Intronic
985591394 5:767185-767207 TCCAGGGTGTGGAGGACCCTGGG + Intergenic
985825392 5:2187216-2187238 GGCAGGGTGAGGAGCAACCTTGG + Intergenic
986725768 5:10595196-10595218 GCCAGGTGGAGGAGCGGCCTGGG + Intronic
986808759 5:11333722-11333744 GCCAGGGTCAGTAGAGCCTTTGG - Intronic
993332527 5:86618105-86618127 GCCACTATGAGGAGGGCCCTGGG + Exonic
994067367 5:95558244-95558266 GCCAGGGCAATTAGGGCCCTAGG - Intronic
997120797 5:131171003-131171025 GCCGCGGTGAGGAGAGCCATGGG + Exonic
997338351 5:133123352-133123374 GCCAGAGTCAGCAGGGCCCATGG - Intergenic
997469236 5:134107577-134107599 ACCAGGGTGGGGAGGGCACCAGG - Intergenic
997978534 5:138454439-138454461 GCCAGTGTGGGGAGGGGCGTGGG + Intergenic
998043293 5:138967145-138967167 GCCAGAGTGTGCAGGGCCCAAGG - Intronic
999130532 5:149279744-149279766 GCCAGTGTGAGAAGAGCCCAGGG - Intronic
1001804327 5:174570533-174570555 GCCTTGGTTGGGAGGGCCCTTGG + Intergenic
1002086181 5:176777087-176777109 GTCAGGGTCAGGAGGGACCGAGG - Intergenic
1002097009 5:176837398-176837420 GCCAGGCAGAGTAGGGCTCTGGG - Intronic
1002417452 5:179127859-179127881 GCCAGCGTGAGCAGGGGCCGAGG - Intronic
1002422132 5:179154286-179154308 GCCAAGGTCAGGAGGCCCGTTGG - Intronic
1003164325 6:3663181-3663203 GCCACGGTGAGGATGGCACGGGG - Intergenic
1006255577 6:32829664-32829686 CCCAGTGGGAGGAGGGCCATGGG + Intronic
1006475214 6:34248764-34248786 GCCAGGGTGGGGAGGGCGTCAGG + Intronic
1007321936 6:41033938-41033960 GCCAAGGTATGGAGGCCCCTGGG - Exonic
1007717964 6:43868230-43868252 GCCAGGGTGAGGCAGTCCATGGG + Intergenic
1007760241 6:44128745-44128767 GCCAGGGTGAGGTGGGGAGTGGG + Intronic
1008034871 6:46735163-46735185 GCCTGAGTGAGGAGGGGCCCCGG - Exonic
1009890383 6:69673563-69673585 ACCTGGGGGAGGAGGGACCTAGG + Intergenic
1012423047 6:99085437-99085459 GGCAGGGTGAGCAGTTCCCTGGG + Intergenic
1012501044 6:99888475-99888497 GCCAGGATCAGTTGGGCCCTGGG - Intergenic
1013832125 6:114285665-114285687 GTCAGGGTGGGGAGGGCGGTGGG + Intronic
1015692108 6:135936996-135937018 GTCAGAGTGAGGAGGGCCTCTGG + Intronic
1016864118 6:148748309-148748331 GCCAGGCTGACCAGCGCCCTCGG - Intronic
1016997299 6:149969728-149969750 GCCAGGGAGGGGAGGGCCTCAGG - Intronic
1017094102 6:150789060-150789082 GAGAGGGAGAGGAGGACCCTGGG + Intronic
1017180826 6:151550343-151550365 CACAGGCTGAGGAGGGGCCTGGG + Intronic
1017376578 6:153776617-153776639 GCAAGGGTGAGGAGCCACCTGGG - Intergenic
1017746064 6:157447620-157447642 GGCAGGGTGAGGAAGACCCGGGG + Intronic
1017898812 6:158703376-158703398 GGCAGGGTGGTGGGGGCCCTTGG + Intronic
1018697981 6:166405568-166405590 GTCAGGCTCAGGAGGGCCCCTGG + Intergenic
1018854388 6:167665272-167665294 GCACGGGGGAGGAGGGGCCTGGG - Intergenic
1018906398 6:168078717-168078739 ATGGGGGTGAGGAGGGCCCTGGG - Intronic
1018906425 6:168078791-168078813 GTGGGGGTGAGCAGGGCCCTGGG - Intronic
1018906452 6:168078865-168078887 GTGGGGGTGAGCAGGGCCCTGGG - Exonic
1019147413 6:169984210-169984232 TCCAGGGTGACGAGGGCCCCTGG + Intergenic
1019285240 7:220013-220035 CCCAGGGTGAGGAGCGGGCTTGG - Intronic
1019555941 7:1631416-1631438 GCCAGAGTGTGAAGGGCCCTGGG - Intergenic
1019643935 7:2119209-2119231 GAGAGGGAGAGGAGGGCACTGGG - Intronic
1019775912 7:2912155-2912177 GCCAAGGTGAGGCGGGGACTGGG - Exonic
1021941679 7:25685227-25685249 GCATGGGTGAGGAAGGCCATGGG - Intergenic
1023247963 7:38226853-38226875 GCTAGGGTGAGGCAGGCCATGGG - Intronic
1023551052 7:41370048-41370070 TCCAAGGTGAGGAGGGACCAGGG + Intergenic
1023858543 7:44201424-44201446 GGCGGGGTGGGGAGGGCCCGGGG + Intronic
1025078671 7:55964476-55964498 GCCAGGGGGAGCAGGGCGCGCGG - Intronic
1025806019 7:64835517-64835539 ACCAGGGTGGAGAGGGTCCTAGG + Intergenic
1026045164 7:66902029-66902051 GCCAGTGTGAGGCGGGAGCTGGG - Intergenic
1026130817 7:67619420-67619442 GCCGGGGACGGGAGGGCCCTGGG + Intergenic
1028774005 7:94658002-94658024 GCCAGAGAGAGGTGGGGCCTGGG - Intronic
1029283309 7:99450378-99450400 GCCAGGGTGGGCTGGGCCCCGGG + Intronic
1032248692 7:130234339-130234361 CCCAGGTGGAGGAGGGCCCCAGG + Intergenic
1032403874 7:131642064-131642086 GCCAGGGTGACGCAGCCCCTAGG + Intergenic
1032715709 7:134507480-134507502 GCCAGGCTCAGGATGGCCCAGGG - Intergenic
1034228710 7:149502168-149502190 TCCAGGGTGAGGAGGGATGTGGG - Intergenic
1034275107 7:149820611-149820633 CCCAGAGTCAGGAGGGCCCAGGG - Intergenic
1034422741 7:150997903-150997925 GTCAGGATGAGCAGGGTCCTAGG + Intronic
1034952985 7:155313504-155313526 GCCTGGGTCAGCAGGCCCCTGGG - Intergenic
1035046761 7:155972932-155972954 GTCAGAGAGAGGAGAGCCCTGGG - Intergenic
1035228563 7:157446927-157446949 GCCAGGATGAGGAGGGCCCCCGG - Intergenic
1035312585 7:157979035-157979057 GCCTGGGGGAGGGCGGCCCTTGG - Intronic
1035376648 7:158411055-158411077 GCCAGGGAGGAGAGGGCCCCGGG - Intronic
1035633709 8:1127633-1127655 GACAGGGAAAGGAGGGGCCTGGG - Intergenic
1036903872 8:12691563-12691585 GGCAAGGGAAGGAGGGCCCTGGG - Intergenic
1037753557 8:21697459-21697481 GCCAGGGGCAACAGGGCCCTTGG + Intronic
1037812761 8:22096633-22096655 GCCAGGCTGAGGTGGGCGGTGGG + Intronic
1038778594 8:30552132-30552154 GCCAGGGTGAGAATGGTCCGTGG + Intronic
1040319781 8:46286713-46286735 GTGAGGGTGGGCAGGGCCCTGGG - Intergenic
1041908138 8:63055844-63055866 GCCTGGGTGTGGAGGGCTGTGGG + Intronic
1043147776 8:76678254-76678276 GCCAGCGTGAGGAGGGCTGTTGG - Intergenic
1045472995 8:102529029-102529051 GCCGGGGTGGGGCGGGGCCTGGG - Intronic
1048484211 8:134832118-134832140 GCCAGGGTGAGGGGCGCGCGAGG + Intergenic
1048507351 8:135033564-135033586 GACAGGATGGTGAGGGCCCTGGG + Intergenic
1048991453 8:139762748-139762770 GCCAAGGTGCGGAGGGCACCTGG + Intronic
1049383838 8:142331057-142331079 GGCAGGGTGAGCAGAGCCCAGGG + Intronic
1049403725 8:142442504-142442526 GCCAGGGCCAGGAGGAACCTGGG + Intergenic
1049587716 8:143439828-143439850 CCCTTGGTGAGGGGGGCCCTGGG + Intronic
1049587773 8:143439992-143440014 TCCTTGGTGAGGGGGGCCCTGGG + Intronic
1049587792 8:143440046-143440068 TCCTTGGTGAGGGGGGCCCTAGG + Exonic
1049598776 8:143497632-143497654 GCTGCGGTCAGGAGGGCCCTGGG + Intronic
1049718638 8:144105361-144105383 CCCAGGGTGAGCAGGGTCCCCGG + Intronic
1049750045 8:144278748-144278770 GCTAGCGTGGGCAGGGCCCTAGG - Intronic
1049789347 8:144465823-144465845 GCCTGGGTGGGGCGGGGCCTGGG + Intergenic
1049805098 8:144535113-144535135 GCCAGGGTGAGGGGGGCCTCTGG + Intronic
1051377576 9:16419250-16419272 GCCAGGGAGGGCAGGGGCCTCGG + Exonic
1056495050 9:87148222-87148244 TCCTGGCTGAGGAGGGCCCGGGG + Intergenic
1057436824 9:95048439-95048461 GGCGGGGTGAGGCGGGGCCTGGG + Intronic
1057758062 9:97853053-97853075 GTCAGGGCGGGGAGGGCGCTTGG - Intergenic
1057814715 9:98285971-98285993 CCCAGGGTGAGGAGACCCCCAGG + Intergenic
1059485565 9:114624131-114624153 GCCAGAGGGAGGAGGCTCCTAGG - Intronic
1060399595 9:123340548-123340570 GGCAGGGAGTGGGGGGCCCTGGG - Intergenic
1060447046 9:123699510-123699532 GCCAGGGTGAGGGGGGAACCTGG - Intronic
1060823426 9:126674128-126674150 GACAGAGTGAGGAGGGCTCCAGG + Intronic
1060827135 9:126693807-126693829 GCCAGGGTGAGCCGGGGCCGGGG + Exonic
1060827151 9:126693840-126693862 GCCAGGGTGAGCTGGGGCCGGGG + Exonic
1060860883 9:126954012-126954034 GGCAGTGTGTGGAGGGCGCTGGG - Intronic
1061167763 9:128934053-128934075 GCCACGGTGAGCAGGGGCTTGGG + Exonic
1061390957 9:130316778-130316800 GTCTGTGTGAGGAGGGGCCTGGG + Intronic
1061422179 9:130478380-130478402 GGCAGGCTGCGGAGGGTCCTGGG + Intronic
1061483561 9:130908995-130909017 GCCGGGGTCAGGAGGGCTCCAGG - Intronic
1061587094 9:131576268-131576290 GACAGAGTGAGGAGGCCCCAGGG - Intergenic
1061988271 9:134143053-134143075 GCCAGGCTGGGAAGGGCACTGGG + Intronic
1061997540 9:134194117-134194139 GCATGGGTGAAGTGGGCCCTGGG + Intergenic
1062049441 9:134439470-134439492 TCCAGGGTGCGGAGGGCCGGCGG - Intronic
1062056030 9:134470191-134470213 CCCAGGCTCAGGAGGGCCCCAGG - Intergenic
1062056085 9:134470388-134470410 CCCAGGCTCAGGAGGGCCCCAGG - Intergenic
1062100005 9:134723123-134723145 GCTGGGCTGAGGAGGGCACTGGG - Intronic
1062169256 9:135125652-135125674 CCCAGGGAGAGGAGGGCCCAGGG - Intergenic
1062267578 9:135694370-135694392 GGCCGGGTGAGTGGGGCCCTGGG - Exonic
1062428584 9:136517107-136517129 GCCGGGGTGCGGACGGCCCGAGG + Intronic
1062503059 9:136859461-136859483 GGCAGAGTGAGGAGGGCACAGGG - Intronic
1062538307 9:137030462-137030484 TTCAGGGTGGGGAGGGTCCTCGG + Exonic
1062577237 9:137214439-137214461 GGCAAGGTGAGGTGGGCCGTGGG + Intronic
1185455365 X:307715-307737 GCCCGGGTGAGTCCGGCCCTGGG - Exonic
1185848736 X:3465248-3465270 AGCAGGGTTGGGAGGGCCCTGGG - Intergenic
1186126303 X:6418200-6418222 GCCCAGGTGAAGAGGGCCATGGG + Intergenic
1186200212 X:7148591-7148613 GCCTTGGTCAGGAGGTCCCTGGG + Intergenic
1187389365 X:18875722-18875744 GCCAGGCTGAGGAGGTCACGTGG + Intergenic
1187500229 X:19833198-19833220 GAAAGAGGGAGGAGGGCCCTGGG - Intronic
1187500357 X:19833641-19833663 GGAAGAGAGAGGAGGGCCCTGGG - Intronic
1189228309 X:39432133-39432155 GCCAGGGAGGGGAGGCCTCTGGG + Intergenic
1189250585 X:39598268-39598290 CCCAGGGAGAGGTGGGACCTTGG + Intergenic
1189498246 X:41529219-41529241 GCCGGGGTGAGGAGGTGCTTTGG + Intronic
1189783960 X:44542865-44542887 GCCAGGGAGAGGAGGGCGGGTGG - Exonic
1190277739 X:48910086-48910108 GCCATGGCTAGGAGGGTCCTGGG - Intronic
1194426520 X:93745605-93745627 GGCAGGCAGAGGAGGGCACTGGG + Intergenic
1194584669 X:95717795-95717817 GCTAGGTTGAGGAGGTGCCTAGG + Intergenic
1195167870 X:102238436-102238458 GGCATAGTGAGGAGAGCCCTGGG - Intergenic
1195190987 X:102448651-102448673 GGCATAGTGAGGAGAGCCCTGGG + Intronic
1195960299 X:110379004-110379026 GCCAGAGTGAGCAGGCCCCATGG - Intronic
1200062004 X:153487913-153487935 GCCTGAGTGAGGGGGCCCCTGGG + Intronic
1200086799 X:153611081-153611103 GACAGGGTGAGGAGGCGCCCTGG + Intergenic
1200814907 Y:7521582-7521604 AGCAGGGTTGGGAGGGCCCTGGG + Intergenic
1201151904 Y:11099290-11099312 GCCACGGAGAGGGGGGTCCTGGG - Intergenic
1201900732 Y:19044400-19044422 GCCAGGCTGAGGAGCTACCTAGG + Intergenic
1202091802 Y:21198689-21198711 GCCAGGGGGTGGAGGGCTATGGG - Intergenic