ID: 1103614843

View in Genome Browser
Species Human (GRCh38)
Location 12:122145541-122145563
Sequence CTTACCTGCACCCCAGCTGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 242}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103614843_1103614846 -6 Left 1103614843 12:122145541-122145563 CCGGCAGCTGGGGTGCAGGTAAG 0: 1
1: 0
2: 5
3: 32
4: 242
Right 1103614846 12:122145558-122145580 GGTAAGGGTCTCTCTCATAGAGG 0: 1
1: 0
2: 0
3: 2
4: 79
1103614843_1103614850 20 Left 1103614843 12:122145541-122145563 CCGGCAGCTGGGGTGCAGGTAAG 0: 1
1: 0
2: 5
3: 32
4: 242
Right 1103614850 12:122145584-122145606 GCTGCAGCTGAGAACTGGCGAGG 0: 1
1: 0
2: 0
3: 9
4: 170
1103614843_1103614847 -5 Left 1103614843 12:122145541-122145563 CCGGCAGCTGGGGTGCAGGTAAG 0: 1
1: 0
2: 5
3: 32
4: 242
Right 1103614847 12:122145559-122145581 GTAAGGGTCTCTCTCATAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 74
1103614843_1103614848 -4 Left 1103614843 12:122145541-122145563 CCGGCAGCTGGGGTGCAGGTAAG 0: 1
1: 0
2: 5
3: 32
4: 242
Right 1103614848 12:122145560-122145582 TAAGGGTCTCTCTCATAGAGGGG 0: 1
1: 0
2: 0
3: 10
4: 82
1103614843_1103614849 15 Left 1103614843 12:122145541-122145563 CCGGCAGCTGGGGTGCAGGTAAG 0: 1
1: 0
2: 5
3: 32
4: 242
Right 1103614849 12:122145579-122145601 GGGGAGCTGCAGCTGAGAACTGG 0: 1
1: 0
2: 2
3: 25
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103614843 Original CRISPR CTTACCTGCACCCCAGCTGC CGG (reversed) Exonic
900517188 1:3088128-3088150 CTGACCTCCACCGCTGCTGCCGG + Intronic
900782004 1:4624508-4624530 CCCACCTGCACCGCAGCTGAAGG + Intergenic
900929413 1:5726833-5726855 CTCACCTGCAGCCTTGCTGCAGG + Intergenic
901056296 1:6450067-6450089 CTTAGCTTCAGCCCTGCTGCAGG - Intronic
902125082 1:14202482-14202504 CTTCCCTGCACCCCAGCACCTGG - Intergenic
902205842 1:14867470-14867492 CTTACCTGGAGCCCAGCTGGAGG - Intronic
902350474 1:15849732-15849754 CTTACCCGCCCCCCACCTCCTGG + Intronic
902470726 1:16646347-16646369 CTGACCTGCACCCACTCTGCAGG + Intergenic
905648302 1:39639748-39639770 CTTTCCTGCGCCGCAGCTCCGGG + Exonic
906710496 1:47926406-47926428 CTTTCCTCCTCCCCAGATGCTGG - Intronic
907538208 1:55185071-55185093 CTTCCCAGCTCCCCAGCAGCTGG + Intronic
907593827 1:55701587-55701609 CTTTCCTGTCCCCCAGCAGCAGG + Intergenic
911695269 1:100883397-100883419 CTGACCTCCATCCCAGCTCCAGG + Intronic
912140001 1:106713138-106713160 CTTACTTGCACTGCAGCTGAGGG - Intergenic
912384523 1:109264611-109264633 CATACCTGGATCACAGCTGCAGG - Exonic
913975060 1:143449511-143449533 CGTGGCTGCACCCCAGCAGCTGG + Intergenic
914069452 1:144275127-144275149 CGTGGCTGCACCCCAGCAGCTGG + Intergenic
914109703 1:144691227-144691249 CGTGGCTGCACCCCAGCAGCTGG - Intergenic
915594832 1:156890673-156890695 CTTATCCCCACCCCAGCTGATGG - Intergenic
915747587 1:158176613-158176635 CTTGCCTTCAACCCATCTGCCGG - Intergenic
918825574 1:189319513-189319535 CTTACTTGCACTGCAGCTGAGGG - Intergenic
920255644 1:204652295-204652317 CCTCCCTGAACCACAGCTGCAGG + Intronic
921803942 1:219433024-219433046 CTCACTTGCACCCCAGATGCAGG + Intergenic
922741620 1:228017252-228017274 CTTACCTGGCCTCCACCTGCTGG - Intronic
923935771 1:238758649-238758671 CTCACTTGCACCACAGCTGCAGG + Intergenic
924471901 1:244350065-244350087 TTTTCCTGCCCCCCTGCTGCAGG + Intergenic
1066001091 10:31104521-31104543 CTTACCTGCAACCTACCTGTGGG - Intergenic
1066523887 10:36254348-36254370 CTTACCTACATCCCAGATGTTGG - Intergenic
1068385938 10:56327478-56327500 CTTACTTGCACCACAGCTGAAGG - Intergenic
1069777017 10:70933219-70933241 CTTTCCTGAAACCCACCTGCTGG + Intergenic
1070307538 10:75248564-75248586 GTTACCTGTCCCCCAGCTGCTGG + Intergenic
1071504117 10:86222544-86222566 CAGGCCTGCTCCCCAGCTGCTGG - Intronic
1071504166 10:86222785-86222807 CTTCCCTGGAGCCCAGCTGAAGG + Intronic
1072207617 10:93218426-93218448 CATGTCTGCACCCCAGCAGCTGG + Intergenic
1072336948 10:94405737-94405759 TTAGCCTGCACCCCACCTGCAGG - Intronic
1072774409 10:98175474-98175496 CTTACCTGACCCCAAGCTTCTGG + Intronic
1073045681 10:100636938-100636960 CTCACTGGCTCCCCAGCTGCCGG - Intergenic
1075923224 10:126230198-126230220 CTTATCTGTACCTCAGATGCAGG + Intronic
1076482891 10:130796450-130796472 CTTTCCTGCACCCCTACTGCGGG - Intergenic
1076565455 10:131395544-131395566 CCTCCCTGGACCTCAGCTGCAGG - Intergenic
1077305941 11:1868727-1868749 GGTCCCTGCACCCCTGCTGCTGG - Intronic
1077350617 11:2091504-2091526 CTTCCCTGGAGCCCACCTGCTGG - Intergenic
1077384599 11:2263038-2263060 CCTACCCCCTCCCCAGCTGCTGG - Intergenic
1077610124 11:3638907-3638929 CCTAGCTGCACCCCTGCTGAAGG + Intronic
1080748235 11:35128134-35128156 CCTACCTCCTCCCCAACTGCTGG - Intergenic
1081640216 11:44747951-44747973 CTCACCTGCAGCAGAGCTGCAGG + Intronic
1083620128 11:64045139-64045161 CTTTTCTGCAGCCCAGATGCTGG + Intronic
1083755155 11:64788307-64788329 CTTCCCAGCCCCCCAGCTGTGGG + Intergenic
1084972347 11:72778769-72778791 CTTGCCTGCATCCCAGGGGCAGG + Intronic
1087732878 11:101798379-101798401 CTTACTCACACCCCAGCTTCTGG - Intronic
1090659857 11:128874204-128874226 CTCACCTGAACCACAGCTCCTGG + Intergenic
1091250719 11:134141692-134141714 CCTGCCTGCACCCCAGCTTGGGG - Intronic
1091319446 11:134639660-134639682 CCCACCTGCAGCCCAGCTACTGG + Intergenic
1092404812 12:8212751-8212773 CTTACCTGCACCACAGCTCCTGG + Intergenic
1092526359 12:9312486-9312508 GTCACCTGGACCCCTGCTGCTGG + Intergenic
1092540910 12:9419299-9419321 GTCACCTGGACCCCTGCTGCTGG - Intergenic
1094494106 12:30978775-30978797 CATATCTGCATCCCAGCTGCTGG + Intronic
1094512131 12:31103186-31103208 GTCACCTGGACCCCTGCTGCTGG + Intronic
1094512706 12:31105853-31105875 CTGACCAGCACCGCAGCAGCTGG + Intergenic
1096077101 12:48812748-48812770 CTCATTTCCACCCCAGCTGCTGG - Intergenic
1099398018 12:82165896-82165918 CTTTCCTGCACCCCAAATGATGG + Intergenic
1100981595 12:100166646-100166668 CTTACCTGAACCCCTGCCCCTGG - Intergenic
1101040816 12:100753602-100753624 CCTACCTGCACCCTAGCTACAGG + Intronic
1101130638 12:101687680-101687702 GGTCCCTGCAGCCCAGCTGCTGG + Intergenic
1103275976 12:119712298-119712320 CTCACCCGCACACCACCTGCTGG - Exonic
1103614843 12:122145541-122145563 CTTACCTGCACCCCAGCTGCCGG - Exonic
1104015362 12:124958264-124958286 CTTACCTGCGTGCCTGCTGCAGG - Intronic
1106111113 13:26777713-26777735 CTTACCTGCATAGCAGATGCAGG + Intergenic
1107252345 13:38379444-38379466 CTTACCAGAACCCAATCTGCTGG - Intergenic
1110359174 13:74605923-74605945 CAGACCTGCATCCCAACTGCTGG + Intergenic
1110388058 13:74937782-74937804 CCTCCCTGCACCCCACCTACAGG + Intergenic
1112030536 13:95452545-95452567 CTTTCCAGCTCCTCAGCTGCTGG + Intronic
1113267438 13:108634774-108634796 TTTTCCTCCACCCCAGTTGCTGG + Intronic
1113503950 13:110800138-110800160 CTTCCCTTCACCACAGCAGCTGG + Intergenic
1113672242 13:112183112-112183134 CTTCCCTGTCTCCCAGCTGCAGG - Intergenic
1117495062 14:56294586-56294608 TTTTCCTCCACCCCAGCTCCTGG + Intronic
1120957490 14:90095825-90095847 CTAACCTGCCCCCCACCTTCAGG + Intronic
1121452139 14:94015662-94015684 TTTAGGTGCATCCCAGCTGCAGG - Intergenic
1121528509 14:94636860-94636882 CTTATCTGCACTCAATCTGCAGG + Intergenic
1122305797 14:100765666-100765688 CTTTTCTGCCCTCCAGCTGCAGG + Intergenic
1122328269 14:100895720-100895742 GTTACCTGCATCCAACCTGCAGG - Intergenic
1123714088 15:23013874-23013896 CTCTCCTGCACCCCAGCCACTGG + Intronic
1126666260 15:51078388-51078410 CTTACCTGGTCACCAGCAGCAGG + Intronic
1127380206 15:58424369-58424391 CTGGCCAGCACCCCAGCAGCTGG + Intronic
1128352151 15:66898204-66898226 CTGGCCTCCATCCCAGCTGCAGG - Intergenic
1128387890 15:67163656-67163678 CTTCCCTGAACCTCTGCTGCTGG + Intronic
1128460388 15:67862395-67862417 ATTACCTGCTCCACAGCTTCTGG - Intergenic
1129550122 15:76439600-76439622 CTTACTTTCAGCACAGCTGCTGG + Intronic
1129879669 15:78998464-78998486 CCTACCTGTACCCCTGCTACAGG + Intronic
1131296820 15:91156542-91156564 CTAACCTGCTCCCAGGCTGCTGG - Intronic
1132540358 16:505610-505632 CTCACCTGTGCACCAGCTGCAGG - Exonic
1132714604 16:1284510-1284532 CTCAACTGCACCCCAGCCCCAGG + Intergenic
1132947230 16:2538248-2538270 CTTACCTGCAGCCGGGCGGCCGG + Intronic
1133508955 16:6439545-6439567 CTTCCCTGTACCCAAACTGCAGG - Intronic
1135413187 16:22250419-22250441 CATTCCTCCACCCCAGCTGAGGG - Intronic
1136229847 16:28879751-28879773 CTCCCCTGCACCCCAGAGGCAGG + Intronic
1138121248 16:54402476-54402498 CATACCAGCGCCCCAGATGCTGG - Intergenic
1138548024 16:57730868-57730890 CTGACCTTCACCCAGGCTGCAGG - Intronic
1141495473 16:84406721-84406743 CTTCCCTGAACCCCAACTTCCGG - Intronic
1141657508 16:85423921-85423943 AGTACCTGCACCCCACCTGAAGG + Intergenic
1143892638 17:10114437-10114459 CTTACCTAAATCCCAGCTTCAGG + Intronic
1144049530 17:11486702-11486724 CTTTCCTGCACCCCAGCATCTGG + Intronic
1147160334 17:38565973-38565995 CTCACCTTCATCCCAGCTGAAGG + Intronic
1148205177 17:45775445-45775467 CCCACCTGCAGACCAGCTGCAGG - Intergenic
1148438768 17:47701115-47701137 CTTATCTGCCTCCCAGCTTCTGG + Intronic
1148443702 17:47725393-47725415 TTTACCTGCAGCCCACCTCCTGG - Intergenic
1148504941 17:48119919-48119941 CTTCCCTCCCCCCCAGCTCCTGG + Intronic
1150259217 17:63774504-63774526 CTTCCCGGCACCCCGGCCGCCGG - Intronic
1152089571 17:78239256-78239278 CTTACCTCCCTCCCACCTGCTGG - Exonic
1152192521 17:78897236-78897258 CAGGCCTGCACCCCGGCTGCAGG + Intronic
1152730372 17:81967038-81967060 CTGCCCTGCGCCCCAGCTGCTGG + Intergenic
1153965925 18:10182055-10182077 CCTAGCTCCACCCCACCTGCTGG - Intergenic
1154346205 18:13545644-13545666 CTTAGCTGCAAACAAGCTGCGGG + Intronic
1156337969 18:36186925-36186947 CTCACTTGGATCCCAGCTGCAGG + Intergenic
1157992170 18:52510319-52510341 CTTCTCTGCATTCCAGCTGCGGG + Intronic
1158437762 18:57445910-57445932 CTGACCTGCAGAGCAGCTGCAGG + Intronic
1160552867 18:79706181-79706203 CTGACCTGCAGCCAAGTTGCTGG + Intronic
1161246129 19:3253154-3253176 CTGACCTGCCCTCCAGCTTCTGG - Intronic
1161651980 19:5491268-5491290 CTGACCTGCACCCCAGCCAGGGG + Intergenic
1163798956 19:19353628-19353650 CTTACCTGAACCCCACATCCAGG + Intronic
1165912405 19:39237320-39237342 CTAACCTCCACCCCTCCTGCTGG - Intergenic
1165913588 19:39244521-39244543 CTAACCTCCACCCCTCCTGCTGG - Intronic
1165917376 19:39269103-39269125 CTAACCTCCACCCCTCCTGCTGG + Intronic
1167391348 19:49196960-49196982 TTGACCTGCTGCCCAGCTGCGGG - Intronic
1167485915 19:49762952-49762974 CTTTCCTGCCCCCGACCTGCTGG + Intronic
924991702 2:318046-318068 CTTACCTGAACCCCAGTGTCCGG - Intergenic
925851679 2:8088052-8088074 CTTCCCTCCACCCCACCTCCAGG - Intergenic
926161402 2:10492549-10492571 ACTACCTCCACCCCAGCTCCTGG - Intergenic
926224416 2:10956759-10956781 CTTACCTGCACCACAGCATTTGG + Intergenic
927687043 2:25178355-25178377 ATTACCAGCACTCCTGCTGCAGG + Intergenic
928028650 2:27760370-27760392 CTGCCCTGATCCCCAGCTGCAGG - Intergenic
928768028 2:34671122-34671144 CTTACCTGTTCCCCAACTCCAGG + Intergenic
930234244 2:48873720-48873742 CTTCACTGCAGCCCAGCTGCTGG - Intergenic
932502407 2:72194970-72194992 TTTCCCTGCAGCCCAGCTCCAGG + Intronic
933649710 2:84840714-84840736 CTTACCTGCACTCTTGCTGAGGG - Intronic
934179763 2:89610484-89610506 CGTGGCTGCACCCCAGCAGCTGG + Intergenic
934290054 2:91684745-91684767 CGTGGCTGCACCCCAGCAGCTGG + Intergenic
936094270 2:109519864-109519886 CTTACCCCAACCCCAGCTCCTGG - Intergenic
936864261 2:117058666-117058688 CTCTCCTGCTCCCCATCTGCTGG - Intergenic
937329347 2:121016142-121016164 CTTGACTGCACACCAGCCGCGGG + Intergenic
937750372 2:125470040-125470062 CCCACCTGCACCACAGCTGAGGG + Intergenic
938161308 2:128986930-128986952 CCAGCCTGCACCCCACCTGCGGG + Intergenic
939695124 2:145313913-145313935 ATTAGCTGCACCCTAGCTACTGG + Intergenic
940806765 2:158196020-158196042 TTTACAGGCACCCCAGCTGATGG - Intronic
943381158 2:187150169-187150191 CTCACTTGCACCACAGCTGAGGG - Intergenic
943552381 2:189356979-189357001 CTTACATGCCCCTCTGCTGCAGG + Intergenic
944522625 2:200587162-200587184 CGTGCCTGCAGCCCAGCTACTGG + Intronic
944850187 2:203711191-203711213 GTTACCTTCCCCCCAGCTTCAGG - Intronic
944906287 2:204265183-204265205 CTGACCCCCACCCCAGCTGTGGG + Intergenic
948197084 2:236104193-236104215 CCTACCAGCGCCCCGGCTGCTGG - Intronic
948994795 2:241572838-241572860 CTCACCTGAACCCCAGGTGAAGG + Exonic
948994845 2:241573000-241573022 CTCACCTGAACCCCAGGTGAAGG + Exonic
1171144367 20:22768725-22768747 CTTGCCTGTCCTCCAGCTGCTGG + Intergenic
1172802015 20:37582377-37582399 CTTTCCTGAAACCCAGCTGAGGG + Intergenic
1174214957 20:48909325-48909347 TGAATCTGCACCCCAGCTGCTGG - Intergenic
1175080172 20:56413073-56413095 CATACCTGTACTCCAGCTACCGG + Intronic
1175980384 20:62735736-62735758 CTTCCCTGCACGCCAGCCTCAGG - Intronic
1176187167 20:63787063-63787085 CTTGCCTCTACCCCACCTGCGGG - Intronic
1176423446 21:6533549-6533571 CTGCCGTGCACCCCACCTGCAGG - Intergenic
1176808610 21:13515619-13515641 CTAACCCTCCCCCCAGCTGCTGG + Intergenic
1179698940 21:43141865-43141887 CTGCCGTGCACCCCACCTGCAGG - Intergenic
1181033579 22:20159459-20159481 CCCACCTGCCCCCCACCTGCTGG - Intergenic
1181631223 22:24152533-24152555 CTTACCTGCCTCCCTGCTGTGGG - Intronic
1181863734 22:25839534-25839556 CTTTACTGCACCCCAGCTACAGG + Intronic
1182312068 22:29416329-29416351 CTTTCCTGCATCACTGCTGCAGG + Intronic
1182423603 22:30260391-30260413 GTTTCCTCCACCTCAGCTGCTGG - Intergenic
1182688193 22:32136914-32136936 CTTTCCTGCACCACAGCTGCAGG - Intergenic
1183028256 22:35082652-35082674 TGTACCTGCACCCGAGCTTCTGG - Exonic
1183335489 22:37243828-37243850 CTCACCTGCACCCCAAAAGCTGG - Intronic
1183357105 22:37365441-37365463 CTTCCCTGGAGCCCTGCTGCGGG + Intergenic
1183622311 22:38981812-38981834 CTGACCTGCCCCCCACCTTCTGG + Intronic
1183770424 22:39920493-39920515 CTGAGCTGCACCCCGGCTGCAGG - Intronic
1184095924 22:42316401-42316423 CTTCCCTGCACCCATGCAGCAGG + Intronic
1184106030 22:42368107-42368129 CTTCCCTGCATCCCAGCCCCAGG + Intergenic
1184264222 22:43338289-43338311 CTAACCAGCACCCCAGGTGCAGG + Intronic
1184641946 22:45877553-45877575 CTCACGAGCACCCCGGCTGCAGG + Intergenic
1184671223 22:46013144-46013166 CTCACCAGCCTCCCAGCTGCTGG + Intergenic
950089891 3:10288085-10288107 CTTGCCTGCACCACAGCGCCAGG - Intronic
953742222 3:45547698-45547720 CTCACCTTCACCCCAGCACCAGG - Exonic
953748484 3:45593095-45593117 CCTCCCTGCACTCTAGCTGCAGG - Intronic
954369931 3:50164951-50164973 CTCACCTGCACACCAGCCTCAGG - Intronic
954877246 3:53810156-53810178 CGTCCCTGCACCGCAGCTCCTGG + Exonic
958004321 3:87792886-87792908 CCCACCTGCGCGCCAGCTGCGGG - Intergenic
959784811 3:110283245-110283267 CTTCCCTCTACCCCTGCTGCAGG + Intergenic
961372850 3:126441796-126441818 CCGCACTGCACCCCAGCTGCTGG + Exonic
961824751 3:129593149-129593171 CCTACCTACAACCCAGCTCCTGG + Intronic
963327765 3:143881149-143881171 CTCACCTGCAGCCCAGCTGAGGG + Intergenic
966832011 3:184017825-184017847 CCTACCTGCGCCCCTGCTCCAGG + Exonic
967695287 3:192524109-192524131 CTTAGTTGCAGCCCTGCTGCTGG - Intronic
968007197 3:195251178-195251200 CCCACCTCCACCCCACCTGCTGG + Intronic
968618999 4:1595239-1595261 CCTTCTTGCACCCCTGCTGCTGG - Intergenic
969489480 4:7490965-7490987 CTTACCAGCTGCCCAGCGGCTGG + Intronic
969761315 4:9185265-9185287 CTTACCTGCACCACAGCTCCTGG - Intergenic
973898784 4:55445339-55445361 TTTACCAGTACCCCAGCTGATGG + Intronic
977934184 4:102781882-102781904 CCTACTTGCACCACAGCTGAGGG - Intergenic
978287370 4:107094910-107094932 CTGAACTGCTCCCCAGATGCTGG + Intronic
978983679 4:114983006-114983028 CTTACCTCCTTCCCACCTGCAGG - Intronic
981100578 4:140825567-140825589 GTTAGCTGCACCTCAGCTGCAGG + Intergenic
981620486 4:146692592-146692614 CTTACTTGTACCACAGCTGAAGG + Intergenic
982069838 4:151685567-151685589 CCTACCTGGAGCCCAGGTGCAGG - Intronic
982155399 4:152515318-152515340 CTTCCCTGCACCCTCGCTTCAGG - Intronic
983040007 4:162914336-162914358 CTTCCCTGTACCACAGCTGCAGG - Intergenic
983314319 4:166109290-166109312 CTTCCCTGTAGCCCAGCTACTGG - Intergenic
983475662 4:168208790-168208812 CTTACTTGCACCACAGCTGAGGG - Intergenic
983700521 4:170587789-170587811 CTTACCTGAGCCCCAAATGCAGG + Intergenic
984635736 4:182107312-182107334 CTTAATTGCACCGCAGCTGAAGG + Intergenic
986006864 5:3676015-3676037 CTCAGCTGCTCACCAGCTGCCGG - Intergenic
987841577 5:23228303-23228325 CTTACTTGCACCACAGCTGAGGG - Intergenic
990032689 5:51281082-51281104 CATTCCTTCTCCCCAGCTGCAGG - Intergenic
991464446 5:66895203-66895225 CTTTCAAGAACCCCAGCTGCTGG + Intronic
993903849 5:93602577-93602599 CTTCCCTGCACGCCAGCCCCAGG - Intergenic
995793924 5:115922561-115922583 CTTTCCTGTCCTCCAGCTGCAGG - Intergenic
996960385 5:129240706-129240728 CTACCCTTCACTCCAGCTGCAGG - Intergenic
997407223 5:133660455-133660477 CTTACCTGCTGCCCTCCTGCTGG + Intergenic
998340431 5:141413028-141413050 CTTCCCTGCAGCCCAGCAGCCGG - Intronic
999105108 5:149063612-149063634 TTTTCCTGCACACCAGCAGCTGG - Intergenic
1000274262 5:159719212-159719234 CTCTCCTGCACACCAGATGCAGG + Intergenic
1001443408 5:171763584-171763606 CTCCCCTGGACCCCAGCAGCTGG - Intergenic
1001999712 5:176190956-176190978 CCTCCCTGCCCCCCAGCTGCTGG + Intergenic
1002649491 5:180681156-180681178 CCTCCCTGCCCCCCAGCTGCTGG - Intergenic
1004897449 6:20162297-20162319 CTTACCTGCTTCCTAGCTGTAGG - Intronic
1007235685 6:40390123-40390145 CAGACCTGGACCCGAGCTGCTGG - Intergenic
1007350944 6:41273024-41273046 CGTGCCTGCAGCACAGCTGCCGG - Intronic
1017652519 6:156596284-156596306 TGTACCTGCACACCAGCTTCAGG + Intergenic
1017970922 6:159312037-159312059 CTGACCCACACCCCGGCTGCTGG - Intergenic
1018192836 6:161325661-161325683 CTCACCTGCACCCCAGATTCAGG - Intergenic
1019321457 7:417311-417333 CTTACCTGTCCGCCAGGTGCAGG + Intergenic
1019663997 7:2242239-2242261 CGTACCTGCACCGCCGCTTCCGG - Exonic
1020332720 7:7036174-7036196 CAGACCTGAACCCCAGATGCAGG - Intergenic
1021086207 7:16423031-16423053 CTCTCTTGCACCCCACCTGCTGG - Intergenic
1021765423 7:23943808-23943830 CATACATCAACCCCAGCTGCAGG - Intergenic
1021845275 7:24757391-24757413 CTTACCCGCGCGCCCGCTGCTGG + Intronic
1022033041 7:26509273-26509295 CTTACCAGCACCCAAGCTCTCGG - Intergenic
1024570878 7:50722096-50722118 CTCTCCTGCACCCCAGAGGCAGG + Intronic
1024670826 7:51592843-51592865 TTAAAATGCACCCCAGCTGCAGG - Intergenic
1028028352 7:85875630-85875652 CAGACCTGCTCACCAGCTGCTGG + Intergenic
1029415804 7:100442425-100442447 CTTTTCTGCATCCCAGCAGCTGG - Intergenic
1029475542 7:100781540-100781562 CTCAGCTGCCCCACAGCTGCTGG + Intronic
1030923172 7:115417945-115417967 CCTACCTGCACTTCAGCTGATGG - Intergenic
1031863095 7:127005782-127005804 CCTACTTGCACCTCAGCAGCTGG + Intronic
1033394675 7:140962253-140962275 CACACCTGCACCCCTGCTGCGGG + Intergenic
1034980188 7:155470916-155470938 TTGACCTTCACCCCAGCTCCTGG - Intergenic
1035392493 7:158514535-158514557 CATCCCTGCACCCCAGGTGATGG + Intronic
1036226875 8:6966767-6966789 CTTTCTTGCACCCCAGATCCTGG - Intergenic
1036271411 8:7307099-7307121 CTTACCTGCACCACAGTTCTTGG - Intergenic
1036349937 8:8003250-8003272 CTTACCTGCACCACAGTTCTTGG + Intergenic
1036402635 8:8423850-8423872 CTTGCCTGCTCACCTGCTGCTGG + Intergenic
1036845207 8:12163777-12163799 CTTACCTGCACCACAGCTCCTGG + Intergenic
1036866576 8:12406100-12406122 CTTACCTGCACCACAGCTCCTGG + Intergenic
1037636116 8:20702162-20702184 ATTCCCTGCACCCCATCAGCTGG - Intergenic
1038068117 8:23984494-23984516 GTTCCCTGCACCCCACCTCCAGG + Intergenic
1038619818 8:29131166-29131188 CTTCCCTGCTCCCCAACTCCTGG - Intronic
1038753830 8:30321798-30321820 CTCACCTACTCACCAGCTGCTGG + Intergenic
1038915925 8:32023108-32023130 TTTACCTGCACCCCATCTCAGGG + Intronic
1047726875 8:127691543-127691565 CTTCCCTGCCCCACAGCTGCAGG + Intergenic
1050028137 9:1356918-1356940 CTGTCCTGCTCCCCACCTGCTGG + Intergenic
1050052363 9:1616474-1616496 CCTACTTGCACCACAGCTGAGGG + Intergenic
1050538208 9:6648148-6648170 CTTACCAGCACCCCATCTTGAGG + Intergenic
1053428839 9:38028430-38028452 GTTTCCAGCACCCCAGCTGCAGG - Intronic
1056544875 9:87605325-87605347 CTGACCTGAAACCCAGCTGCAGG + Intronic
1057310800 9:93941891-93941913 CCCACTTGCACCCCAGCTGAAGG + Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1058237805 9:102514735-102514757 CTTGGCTGCAGCCCAGCTGCAGG - Intergenic
1059556928 9:115290804-115290826 CCTTCCTGCACCCCTGCAGCTGG + Intronic
1061152309 9:128835868-128835890 CCTACCTGCGCCCCTGCTGCAGG - Exonic
1061273567 9:129557483-129557505 GTTACATACAGCCCAGCTGCGGG - Intergenic
1061868306 9:133506646-133506668 CTGACCTGCACACCGGCCGCAGG - Intergenic
1062122765 9:134842520-134842542 CCTAGCTGCACCCCAGCGCCTGG + Exonic
1062279132 9:135744228-135744250 CTGACCGGCAGGCCAGCTGCAGG - Intronic
1185573440 X:1152221-1152243 CTTTCCCTCACCCCAGCTCCTGG - Intergenic
1189250877 X:39600008-39600030 CATACCTGCAGCCCAGCTGTGGG + Intergenic
1189962111 X:46333679-46333701 GCTACCTGCTTCCCAGCTGCAGG - Intergenic
1192886206 X:75337281-75337303 CTTACCTGTACCTCTGCTGAAGG + Intergenic
1193019865 X:76780334-76780356 CATACCGGCTCCTCAGCTGCAGG + Intergenic
1199872218 X:151909686-151909708 CCTACCTGCATCTCAGCTGCTGG - Intergenic
1199895493 X:152122943-152122965 CCTACCAGCACCTAAGCTGCTGG + Intergenic
1199949476 X:152696258-152696280 CCTACCTGCACATCAGCTTCTGG - Intergenic
1199960200 X:152772191-152772213 CCTACCTGCACATCAGCTTCTGG + Intergenic
1200117442 X:153775510-153775532 CTTTCCTTCCCCCCACCTGCTGG - Intronic
1200219634 X:154384703-154384725 CGTACCTCCAACCCAGCTGAGGG - Intergenic