ID: 1103613863

View in Genome Browser
Species Human (GRCh38)
Location 12:122140059-122140081
Sequence ATCCCTGTCATTAATAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103613857_1103613863 14 Left 1103613857 12:122140022-122140044 CCTCTGTGTTGCTGTTTTACTGC 0: 1
1: 0
2: 0
3: 13
4: 227
Right 1103613863 12:122140059-122140081 ATCCCTGTCATTAATAGAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 98
1103613856_1103613863 26 Left 1103613856 12:122140010-122140032 CCAGCTCTGATTCCTCTGTGTTG 0: 1
1: 0
2: 3
3: 26
4: 246
Right 1103613863 12:122140059-122140081 ATCCCTGTCATTAATAGAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 98
1103613859_1103613863 -8 Left 1103613859 12:122140044-122140066 CCTGCCCTGGTCCTGATCCCTGT 0: 1
1: 0
2: 4
3: 41
4: 370
Right 1103613863 12:122140059-122140081 ATCCCTGTCATTAATAGAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103613863 Original CRISPR ATCCCTGTCATTAATAGAGC TGG Intronic
900252044 1:1675990-1676012 GTCCCTCTCGTTACTAGAGCGGG - Intronic
900262455 1:1738848-1738870 GTCCCTCTCGTTACTAGAGCGGG - Intronic
902184270 1:14713410-14713432 ATCACTGTCATTTACGGAGCTGG + Intronic
902829600 1:19003236-19003258 ATTTCTGTCATTGATAGAACAGG + Intergenic
903112870 1:21152100-21152122 TTCCCTGTCAGTTATAGATCCGG - Intronic
905607066 1:39310939-39310961 ATCTCTGTCAGTCCTAGAGCTGG - Exonic
907464734 1:54627603-54627625 AGCCATTTTATTAATAGAGCTGG + Intronic
911376908 1:97062218-97062240 ATCCCTGGCTTCAAAAGAGCAGG - Intergenic
915113095 1:153577274-153577296 ATGTCTGTGATTAATAGACCAGG + Intergenic
915240025 1:154514644-154514666 ATCCCTGGCAGTAATACAGGTGG - Intronic
915356083 1:155255748-155255770 TTCCCCGTCATTAATGGAGAGGG + Intergenic
916617445 1:166457399-166457421 ATTCTTGTAATGAATAGAGCAGG - Intergenic
924445728 1:244128536-244128558 ATCACTGTGGTTAAAAGAGCTGG - Intergenic
1063192658 10:3712013-3712035 ATCCCTGCCATTTCTAGATCTGG + Intergenic
1068666406 10:59680152-59680174 ATCCCTGGGATGAATAAAGCTGG - Intronic
1073746628 10:106476220-106476242 ATCAATGTCATTAAAAGACCAGG + Intergenic
1075361481 10:121839203-121839225 ATCCCTGCAAATACTAGAGCTGG - Intronic
1080365263 11:31566992-31567014 CTCTCTGTCATTAATAGCACTGG + Intronic
1080492938 11:32785876-32785898 ATCCCTGGTATTAATAGATGAGG - Intronic
1085787749 11:79469992-79470014 ATGCCTGTCATTAGTAGAAGTGG - Intergenic
1088416181 11:109591345-109591367 ATACCTGTGAATAATAGAGATGG - Intergenic
1091112279 11:132980876-132980898 ATCCCTGTCATTAAGTGACACGG - Intronic
1091222955 11:133941224-133941246 AGCCCTGTAATTAATAGTGCAGG + Intronic
1099268146 12:80474227-80474249 ATCCTTTTCATTAATACAACAGG + Intronic
1100069578 12:90696135-90696157 ATCCCTGCCATGAATAGACTAGG + Intergenic
1100127024 12:91439660-91439682 ATCCCTGTCATTGTTCCAGCCGG + Intergenic
1103613863 12:122140059-122140081 ATCCCTGTCATTAATAGAGCTGG + Intronic
1107056986 13:36116612-36116634 ATCCTTCACATTACTAGAGCTGG + Intronic
1109238450 13:59852867-59852889 CTGCCTGTCATTAACAGTGCAGG - Intronic
1110101942 13:71617041-71617063 AACCCTGTCTCTAATAAAGCCGG - Intronic
1114257452 14:21015524-21015546 ATCACTGTCCTTCATAGAACTGG - Intergenic
1118031342 14:61821089-61821111 AAACCTGACACTAATAGAGCTGG - Intergenic
1119650784 14:76381368-76381390 AGCCCTGCCATTATTAGAGAAGG - Intronic
1128689291 15:69711006-69711028 CTCCCTGGCATAACTAGAGCTGG - Intergenic
1138782586 16:59807393-59807415 ATCAGTGTCATTAATGCAGCAGG + Intergenic
1139110727 16:63887365-63887387 ATTCCTGTACTTAATAGTGCAGG - Intergenic
1149958343 17:61078666-61078688 TTCCCTGTCATTACTTGAGATGG + Intronic
1153620231 18:6970407-6970429 ATCACTGTGATTTATAGAGGTGG + Intronic
1156928727 18:42615560-42615582 ATCCCTGTTGTTAATAAAGTAGG - Intergenic
1157565920 18:48679313-48679335 ATCCCTGTCATTATATGAACTGG - Intronic
1159123901 18:64200960-64200982 CTGCCTGTCATTCAGAGAGCGGG + Intergenic
1160759612 19:776616-776638 ATTCCTGTTATAAATAGGGCTGG - Intergenic
1167444504 19:49529303-49529325 GTCCCTGCCATTTACAGAGCAGG - Intronic
1167853057 19:52216408-52216430 GCCCCTCTCATTCATAGAGCAGG - Intronic
1168460319 19:56549913-56549935 AGCCCTGTCATTATTTGACCTGG + Intronic
925758793 2:7163517-7163539 ATCCATGACCTTGATAGAGCTGG - Intergenic
928498420 2:31860220-31860242 ATCCTTGAGATTAACAGAGCAGG + Intergenic
929307892 2:40386219-40386241 CTACCTGTTATTAATACAGCTGG + Intronic
929468085 2:42164009-42164031 ATCCCTGCCATTAAAAGACCTGG + Intergenic
931098587 2:58970242-58970264 ATCCCTCTAATTACTAGAGTGGG - Intergenic
931215909 2:60244459-60244481 TTCCATGTCATTACTAGAGTGGG - Intergenic
934334770 2:92117120-92117142 ATCACTCCCTTTAATAGAGCAGG + Intergenic
934401562 2:93236122-93236144 ATCACTCCCTTTAATAGAGCAGG + Intergenic
936593469 2:113825621-113825643 AGCCCTTTCAGTAATAGAACTGG + Intergenic
937585912 2:123549518-123549540 ATCCCTACCAAGAATAGAGCTGG + Intergenic
938083951 2:128386085-128386107 ATCCCTGCCAAGAAGAGAGCAGG + Intergenic
942902156 2:181133952-181133974 AACCGTGTCTTTAAAAGAGCAGG + Intergenic
944881681 2:204019111-204019133 ATCCCTGACATTCCTAGACCAGG + Intergenic
945398835 2:209354688-209354710 ATACCTAACATTAAGAGAGCAGG - Intergenic
1169862600 20:10168359-10168381 TTGCCTATCATTAATGGAGCAGG - Intergenic
1176216632 20:63951204-63951226 ATGCCTGATATTAATAGCGCTGG + Intronic
1178283280 21:31303362-31303384 ATCTCTGTCATTCACAGATCTGG + Intronic
1179412229 21:41170671-41170693 CTCCTGGCCATTAATAGAGCAGG - Intronic
1181901147 22:26156795-26156817 AGCCCTCTGATTAATAGAGGAGG - Intergenic
1202717104 2_KI270715v1_random:18624-18646 ATCACTCCCTTTAATAGAGCAGG + Intergenic
1202729418 2_KI270716v1_random:47132-47154 ATCACTCCCTTTAATAGAGCAGG + Intergenic
959273290 3:104242027-104242049 ATCCCTGGCCTTTATAGACCTGG + Intergenic
961366708 3:126404650-126404672 CTCCCGGTCATTCACAGAGCAGG + Intronic
962228978 3:133643293-133643315 ATTCCTGTCATTACTGGAACTGG + Exonic
968653613 4:1769526-1769548 AACCCTGTCATTACTTGATCGGG - Intergenic
970513744 4:16806526-16806548 AGCCCTGCCATTAAGTGAGCAGG + Intronic
974171645 4:58274259-58274281 ATCCCTTTCTTTCATAAAGCTGG + Intergenic
976201516 4:82584142-82584164 ATCCCTGTCATTCCTACAGATGG + Intergenic
976899094 4:90151976-90151998 ATTCCTTTACTTAATAGAGCTGG - Intronic
1003630827 6:7785282-7785304 ATTGCTGTAATTAATATAGCTGG + Intronic
1003762170 6:9191839-9191861 ATCCCTGTAATTAATGAAGAGGG + Intergenic
1006125064 6:31832448-31832470 ATCTCTTTCATTAATAAAACAGG - Intergenic
1011935331 6:92770003-92770025 ACCCCTGCCATGAATCGAGCAGG + Intergenic
1015012660 6:128370264-128370286 ATCCCTGTTATTGATGTAGCTGG + Intronic
1017878704 6:158544790-158544812 GTCCCTGTTATAAAAAGAGCAGG - Intronic
1018181366 6:161226349-161226371 AGCCCTGTCATTAATCAGGCAGG + Intronic
1018649714 6:165983194-165983216 CTCCCTGACCTTAATAGATCCGG - Intronic
1023222746 7:37936530-37936552 ATCCATATCATTGATAGAGATGG - Intronic
1026535940 7:71238596-71238618 ATCCCAGTCATTCACAGGGCTGG - Intronic
1030412365 7:109197516-109197538 ATCCCTAACAAAAATAGAGCTGG - Intergenic
1032842402 7:135724687-135724709 AATCCTGTCCTTAATACAGCTGG - Intronic
1036030991 8:4972757-4972779 ATGCCTGTCATTTAGATAGCTGG - Intronic
1038773575 8:30507079-30507101 ATCCCTGGCACAAATAGAGCAGG - Intronic
1042995293 8:74691539-74691561 TTCCCAGTGATAAATAGAGCTGG + Intronic
1046142109 8:110107477-110107499 ATACCTGTCAGTGATAGAGTGGG + Intergenic
1047860023 8:128955651-128955673 ATCCTTGTCATTGCTAGAGGAGG + Intergenic
1048458962 8:134603864-134603886 AGCTCTGTCAGTAATAGAGCTGG + Intronic
1048698394 8:137055465-137055487 ATCACTGTCCTTAATAGAAGGGG - Intergenic
1048863903 8:138744933-138744955 TTCCCTGTCATCAATAGATGAGG - Intronic
1050227029 9:3470817-3470839 ATCCTTGTCTTTAAATGAGCAGG + Intronic
1053319804 9:37086651-37086673 ATTCCTTTCATAAATAGATCTGG + Intergenic
1058205939 9:102107612-102107634 TTCCCTCTGATTAATATAGCAGG + Intergenic
1058978978 9:110151825-110151847 AGCCCTGACATTTACAGAGCAGG - Intronic
1059832971 9:118119074-118119096 ATCACTGCCATTCAGAGAGCTGG + Intergenic
1187351171 X:18518848-18518870 ATTCATGTCAATAATAAAGCGGG + Intronic
1187908267 X:24087288-24087310 ATTCCTATCAACAATAGAGCAGG + Intergenic
1188527599 X:31103087-31103109 AACCATGTCCTTAATATAGCAGG + Intronic
1191755484 X:64587962-64587984 ACCACTGTCATAGATAGAGCTGG - Intergenic