ID: 1103619210

View in Genome Browser
Species Human (GRCh38)
Location 12:122175961-122175983
Sequence TAAAATATGAATAAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 858
Summary {0: 1, 1: 0, 2: 6, 3: 87, 4: 764}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103619210_1103619218 15 Left 1103619210 12:122175961-122175983 CCGGCCTCCTTATTCATATTTTA 0: 1
1: 0
2: 6
3: 87
4: 764
Right 1103619218 12:122175999-122176021 AGGCCATTTTATAGGGTATCGGG 0: 1
1: 0
2: 0
3: 2
4: 74
1103619210_1103619215 7 Left 1103619210 12:122175961-122175983 CCGGCCTCCTTATTCATATTTTA 0: 1
1: 0
2: 6
3: 87
4: 764
Right 1103619215 12:122175991-122176013 CTTTGATCAGGCCATTTTATAGG 0: 1
1: 0
2: 1
3: 8
4: 136
1103619210_1103619217 14 Left 1103619210 12:122175961-122175983 CCGGCCTCCTTATTCATATTTTA 0: 1
1: 0
2: 6
3: 87
4: 764
Right 1103619217 12:122175998-122176020 CAGGCCATTTTATAGGGTATCGG 0: 1
1: 0
2: 1
3: 13
4: 403
1103619210_1103619216 8 Left 1103619210 12:122175961-122175983 CCGGCCTCCTTATTCATATTTTA 0: 1
1: 0
2: 6
3: 87
4: 764
Right 1103619216 12:122175992-122176014 TTTGATCAGGCCATTTTATAGGG 0: 1
1: 0
2: 4
3: 15
4: 201
1103619210_1103619213 -5 Left 1103619210 12:122175961-122175983 CCGGCCTCCTTATTCATATTTTA 0: 1
1: 0
2: 6
3: 87
4: 764
Right 1103619213 12:122175979-122176001 TTTTAGTGCCAGCTTTGATCAGG 0: 1
1: 0
2: 1
3: 11
4: 110
1103619210_1103619220 23 Left 1103619210 12:122175961-122175983 CCGGCCTCCTTATTCATATTTTA 0: 1
1: 0
2: 6
3: 87
4: 764
Right 1103619220 12:122176007-122176029 TTATAGGGTATCGGGAATAGCGG 0: 1
1: 0
2: 0
3: 3
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103619210 Original CRISPR TAAAATATGAATAAGGAGGC CGG (reversed) Intronic
900863239 1:5247847-5247869 TAAAAAATAAATAAGTAGCCAGG + Intergenic
901046847 1:6401808-6401830 AAAAATATAAAGAAAGAGGCCGG - Intergenic
901563977 1:10096743-10096765 AAAAATATGAATAAGGGGCTGGG + Intronic
901835547 1:11921844-11921866 AAAAATAATAATAATGAGGCTGG - Intronic
902031050 1:13422519-13422541 TAAAAGATGAAAAATGCGGCTGG - Intergenic
902141968 1:14364477-14364499 TAAAATGGGAATAATGATGCTGG + Intergenic
902280847 1:15373212-15373234 TAAAAGATGAAAAAGACGGCTGG + Intronic
902281097 1:15375150-15375172 TGAAATAAGAAAAAGTAGGCTGG - Intronic
902594183 1:17496834-17496856 TAAAATATAAAAAATTAGGCAGG - Intergenic
902959370 1:19951633-19951655 GAAAAAATGAAAAAGAAGGCTGG + Intergenic
903432226 1:23314981-23315003 TAAAAAATGAAGAAGAGGGCTGG + Intronic
903660851 1:24977569-24977591 TAAAAGAGGAGCAAGGAGGCCGG + Intergenic
903731954 1:25503291-25503313 TAAAATATGCTCAAGGAGGGAGG - Intergenic
903797251 1:25938721-25938743 TGAAATCTGAATAAGGTGGGTGG - Intergenic
903898564 1:26625131-26625153 TAAAAATTAAATAAAGAGGCCGG + Intergenic
904018271 1:27441329-27441351 TAAAAAATGAAAAACGTGGCTGG + Intronic
904066549 1:27756585-27756607 TAAAATATTAACACTGAGGCCGG - Intronic
904402628 1:30266861-30266883 TTAGAAATAAATAAGGAGGCTGG - Intergenic
904628565 1:31823981-31824003 TAAAAAATGAATAATGAGCAGGG - Intergenic
906978393 1:50601375-50601397 AAAAATATGAATTAGTAGGCTGG + Intronic
907120530 1:52004341-52004363 TAAAATATGAATGGGGTGGCTGG + Intergenic
907388793 1:54143037-54143059 TAAAATATGAATTTACAGGCTGG + Intronic
908562401 1:65319764-65319786 TAAAATAAGAATAAGGATCAGGG - Intronic
908959188 1:69674011-69674033 TAACACATAAATATGGAGGCAGG + Intronic
908995682 1:70150212-70150234 TAAAATATGAATAACTGGCCAGG - Intronic
909156151 1:72078934-72078956 TAAAATATCAATAAATAGGCTGG - Intronic
909591321 1:77352315-77352337 TATAAGATGAATAAGGAGTCTGG - Intronic
909662297 1:78097591-78097613 TAAAATATGGAAATGAAGGCAGG - Intronic
909886275 1:80945919-80945941 TAAAAAATGAAAAAGAAGACAGG + Intergenic
910277869 1:85467131-85467153 TATAATAAGAATAAATAGGCTGG - Intronic
910994145 1:93086205-93086227 TAAATAATGAAGGAGGAGGCCGG + Intronic
911010947 1:93280234-93280256 AAAAATATGAATCATGAGGGTGG - Intergenic
911451927 1:98073687-98073709 AAAAATATCAAAAAAGAGGCAGG + Intergenic
912066590 1:105752923-105752945 TAACATTTGAATCAGTAGGCTGG + Intergenic
912372381 1:109184073-109184095 TAAAATAATAATAAAGAGGCCGG + Intronic
912539759 1:110405459-110405481 TAAAATTTAAAAAAAGAGGCCGG - Intronic
912735289 1:112144949-112144971 AAAAATAGGCATCAGGAGGCTGG + Intergenic
914225230 1:145714515-145714537 TAAAATATGGAGAGGGAGTCAGG - Intergenic
914724092 1:150312887-150312909 TAAAATAAGGATAATGGGGCCGG + Intergenic
914757216 1:150570050-150570072 TAAAACATGAGTAACGAGGCTGG - Intergenic
914874542 1:151502972-151502994 TGAAAGATAAAGAAGGAGGCAGG + Intergenic
915387120 1:155505110-155505132 GAAAATATAAATAATGAGGCCGG - Intronic
915688036 1:157655885-157655907 TATAAAATGAATAAAAAGGCAGG + Intergenic
915750670 1:158206865-158206887 TAAAAAATGAAACAGGAGGCCGG - Intergenic
916316031 1:163448660-163448682 TAAAAAATAAAAAAGGAGGTGGG - Intergenic
916803643 1:168237807-168237829 TAAGATATGGAGAAGGATGCTGG + Intronic
916965043 1:169930081-169930103 TAAAATATTACTCTGGAGGCAGG - Intronic
918026536 1:180754756-180754778 TAAAATACAAGAAAGGAGGCCGG - Intronic
918081106 1:181208371-181208393 TTAAAGATGAATAAGAGGGCAGG - Intergenic
918653354 1:186993652-186993674 TCAAATAGGATTTAGGAGGCAGG + Intergenic
918705110 1:187650931-187650953 TAAAATGTGAATATTTAGGCCGG + Intergenic
918952410 1:191155938-191155960 TAAAAAATTAATGAGGAGGACGG - Intergenic
919000422 1:191825288-191825310 AAAAATGTGAAAAAGGAGCCTGG - Intergenic
919467197 1:197936413-197936435 TAAAATATCCAGAAGGAGGCTGG - Intergenic
920117768 1:203632671-203632693 TAAAATATGAATATAGAATCAGG - Intronic
920328424 1:205185726-205185748 TAAAATATAAAAAAGTAGCCAGG + Intronic
920360712 1:205414284-205414306 TAAAATAATAATATGGAGGCCGG + Intronic
920447328 1:206028609-206028631 TAAAAGATGGAAAAGGAGGGAGG - Intergenic
920638368 1:207727431-207727453 AAGAATATGAAAAAGTAGGCAGG - Intronic
920786651 1:209049045-209049067 TAATATATGAGTAAAGGGGCTGG - Intergenic
921390811 1:214611660-214611682 TACAATAAGAATTAGAAGGCTGG - Intronic
921809966 1:219501616-219501638 TAAAATATGCCTAAAGAGGCAGG - Intergenic
921861220 1:220044426-220044448 CAAAAAATGTATCAGGAGGCTGG + Intronic
921989259 1:221346636-221346658 TAAACTATGAACAAGAAGACAGG + Intergenic
922036124 1:221850258-221850280 TAACATATGAATCTGGAGGCGGG + Intergenic
922059691 1:222076300-222076322 TAGAATAAGAATAAGATGGCTGG - Intergenic
922459650 1:225805291-225805313 TAAAATATAAAAGGGGAGGCGGG - Intergenic
923706901 1:236351421-236351443 TCAAGGATGAATGAGGAGGCTGG + Intronic
1063720875 10:8580292-8580314 TAAAATATCTATATTGAGGCCGG - Intergenic
1063842981 10:10092552-10092574 TAACATAGGAACAAAGAGGCAGG + Intergenic
1063943489 10:11155184-11155206 TAAATTCTGCTTAAGGAGGCCGG - Intronic
1063997045 10:11629233-11629255 GAAAAGAAGAATAATGAGGCCGG - Intergenic
1064048248 10:12038430-12038452 TAATATATGAAAAAGCAGGCTGG + Intronic
1064192659 10:13221173-13221195 TAAAATATGTAGAAGTCGGCTGG + Intergenic
1064594583 10:16930696-16930718 TATAAAATGAATAAGCAGGTGGG + Intronic
1065215646 10:23445940-23445962 TAAAATATGAAACAAAAGGCCGG + Intergenic
1065262897 10:23944126-23944148 TAATAAATGAATAAGTAGGCCGG + Intronic
1065502273 10:26394089-26394111 CAATATATGAATTTGGAGGCAGG - Intergenic
1065882536 10:30048862-30048884 TAAAAGTTTCATAAGGAGGCCGG - Intronic
1066292281 10:34025409-34025431 TATAGTATGAAAAAGGATGCTGG + Intergenic
1067130730 10:43563016-43563038 AATAATATGAAGAATGAGGCCGG + Intronic
1067845211 10:49714557-49714579 TACACTATGAATACGGAGCCAGG + Intergenic
1068228982 10:54145122-54145144 TAAAATATGAATAAAGAAGAGGG + Intronic
1068298835 10:55112416-55112438 GAAAATAGGAAAAATGAGGCAGG + Intronic
1069484033 10:68809491-68809513 TAAAAAATAAATAAAGAGCCGGG - Intergenic
1069977645 10:72227732-72227754 TAGAATATGAAAATAGAGGCCGG + Intronic
1070030979 10:72677147-72677169 TAGAAAATGAAAAGGGAGGCTGG - Intergenic
1070154149 10:73823374-73823396 TAAAATACAAAAAAGTAGGCAGG - Intronic
1071230121 10:83576639-83576661 TAAAAAATGGCAAAGGAGGCTGG - Intergenic
1071687253 10:87772407-87772429 TAAAAAGTCAATAAAGAGGCTGG - Intronic
1071737358 10:88316780-88316802 TCAAATAAAAATAAGTAGGCAGG - Intronic
1073241556 10:102062154-102062176 TAGAATATAAAAAAGTAGGCAGG + Intergenic
1074358067 10:112803362-112803384 TCTAAAATGAAGAAGGAGGCTGG - Intronic
1074633344 10:115284304-115284326 TAAAAAATAAATGAGGAGACAGG + Intronic
1074810806 10:117103385-117103407 TAAAAAATGAACAACGAGGCTGG - Intronic
1075126612 10:119705414-119705436 AAAAATATTAAGAAGGTGGCTGG - Intergenic
1075750048 10:124761026-124761048 TAAAATATGAAAAATTAGCCGGG - Intronic
1075947858 10:126453765-126453787 TAAGAGATGAATAAAAAGGCTGG + Intronic
1077870187 11:6255931-6255953 TAAAAAATGAATAAGGTTTCTGG - Intergenic
1078217424 11:9323304-9323326 TAAAGAAAGAGTAAGGAGGCTGG - Intergenic
1078227399 11:9404860-9404882 TAAAATATGAATCTGAAGGCCGG - Intronic
1078232898 11:9459174-9459196 TAAAAAATGGATTAGGTGGCCGG - Intergenic
1078411943 11:11130215-11130237 AAAAATATTAAGAATGAGGCAGG + Intergenic
1078485784 11:11722119-11722141 TAAAAAAAGTATAAGTAGGCTGG - Intergenic
1078499458 11:11855846-11855868 TCAAAGATGAATAAGGAATCTGG + Intronic
1078599443 11:12717332-12717354 TGAAACATGAGTCAGGAGGCAGG + Intronic
1078984127 11:16574191-16574213 AAAAATAAGAATAAGGTGGCAGG + Intronic
1079089160 11:17468772-17468794 AACAATACCAATAAGGAGGCTGG + Intronic
1080195002 11:29599014-29599036 TAAAAAATGAATAAACAGCCGGG + Intergenic
1080357808 11:31472065-31472087 TAAAAGAGTAAAAAGGAGGCAGG - Intronic
1080536983 11:33231200-33231222 TAAAAAATAAAAAATGAGGCAGG + Intergenic
1081128241 11:39344688-39344710 TTAAATAAGAATAAGCAGCCAGG - Intergenic
1081912908 11:46711608-46711630 TAAATTAGGAATCAGAAGGCCGG - Intergenic
1082669864 11:56022403-56022425 TAAAAAATGTATAAGAAGGCCGG + Intergenic
1082920952 11:58493263-58493285 GAAAAAAAGAAAAAGGAGGCTGG + Intergenic
1083251243 11:61468820-61468842 TAAAATATGGACAATGTGGCTGG + Intronic
1083383085 11:62283851-62283873 TAAAATAGGAAGAAGAAGGGAGG - Intergenic
1083624552 11:64065492-64065514 TAAAAGATGAACAAGGGGCCAGG + Intronic
1083692230 11:64416661-64416683 TAAATTATAAAGAATGAGGCTGG + Intergenic
1084026529 11:66453768-66453790 TGAAATAAAAATAAAGAGGCTGG - Intronic
1084589494 11:70082260-70082282 AAAAAGATGAATAAGAGGGCTGG + Intronic
1085154175 11:74278283-74278305 TAAATTATGAATAAGGAGATAGG + Intronic
1087082931 11:94189184-94189206 TAAAAAAAGAATAAGGGGCCGGG + Intergenic
1087114886 11:94514104-94514126 TAGAATTTGAAGTAGGAGGCTGG - Intergenic
1087453716 11:98355805-98355827 TAAAATACCAAGAAGGAGCCTGG - Intergenic
1087521104 11:99237518-99237540 TAAAATATGAAAAATTAGCCTGG + Intronic
1087583699 11:100091721-100091743 TAAAAAATGAATAAATAGGCTGG - Intronic
1087924096 11:103899567-103899589 TATAATATGATTAAGGATGTGGG + Intergenic
1087928579 11:103949297-103949319 TAAGATTAGAATAACGAGGCCGG - Intronic
1088079125 11:105888580-105888602 TAAAAATAGAAAAAGGAGGCCGG - Intronic
1088259884 11:107934129-107934151 TAAAATATGAAAATCTAGGCTGG + Intronic
1088645746 11:111914721-111914743 TGAAATATGTATTTGGAGGCAGG - Intronic
1089037108 11:115406220-115406242 GAATATATGAATAATGAGGGAGG - Intronic
1089235293 11:117019178-117019200 TAAAATATGAAAAATTAGCCAGG - Intronic
1089509207 11:118985256-118985278 AAAAATTTAAATGAGGAGGCGGG - Intergenic
1090034426 11:123236292-123236314 TAAAAAATAAAAAAGTAGGCTGG + Intergenic
1090870636 11:130743742-130743764 TAAAATATTTATAATGAGGCAGG + Intergenic
1091472988 12:746202-746224 TAATATATGAAGAAGTAAGCGGG - Intergenic
1091946825 12:4553264-4553286 TAAAATATGTAAAAGGAAGGTGG + Intronic
1092123313 12:6059201-6059223 TAAATTTTAAATAAGGAGGTGGG - Intronic
1092254841 12:6921097-6921119 TGAAATAAGAATCAGGAGCCAGG + Intronic
1092493384 12:8967423-8967445 TAAAAAATTAATAACCAGGCTGG + Intronic
1092716008 12:11391405-11391427 TAAATTAGGATTAAGGAGGAGGG + Intronic
1092960860 12:13595748-13595770 TACAATTTGCATAACGAGGCAGG + Intronic
1093076881 12:14768261-14768283 TAAAATGTGAATGAGGGGGGCGG - Intronic
1093173914 12:15889614-15889636 TAAAATAAAAGTAAGGAGGATGG + Intronic
1093262567 12:16957310-16957332 TAAATAAAGAAAAAGGAGGCTGG - Intergenic
1093434062 12:19115380-19115402 TAAACAAGGAATCAGGAGGCTGG + Intergenic
1093582272 12:20796352-20796374 TAAAATATGAAATAAGAGGCTGG - Intergenic
1094035246 12:26063555-26063577 TAAAATATGAAAAAGTTAGCCGG - Intronic
1094555253 12:31493395-31493417 TAAAATACTAAAAAAGAGGCCGG + Intronic
1094693083 12:32788757-32788779 TAAAATGTTAACAAGTAGGCCGG + Intergenic
1095565465 12:43618206-43618228 TTAAAAATAAAGAAGGAGGCCGG - Intergenic
1095875251 12:47073370-47073392 TAAATCATGAATCAGGGGGCTGG + Intergenic
1096345224 12:50840540-50840562 TAAAAGGTGAAGAAGTAGGCTGG + Intergenic
1096381668 12:51163623-51163645 TAAAATATTAGAAAGAAGGCAGG + Intronic
1096829363 12:54302071-54302093 AAAAAGATGAATAAGTGGGCTGG - Intronic
1097502323 12:60419992-60420014 TAGAATGTGAATAAGGAGATGGG - Intergenic
1097575762 12:61390498-61390520 TTAAATATGCATAAATAGGCAGG + Intergenic
1097811339 12:64022489-64022511 TAACATAGGAATCAGTAGGCTGG - Intronic
1097817061 12:64086513-64086535 TATAATATGAATCAGGGGACTGG - Intronic
1098011310 12:66055677-66055699 AAAAATATGAAAAAGTAGCCCGG - Intergenic
1098148344 12:67520561-67520583 TGAAATATTAATGAGGAGACGGG + Intergenic
1098293632 12:68982241-68982263 TAAAAAATAAATAAGGAGGAAGG - Intergenic
1098351615 12:69568016-69568038 CAATATATGAAAAAGGAGGAGGG - Intronic
1098620411 12:72590641-72590663 AAAAATAAGATTAAGAAGGCTGG - Intronic
1098992165 12:77075774-77075796 CAAAATCTGATGAAGGAGGCTGG - Intergenic
1099514399 12:83579039-83579061 TAAAATAAGAATAAAAATGCAGG + Intergenic
1099702961 12:86112452-86112474 GAAAATGTGAATAAGGAAGGGGG - Intronic
1100348039 12:93751957-93751979 TACAGTATGAAAAATGAGGCTGG - Intronic
1100557309 12:95708551-95708573 AAAAATAACAATAAAGAGGCTGG - Intronic
1100688151 12:97009306-97009328 TAAAAAATTAATCCGGAGGCTGG + Intergenic
1100938928 12:99703553-99703575 TGACACATGAATAAGGAGGGAGG - Intronic
1101256495 12:102982629-102982651 AAAAATATGAGTAAATAGGCTGG - Intergenic
1101358169 12:104000549-104000571 TAAAGTATGTAAAAGGGGGCAGG + Intronic
1101374431 12:104158553-104158575 TAAAAGTTGAAGAAGAAGGCTGG - Intergenic
1101381044 12:104214432-104214454 AAAATTATGAATAAGGCTGCAGG - Intergenic
1101639229 12:106574838-106574860 TAAAATATGAAAAATTAGACAGG + Intronic
1102321656 12:111941079-111941101 TAAAATATGGAAGAGTAGGCCGG + Intronic
1102353424 12:112212059-112212081 TTAAATATGTATGAGGATGCTGG + Intronic
1102477572 12:113198796-113198818 TAAATTAAAAATAAGCAGGCTGG + Intronic
1102534781 12:113573280-113573302 TAAAATCTGAATAAGGTGGGTGG + Intergenic
1102838839 12:116096055-116096077 TAAAAAATCAATGATGAGGCCGG + Intronic
1102877717 12:116460715-116460737 AAAAATAAAAATAAGAAGGCTGG + Intergenic
1103104484 12:118211031-118211053 TAAGAAATAAATAAGTAGGCCGG - Intronic
1103225306 12:119282430-119282452 TAAAATATGAAAAATTAGCCAGG + Intergenic
1103474218 12:121206760-121206782 TCAAAAATAAATAAGAAGGCGGG - Intergenic
1103542429 12:121675388-121675410 AAAAATAAAAATAATGAGGCCGG - Intergenic
1103619210 12:122175961-122175983 TAAAATATGAATAAGGAGGCCGG - Intronic
1104514457 12:129411649-129411671 TAAAATAGCAATAATTAGGCTGG - Intronic
1104579369 12:129999102-129999124 TAAAAAATGAATAACCAGGCCGG - Intergenic
1105066982 12:133209536-133209558 TAAAACATTAATAAAAAGGCTGG + Intergenic
1105343548 13:19551291-19551313 TACAATATGAATATACAGGCCGG + Intergenic
1105370157 13:19795190-19795212 TAAAAAATGAATGCAGAGGCTGG + Intergenic
1105453554 13:20520941-20520963 TAAAATATAAATAATTAGCCAGG + Intronic
1105520808 13:21129261-21129283 AAAAATATGAAAAAGTAGCCAGG - Intergenic
1105536497 13:21270344-21270366 TACAATATGAATATACAGGCTGG - Intergenic
1105887974 13:24658816-24658838 TAAAAAATAAATAAATAGGCCGG + Intergenic
1105993971 13:25652477-25652499 AAAAATAAGAATAAGGAAGAGGG - Intronic
1106458711 13:29949400-29949422 TAAACTACGAATCAGGAGGATGG - Intergenic
1106670245 13:31897520-31897542 TAAAATAAAAGTAATGAGGCTGG - Intergenic
1106716761 13:32397901-32397923 TAAAAGATAAAAAAGGAGGTAGG - Intronic
1106759685 13:32856662-32856684 TAAAATATTAAAAAAAAGGCGGG + Intergenic
1106972365 13:35157209-35157231 TAAAATATGAATGGGGAGGCTGG + Exonic
1107452928 13:40527909-40527931 TAAAATATCATTTAGGAGCCTGG + Intergenic
1107931717 13:45312561-45312583 TCAAAAATGAAAAAGAAGGCCGG - Intergenic
1108117488 13:47145347-47145369 GAAAATATCCATCAGGAGGCTGG - Intergenic
1108341704 13:49504018-49504040 AAAAAAATCAAAAAGGAGGCTGG - Intronic
1108681637 13:52785794-52785816 TAAAAAATAAACAAGGAGCCTGG - Intergenic
1108980283 13:56502410-56502432 TAAAATTTGAATAAGAAGACTGG + Intergenic
1109077214 13:57851605-57851627 TAAAATATCAGTAAGTAAGCCGG + Intergenic
1109664485 13:65514260-65514282 CAAAAGATCAATAAGGAGACAGG + Intergenic
1109741302 13:66559502-66559524 AAAAATACGGATCAGGAGGCCGG + Intronic
1109807307 13:67460304-67460326 TAAAATATGAAAAATTAGCCTGG - Intergenic
1109866959 13:68277119-68277141 AAAAATATGAATTAAGATGCTGG - Intergenic
1110625291 13:77648476-77648498 TAAAATATGAATAATGCATCTGG + Intergenic
1111158698 13:84363906-84363928 GAAACTATGAATCAGGAGCCTGG - Intergenic
1111508364 13:89226383-89226405 TGAAATCTGAATAAGGTGGATGG + Intergenic
1111710825 13:91812021-91812043 TAGACTATGAATAAAGTGGCGGG + Intronic
1111741135 13:92207023-92207045 TAAAAAATGAATAAGAAGATAGG - Intronic
1112081325 13:95974783-95974805 TTAAATATTAATAATGAGACTGG + Intronic
1112390976 13:98983911-98983933 TAAAAAATAATTGAGGAGGCCGG - Intronic
1112393696 13:99008913-99008935 CAACATATGAATAGGGAGGTAGG + Intronic
1112546640 13:100377473-100377495 TAAAATAAAAAGATGGAGGCTGG - Intronic
1112669815 13:101622018-101622040 TGGAATATAAATAAGCAGGCAGG + Intronic
1112938828 13:104835030-104835052 TAAAATCTGAAAAGGGAGGCAGG + Intergenic
1113592971 13:111513702-111513724 GAAAATATCAATAATGAGACAGG + Intergenic
1113811929 13:113148031-113148053 TAAAATATAAAAAAACAGGCTGG + Intronic
1114011152 14:18369861-18369883 TAAAAAATGATAAAGGGGGCTGG - Intergenic
1114582497 14:23775320-23775342 TAAAATATGAAAAAGTTGGGGGG + Intergenic
1114859610 14:26498828-26498850 TAAAATGTTTATAAGGAGACTGG - Intronic
1115693332 14:35869549-35869571 TAAAAAATAAATAATTAGGCCGG + Intronic
1115780924 14:36767349-36767371 CAAAATCTGAATAAAGAGTCGGG - Intronic
1115833891 14:37375479-37375501 TAATAAATTAAAAAGGAGGCTGG - Intronic
1116141173 14:40995826-40995848 TAAAATATGTAAAAGGAGAGTGG - Intergenic
1116889721 14:50256349-50256371 TAAAATAATAATAACTAGGCAGG + Intronic
1117332655 14:54728442-54728464 TCAAATATAATTAAGGAGCCAGG + Intronic
1117673180 14:58128613-58128635 TGAAATATGCACAAGGTGGCAGG + Intronic
1118381585 14:65221996-65222018 TAAAAGATCAAGATGGAGGCTGG + Intergenic
1118798446 14:69167066-69167088 TAAAAAAAGAAAAAAGAGGCTGG + Intergenic
1119106136 14:71926285-71926307 TAGAATATCAATGAAGAGGCTGG + Intergenic
1119118012 14:72045100-72045122 TTAAATCTGATTATGGAGGCTGG - Intronic
1119260679 14:73236518-73236540 TAAAAAAAGAAGAAGAAGGCTGG + Intergenic
1120139791 14:80916019-80916041 TAAAAGAGGAAAAGGGAGGCAGG + Intronic
1120347538 14:83309313-83309335 TAAAATAGGTGTAAGGTGGCTGG - Intergenic
1120651809 14:87142938-87142960 TGAAATATGAAAAATGAGACTGG - Intergenic
1120784409 14:88518725-88518747 AAAAATATTAATTATGAGGCTGG - Intronic
1120902023 14:89583854-89583876 TAAAAAATAAATAAATAGGCTGG - Intronic
1121135373 14:91493090-91493112 AAAAATAAGAAAAAGTAGGCTGG + Intronic
1121246067 14:92461693-92461715 CAACATATGAATTTGGAGGCGGG + Intronic
1121355365 14:93209107-93209129 TAAAAAGTGAATATGTAGGCTGG - Intronic
1121474536 14:94185205-94185227 TAAAATGGGAATAAATAGGCTGG + Intronic
1121670614 14:95708176-95708198 TAAAATATGTAGAGGGAGGCTGG + Intergenic
1121878632 14:97478868-97478890 TAAAAGATGAATGAGAAAGCTGG - Intergenic
1122188851 14:100023756-100023778 TAAAAAAGGCAAAAGGAGGCTGG - Intronic
1122678430 14:103436772-103436794 TTAAATATGTATAATCAGGCTGG - Intronic
1202927793 14_KI270725v1_random:7644-7666 TAAAAAATCAACAATGAGGCTGG + Intergenic
1123657005 15:22528211-22528233 TAAAATAGGAATAAGTGGCCAGG + Intergenic
1124310918 15:28623387-28623409 TAAAATAGGAATAAGTGGCCGGG + Intergenic
1124454961 15:29833810-29833832 AAAAATATAAATGAGGAGGTTGG - Intronic
1124530966 15:30505868-30505890 GAAAATATGTATAGGGCGGCCGG - Intergenic
1124767689 15:32501827-32501849 GAAAATATGTATAGGGCGGCCGG + Intergenic
1124792384 15:32740819-32740841 TAAGATTTGAATATGGAGGCTGG - Exonic
1124792555 15:32743202-32743224 TAAGATTTGAATATAGAGGCTGG + Exonic
1125473209 15:40024692-40024714 TAAAAAAAAAAAAAGGAGGCTGG - Intronic
1125999138 15:44193820-44193842 AAATAAATAAATAAGGAGGCGGG + Intronic
1126041179 15:44592657-44592679 TAAAATATAAAAAAGTAGCCAGG + Intronic
1126467613 15:48975302-48975324 TAAAATGTGAATAAGGATTGTGG - Intergenic
1126733231 15:51705853-51705875 TAAAACATTAAAAAGAAGGCAGG + Intronic
1127785097 15:62348752-62348774 TAAAATCTGAATAAAGTTGCTGG - Intergenic
1128009631 15:64280655-64280677 TAAAATATGAGAAAAGGGGCCGG - Intronic
1128103674 15:65027492-65027514 TAAAAAATGAAAACTGAGGCTGG - Intronic
1128169448 15:65498123-65498145 TAAAATGTCAACAATGAGGCCGG + Intronic
1128405088 15:67329000-67329022 TAAAAAATGAATATTGTGGCTGG + Intronic
1128565054 15:68695575-68695597 AAGAATATGAACAAGGAGGGAGG + Intronic
1129077898 15:73013228-73013250 TACAAAATGAATAATCAGGCTGG + Intergenic
1130536271 15:84787145-84787167 TAGAAGATGCACAAGGAGGCGGG - Intronic
1130551449 15:84892215-84892237 TAAAAAAAGAAAAAGGAGGATGG + Intronic
1130625434 15:85509240-85509262 TGAAATATAAAAATGGAGGCTGG - Intronic
1131694586 15:94862387-94862409 TAAAATAAAAATAAGGAAGAGGG - Intergenic
1131817903 15:96241598-96241620 TAAAATATGAATGAGGAAGGAGG - Intergenic
1131843761 15:96467472-96467494 TAAAACATCATTAGGGAGGCAGG + Intergenic
1131926619 15:97391622-97391644 TAAGAAATGAATAAGCAGGCCGG + Intergenic
1132110472 15:99099061-99099083 TATTATATGGATAAGGAGGTGGG + Intronic
1132157129 15:99503456-99503478 TAAGAGCTGAACAAGGAGGCGGG - Intergenic
1132359561 15:101201271-101201293 AAAATAATGAATAATGAGGCTGG + Intronic
1132507717 16:320205-320227 TAAAAAATGAAAAAGTAGCCAGG - Intronic
1132681183 16:1142518-1142540 TAAAAAAAGAAAAAGGCGGCCGG + Intergenic
1132823612 16:1891031-1891053 TAAAAAAAGAATCAGGAGGCTGG + Intergenic
1133084761 16:3353502-3353524 AAAAAAAAGAATAAGTAGGCCGG + Intergenic
1133323298 16:4928139-4928161 CAAAAAATGAAAAAGGAGGCTGG - Intronic
1133431508 16:5740976-5740998 TAAAATAGGTTAAAGGAGGCAGG + Intergenic
1134475488 16:14570042-14570064 TGAAATAGGAAAGAGGAGGCCGG + Intronic
1134742761 16:16562515-16562537 TAAAATATGAAAAATTAGCCGGG + Intergenic
1134806777 16:17132604-17132626 TAAAATGGGAATAACAAGGCTGG + Intronic
1134841771 16:17407293-17407315 TAAAATAAGAATAAATAGGCTGG - Intronic
1135327470 16:21536075-21536097 TTAGATAAGAAAAAGGAGGCCGG + Intergenic
1135541209 16:23331714-23331736 TAAAATATGAATTTGGTGGGGGG + Intronic
1136134761 16:28248864-28248886 AAAAAAATAAAGAAGGAGGCCGG + Intergenic
1136183211 16:28569361-28569383 TAAAGAATGAAAAAGTAGGCTGG + Intronic
1136337822 16:29622095-29622117 TTAGATAAGAAAAAGGAGGCCGG + Intergenic
1136582877 16:31164488-31164510 TACAAAATTAAAAAGGAGGCCGG - Intergenic
1136931667 16:34423258-34423280 TAAAATATACATAACAAGGCCGG - Intergenic
1136972905 16:34988557-34988579 TAAAATATACATAACAAGGCCGG + Intergenic
1137499735 16:49001260-49001282 TAAAATATGAAAAAGGCAGTGGG - Intergenic
1137994392 16:53194071-53194093 TAAAATATGTCTAAGAAGGCTGG + Intronic
1138467555 16:57202845-57202867 TAAAATATATATAAAGAGGGAGG - Intronic
1138621471 16:58214637-58214659 AAAAATAAGAATAATGGGGCTGG + Intergenic
1138647051 16:58433279-58433301 TAACATTTGAATAAGTGGGCTGG - Intergenic
1138727508 16:59156328-59156350 TAAAGAATGATTAAAGAGGCAGG + Intergenic
1139608357 16:68036597-68036619 TAAAATATAAAAAATTAGGCTGG - Intronic
1139733269 16:68966225-68966247 TAAAAAATAAAAAATGAGGCCGG + Intronic
1139898528 16:70308531-70308553 TAAAAAATAAATAAATAGGCTGG - Intronic
1140882837 16:79214564-79214586 TAAAATATGAAAAATTAGCCAGG - Intergenic
1140883270 16:79218668-79218690 TATACTTTAAATAAGGAGGCTGG - Intergenic
1141396425 16:83709055-83709077 TAAAAAATTAAAATGGAGGCAGG + Intronic
1141549614 16:84796766-84796788 AAAAAAAAGAAAAAGGAGGCTGG - Intergenic
1142040574 16:87891169-87891191 TTAGATAAGAAAAAGGAGGCCGG + Intronic
1142250117 16:88987769-88987791 TAATACATGAAGAAAGAGGCAGG + Intergenic
1142734833 17:1890364-1890386 TAAAAAATAAATAAATAGGCCGG + Intronic
1142882570 17:2893335-2893357 TAAAATAACAGTAAGGGGGCTGG - Intronic
1143194405 17:5064546-5064568 TAAAATTTGGAGGAGGAGGCTGG - Intergenic
1143244493 17:5471717-5471739 TAAAATATGTTTAAGTAGCCTGG + Exonic
1143343320 17:6231423-6231445 TAAAAATTGACAAAGGAGGCTGG + Intergenic
1143360899 17:6370192-6370214 AATAAAATGAACAAGGAGGCCGG + Intergenic
1143628456 17:8123868-8123890 CAAAATATGAAGAAGGGGACAGG - Intronic
1143643989 17:8217743-8217765 TAAAATTTCAAGAAGTAGGCCGG + Intergenic
1143802431 17:9395303-9395325 TAAAACATGAATATGGCAGCTGG + Intronic
1143900195 17:10168674-10168696 TAAAAAATTAATAATTAGGCTGG + Intronic
1144027711 17:11293119-11293141 AAAAATATCAATCTGGAGGCCGG - Intronic
1144055141 17:11533885-11533907 TAGAGTAAGAATAATGAGGCTGG - Intronic
1144511547 17:15881395-15881417 TAAAAAATAAATAAAGAGGCCGG - Intergenic
1145873098 17:28292903-28292925 TAAAATACCAAGAAGGCGGCTGG + Intergenic
1146369406 17:32255934-32255956 GAAAATATGAATAACCCGGCTGG - Intergenic
1147435742 17:40413710-40413732 TAAAATATGTATATTCAGGCTGG + Intronic
1148039381 17:44694531-44694553 AAAAAAATGAACAAAGAGGCCGG + Intergenic
1148097854 17:45066212-45066234 TAAAATATGAAAAATTAGCCGGG - Intronic
1148330334 17:46810301-46810323 GAAAAGAGGAATAAGAAGGCTGG - Intronic
1148433967 17:47666911-47666933 AAAAATATAAGAAAGGAGGCCGG - Intronic
1149369205 17:55976583-55976605 AAAAATAGGAATGAGGAGCCAGG + Intergenic
1149544510 17:57493441-57493463 GAAAATATCAATAAAGAGGCTGG + Intronic
1149576627 17:57718087-57718109 TAAAAAATAAATAAACAGGCCGG + Intergenic
1149903347 17:60502555-60502577 TAAAAAAAGAATAAACAGGCTGG + Intronic
1149905237 17:60520274-60520296 AAAAAAATCATTAAGGAGGCCGG + Intronic
1150036232 17:61801942-61801964 TCAAATATAAATAAGAAGGAAGG + Intronic
1150666767 17:67147467-67147489 AAAAATAAGAATAAAAAGGCAGG - Intronic
1150706564 17:67492372-67492394 AAACATATGAAGCAGGAGGCAGG + Intronic
1150768432 17:68020924-68020946 TAAAATATGGCTAAGCCGGCCGG + Intergenic
1150947527 17:69764831-69764853 TAAAATATGCATCAAGAAGCAGG - Intergenic
1150967266 17:69985969-69985991 TAAAAGAAAAATAAGCAGGCTGG + Intergenic
1151095508 17:71492886-71492908 TAAAATATTAATATACAGGCCGG - Intergenic
1151531470 17:74708618-74708640 TAAAAAATCAATAAGGAGGCTGG + Intronic
1151547805 17:74803887-74803909 TAAAAAATAAAAAAGGTGGCAGG - Intronic
1151656134 17:75496871-75496893 GAAAATCTGAGGAAGGAGGCTGG + Intronic
1151885164 17:76919219-76919241 TAAAATATCAAAGAGGAGGATGG - Intronic
1152677585 17:81649551-81649573 GAAAATAACAATAATGAGGCTGG - Intergenic
1153385809 18:4494071-4494093 TAAAAGATCATTTAGGAGGCCGG - Intergenic
1155020832 18:21895414-21895436 TATAAGATCAATAAGGTGGCTGG - Intergenic
1155161395 18:23198612-23198634 TAAAAGCGGAAGAAGGAGGCAGG + Intronic
1155245226 18:23901988-23902010 TAAAATATGAACTATAAGGCCGG - Intronic
1155420888 18:25654805-25654827 TAGAATAAGAATAGGGAGTCAGG - Intergenic
1155455070 18:26003400-26003422 TAAAATATGAAAAAGAAAACAGG + Intergenic
1155601014 18:27547708-27547730 TAATATAAAAATAAGGAAGCAGG + Intergenic
1156178814 18:34579279-34579301 TAAAATATGAATAGATAGGTAGG + Intronic
1156429667 18:37058414-37058436 TAAAAAATAAACAAGTAGGCTGG + Intronic
1156922140 18:42534847-42534869 TGAAATGTGAAACAGGAGGCAGG - Intergenic
1157469486 18:47977902-47977924 TAAAATATGGAAAAGCAGGCCGG - Intergenic
1159095635 18:63898395-63898417 TAAAATATACAGAGGGAGGCAGG - Intronic
1159184688 18:64953665-64953687 TTAAATGTGAACAATGAGGCAGG - Intergenic
1159449038 18:68576457-68576479 TAAAAAATAAATAAAGAGGCTGG + Intergenic
1159533601 18:69686694-69686716 TAAAATATAAAAAAGGAAACAGG + Intronic
1159952382 18:74495006-74495028 TAAAAAATAAAAGAGGAGGCAGG + Intergenic
1160007508 18:75078634-75078656 TAAAATATGAAAAATTAGCCAGG + Intergenic
1160535390 18:79588848-79588870 TAAAATGTGAAGAGGGAGTCTGG - Intergenic
1160771341 19:832625-832647 TAAAATATGAATATGATGGCTGG + Intergenic
1161269072 19:3379640-3379662 AAAAAAATGAAAAATGAGGCTGG - Intronic
1161488105 19:4546561-4546583 TAAAATAAAAATAAAGAGGCAGG - Intronic
1161645389 19:5450321-5450343 TTAAATATGGATCAAGAGGCAGG + Intergenic
1161717047 19:5882134-5882156 TTAAAGATGAATAATGAGCCTGG - Intronic
1161782625 19:6303409-6303431 AAAAATATAAAAAATGAGGCAGG - Intergenic
1162106341 19:8372052-8372074 CAAAAAATAAATAAGTAGGCCGG - Intronic
1162363520 19:10233642-10233664 TAAAATAAAAATAAAGAGGCTGG + Intergenic
1162458429 19:10799828-10799850 TAAAAAAAGAAAAAGCAGGCTGG - Intronic
1162814115 19:13182958-13182980 TAAAAAATAAATAAATAGGCCGG + Intergenic
1163042635 19:14613980-14614002 TTAAAAATAAATAACGAGGCTGG - Intergenic
1163120595 19:15215103-15215125 AAAAATAATAATAAAGAGGCTGG + Intergenic
1163389186 19:17019862-17019884 TAAAAAATGAATAATGAGGCTGG - Intronic
1163462828 19:17448885-17448907 TAAAACAAGAAAAAGGAGGCCGG + Intronic
1164811810 19:31163433-31163455 TAAAAGATGACTATGGTGGCTGG + Intergenic
1164999857 19:32752168-32752190 GAAAAAATGAAGAAGGGGGCTGG - Intronic
1165171337 19:33894118-33894140 TAAAAAAAGAAAAAAGAGGCTGG - Intergenic
1165441139 19:35828558-35828580 TAAAAAATGAAAAACCAGGCCGG - Intronic
1165534792 19:36434736-36434758 TAAAATACGTATGGGGAGGCCGG + Intergenic
1165558266 19:36655305-36655327 TAAAAAACTAATAAGCAGGCTGG + Intronic
1165620584 19:37243679-37243701 TAAAATATGAGGAAGGTGACAGG - Exonic
1166229480 19:41417626-41417648 TAAAATATCAACAAGTGGGCTGG + Intronic
1166543050 19:43618327-43618349 AAAAATATAAATAAGTAGGCTGG - Intronic
1166796944 19:45432130-45432152 TAAAATATGAAAAATTAGCCCGG - Intronic
1166832508 19:45647092-45647114 TAAAATATAAAAAAATAGGCCGG - Intergenic
1167204503 19:48091591-48091613 TAAAAAATGAATAATCAGCCAGG + Intronic
1167393990 19:49215360-49215382 TCAAAAATGAATAAATAGGCCGG - Intergenic
1167886956 19:52508048-52508070 TCAAAAATAAATAAAGAGGCGGG + Intronic
1168138586 19:54368981-54369003 TAAAAAATGAATTAGTCGGCCGG - Intronic
1168361327 19:55743191-55743213 TAAAATTTAACTATGGAGGCCGG - Intergenic
1168509733 19:56964902-56964924 TAAAATACACATAAGCAGGCCGG + Intergenic
925003194 2:422545-422567 TAGAATATAAACAAGGAAGCTGG + Intergenic
926069000 2:9869517-9869539 TAAAAAACAAATAAGCAGGCCGG - Intronic
926176857 2:10601358-10601380 TAAAATACGAATTAGTTGGCTGG - Intronic
926346545 2:11951943-11951965 AAAAATATGAAAATGCAGGCCGG - Intergenic
926845463 2:17132851-17132873 TTAAATATGAAAACGTAGGCAGG - Intergenic
927724341 2:25409750-25409772 AAAAAGAAGAAAAAGGAGGCAGG - Intronic
927885972 2:26718902-26718924 GAAAATATGAAAAATGTGGCTGG - Intronic
928542466 2:32295897-32295919 TAAAAGATGAAAACTGAGGCTGG - Intronic
929052986 2:37853727-37853749 TAAAAAATGAGTAAAGTGGCCGG - Intergenic
929192298 2:39150708-39150730 GAAAATATGAAAGAAGAGGCAGG - Intergenic
929203817 2:39267373-39267395 TAAAATTAGAATAAAAAGGCCGG + Intronic
929282818 2:40100954-40100976 CAAAGTATGTAAAAGGAGGCTGG - Intronic
929909332 2:46075586-46075608 AAAAATATGAAAAATTAGGCAGG + Intronic
929910953 2:46089182-46089204 TAGAATAAGAATGAGGAGGGAGG - Intronic
930000629 2:46859369-46859391 TAAAATGTGAAGAAGGGGGATGG + Intergenic
930285222 2:49419633-49419655 TAAAACATCAATAGGGAGGAGGG - Intergenic
931568138 2:63638491-63638513 TAAAAAATGAAAAAGTGGGCTGG + Intronic
931744948 2:65283712-65283734 TAAAAAATGATTAAATAGGCGGG + Intergenic
931747493 2:65302907-65302929 TTAAAAATTACTAAGGAGGCCGG + Intergenic
932095841 2:68847599-68847621 AGAAATATGAATATGGAGACGGG - Intergenic
933417879 2:82010319-82010341 CAAAGGATGTATAAGGAGGCAGG - Intergenic
934541530 2:95179286-95179308 TAAAAACTGGATAATGAGGCTGG - Intronic
934920760 2:98343408-98343430 TAAAATATTTATGAGGAGACAGG - Intronic
935030320 2:99315359-99315381 TAAAAAATGAGTAAAGGGGCCGG - Intronic
935168160 2:100587831-100587853 TACAATATGAAAAGGGAGGTGGG + Intergenic
935363098 2:102264345-102264367 TGCAATTTTAATAAGGAGGCTGG + Intergenic
935962895 2:108444817-108444839 TAAAATATGAATTTGGTGGATGG - Intergenic
935987111 2:108686029-108686051 TAAAATATGAATTAGTGGACAGG + Exonic
936761804 2:115794759-115794781 TTAAAAATGAATAAGGACTCCGG - Intronic
936800795 2:116262485-116262507 TCAAACATGAAGAAGGAGGCAGG + Intergenic
938785666 2:134626399-134626421 TAAAAGCTGGAAAAGGAGGCTGG - Intronic
938873416 2:135506787-135506809 AAAGATATCAATAAGGAGGCAGG + Intronic
938965727 2:136386815-136386837 TAAAATATAAAAAATCAGGCTGG - Intergenic
939176507 2:138754175-138754197 TAAAAAATCAATAAAGAGGCTGG - Intronic
939533920 2:143400715-143400737 TAAAATTTAAATAAGAAGGACGG - Intronic
939675640 2:145069024-145069046 TGAAGTATCAAGAAGGAGGCTGG + Intergenic
939859207 2:147397409-147397431 TAAAATAAGAATAATGAAGCAGG - Intergenic
940344015 2:152611042-152611064 TAAAATATTTTTAAAGAGGCCGG + Intronic
941531985 2:166681763-166681785 ATTAATATGAATAAGAAGGCTGG + Intergenic
941594066 2:167453783-167453805 TCAAATATGTAAAAGGAGGAAGG + Intergenic
942080017 2:172391344-172391366 TAAAATATTAAAAATCAGGCCGG - Intergenic
942111043 2:172683048-172683070 TAAAAAACGTATAAAGAGGCTGG + Intergenic
942360091 2:175163647-175163669 TAAAAAATGAAAAATGATGCTGG + Intronic
942418442 2:175782826-175782848 TAAAATGTGCAGGAGGAGGCCGG - Intergenic
942425729 2:175858526-175858548 TAAAATCTGAATAAGGTGGGTGG - Intergenic
942442773 2:176053160-176053182 TAAAGTATGAAGAAGGAAACTGG - Intergenic
942511306 2:176705066-176705088 TTATATATGAATAAGGTGGTTGG + Intergenic
942928622 2:181462345-181462367 TATAATATGAACCAGGAGGCTGG - Intronic
943317627 2:186409892-186409914 TAACATTTGAGTAAGTAGGCTGG - Intergenic
943362814 2:186942776-186942798 TAAAATGTGCATAAGTAGGCTGG + Intergenic
943594803 2:189843361-189843383 TAAAAGCTGAATAATGAGGCTGG - Intronic
943695978 2:190931217-190931239 TAAAATATAAATAAGTACTCTGG - Intronic
943977943 2:194507998-194508020 TAAAAAAGGAATAAGAAGGCTGG + Intergenic
944246034 2:197531338-197531360 TAAAATAGCAAAAATGAGGCCGG - Intronic
944344316 2:198642776-198642798 TATGATATCAATATGGAGGCTGG - Intergenic
944730527 2:202512280-202512302 TAAAGAATGAATAAAGATGCTGG + Intronic
944963876 2:204907139-204907161 AAAAATATGAAAAAAGAGCCGGG - Intronic
945228730 2:207561086-207561108 AAAAATATGAAATGGGAGGCTGG - Intronic
945372160 2:209032463-209032485 TAAGAAATGAAATAGGAGGCTGG - Intergenic
946846720 2:223865669-223865691 TAATATATGTAGAAGGATGCTGG + Intronic
947416028 2:229897350-229897372 TAAAAAATAAATAAGGGGCCAGG + Intronic
948405415 2:237714120-237714142 TAAAATGTGAATAAGAAAACAGG - Intronic
1170158949 20:13293468-13293490 TAAATTTTGACTGAGGAGGCAGG - Intronic
1170235900 20:14105080-14105102 TAAATAATGAGTAAGGAGGAAGG + Intronic
1170510173 20:17068270-17068292 TAAAATATGGAGGAGGAGGCAGG + Intergenic
1170617019 20:17961845-17961867 GAAAATCTGATCAAGGAGGCAGG - Intronic
1172219643 20:33264681-33264703 CAAAATATGAAAAATGAGCCAGG + Intergenic
1172318365 20:33974700-33974722 AAAAATGTAAATAAGAAGGCTGG - Intergenic
1172396460 20:34609658-34609680 TTAAATATGAAGGAGGAGCCAGG - Intronic
1172695306 20:36818274-36818296 GATAAAATGAATATGGAGGCTGG + Intronic
1173143763 20:40507189-40507211 TAGAATATTACTAAGAAGGCAGG + Intergenic
1173283152 20:41647431-41647453 TATAATTTAAATAATGAGGCAGG + Intergenic
1173386814 20:42595931-42595953 TTAAAAATGAACAAGTAGGCAGG - Intronic
1174634057 20:51983662-51983684 TAAAATAACAATAAATAGGCTGG - Intergenic
1174658944 20:52193960-52193982 TAATATCTGAACAAGGAGCCGGG + Intronic
1174778562 20:53367865-53367887 TAAAAGAAGAATAAGAAGGCTGG - Intronic
1175177232 20:57119488-57119510 TAAAATATGAAAAATGAGTTGGG + Intergenic
1175354930 20:58357315-58357337 TAAAACATTAAGAAGGAGGCAGG - Intronic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1176589815 21:8636307-8636329 TAAAAAATCAACAATGAGGCTGG + Intergenic
1177356866 21:20019452-20019474 TAAAAAATAAGTAAGTAGGCTGG - Intergenic
1178204164 21:30443830-30443852 TAACATATGAATTTGGAGGAAGG - Intergenic
1178625258 21:34211122-34211144 AAAAATATGAAAAATGAGTCAGG - Intergenic
1178810031 21:35873065-35873087 TAGAAAATGAGCAAGGAGGCTGG + Intronic
1179199775 21:39205781-39205803 TAAAAAATAAATAAATAGGCTGG + Intronic
1179421929 21:41243205-41243227 TAAAAAATAAACAAGGAGCCAGG - Intronic
1180018758 21:45105396-45105418 TAAAATACAAAGAAGCAGGCCGG - Intronic
1180208289 21:46276897-46276919 TAAATAATAAATAAGCAGGCTGG - Intronic
1180435646 22:15300665-15300687 TAAAAAATGATAAAGGGGGCTGG - Intergenic
1181330241 22:22085485-22085507 GAAAATATAAATATGGAGCCAGG - Intergenic
1181739220 22:24906962-24906984 TAAAAAATAAATAAATAGGCCGG + Intronic
1182250697 22:28997713-28997735 TAAAAAAAGAATAAAGTGGCTGG + Intronic
1182308921 22:29390892-29390914 TAAAAATGGAATAAGGTGGCCGG - Intronic
1182316471 22:29450708-29450730 TAAAAAATTAATAAATAGGCCGG + Intergenic
1182328473 22:29532365-29532387 TCAAATAAGAATAAACAGGCCGG + Intronic
1182589435 22:31367442-31367464 TAAAATATAAATAATAGGGCTGG - Intergenic
1182745352 22:32601571-32601593 TAAAAAATGGCAAAGGAGGCTGG - Intronic
1183031165 22:35106253-35106275 TAAAACAAGAATAATGAGGAAGG - Intergenic
1183049390 22:35248563-35248585 TAAAATATGAAAAATTAGCCAGG - Intergenic
1184075606 22:42175499-42175521 TAAAATATGAAAAATTAGCCAGG - Intronic
1184627813 22:45751225-45751247 TAAAAGAAGAACAAAGAGGCTGG - Intronic
1184719455 22:46301783-46301805 AAAAATAAGAGTAATGAGGCTGG - Intronic
949137474 3:585399-585421 TAAAAAATCAACAATGAGGCTGG - Intergenic
949914310 3:8945764-8945786 TTAAAAATGAAGATGGAGGCCGG - Intronic
951627410 3:24680974-24680996 TATAATCTGAATAAAGAGCCTGG - Intergenic
951949663 3:28185695-28185717 CAATATATGAATTAGGGGGCAGG + Intergenic
952136393 3:30426959-30426981 TTAAATATGAGAAAAGAGGCAGG - Intergenic
952299597 3:32092703-32092725 TAAAAAAGAAAAAAGGAGGCCGG - Intergenic
952448184 3:33404114-33404136 TAAAATAAATATAATGAGGCCGG + Intronic
952470653 3:33647736-33647758 TAAAAGAAGAGTAAGTAGGCCGG + Intronic
952534754 3:34297787-34297809 GAATAAATGAATAAGCAGGCAGG + Intergenic
953374650 3:42418578-42418600 AAAAATAAGAAAAAGGAGGGAGG + Intergenic
953724562 3:45386853-45386875 TAAAATATGGAATATGAGGCCGG + Intergenic
953833220 3:46320949-46320971 TAAAAAATGGCAAAGGAGGCCGG + Intergenic
953836738 3:46352670-46352692 TGAAATATGAATAACAAGACTGG - Intergenic
953950970 3:47189864-47189886 AAAAATTTAAAGAAGGAGGCAGG + Intergenic
954020189 3:47733457-47733479 TAAAAAAAGAACAAGAAGGCCGG + Intronic
954062565 3:48080682-48080704 TAAAAAATAAATAAATAGGCCGG + Intronic
954180168 3:48875394-48875416 TAAAAAATAAATAAATAGGCTGG - Intronic
954922663 3:54205080-54205102 TAAAAGATGAATAGGAAGCCAGG + Intronic
955174795 3:56603129-56603151 TAAAAAATGATAAAGGGGGCCGG - Intronic
956058224 3:65323000-65323022 TAGAAAAAGAAAAAGGAGGCCGG - Intergenic
956121511 3:65970906-65970928 TAAAAAATAAATAAATAGGCTGG + Intronic
956332953 3:68131461-68131483 AAAAATAAAAATAAGGATGCAGG - Intronic
956457558 3:69438400-69438422 TAAAATATTCATAACAAGGCTGG - Intronic
956824045 3:72980869-72980891 TAAAAAATGAATACGGGGCCAGG - Intronic
957240565 3:77655979-77656001 AAAAATATGAAAAATAAGGCCGG + Intergenic
957661325 3:83157411-83157433 TAGAATATAAATCTGGAGGCTGG + Intergenic
958725563 3:97901747-97901769 TAAAAAAAGAACAAGGAGGTAGG - Intronic
958907135 3:99954527-99954549 TAAAATAAGAATAACTGGGCTGG + Intronic
959367608 3:105482403-105482425 TAAAATATGAATTAAGGGCCAGG - Intronic
959508628 3:107183524-107183546 TAATATATGAATATGGAGACTGG - Intergenic
959837795 3:110941147-110941169 GAATATATGAATAAGAAGACAGG - Intergenic
959927109 3:111935258-111935280 AAAAATATGAAAAATGAGCCAGG - Intronic
959930228 3:111972987-111973009 AAAAGCATGAATGAGGAGGCAGG - Intronic
960611829 3:119561664-119561686 TAAAAGATTTAAAAGGAGGCTGG + Intergenic
962089166 3:132224829-132224851 TAAAATAACAATAAAAAGGCCGG - Intronic
962449462 3:135500473-135500495 TGAAATATGGATAAGATGGCTGG + Intergenic
962798630 3:138870359-138870381 TAAAATAAGAAAAAAAAGGCTGG + Intergenic
963067124 3:141272764-141272786 AAAAATATGAATAGACAGGCTGG - Intronic
963328723 3:143890912-143890934 AAAAATATGAATAAAGATGTAGG + Intergenic
963355328 3:144204307-144204329 AAAAATATGAATAGAGAGGCTGG - Intergenic
963375511 3:144458626-144458648 TTAAAAATGAAGAAAGAGGCTGG + Intergenic
964093884 3:152908848-152908870 TAATAAAAGAATAAGAAGGCTGG - Intergenic
964101650 3:152994784-152994806 TGAAAAATGAATTAAGAGGCTGG - Intergenic
964171451 3:153775213-153775235 TAAAGTATGAAAAAACAGGCCGG - Intergenic
964265114 3:154887423-154887445 TAAAAGAGGAATCAGGAAGCAGG + Intergenic
964496157 3:157292685-157292707 TAAAAAAAGAAAAAAGAGGCCGG + Intronic
964602689 3:158519456-158519478 TAAAATCTGAATAACAAGGAGGG + Intronic
964665132 3:159163659-159163681 TAATACATGAAAAATGAGGCTGG - Intronic
964748675 3:160035049-160035071 CAAAAAATAAATAAGTAGGCTGG - Intergenic
964757728 3:160103951-160103973 TAAAATGTGCATAAGTGGGCCGG + Intergenic
964763449 3:160156184-160156206 TAAAATTTGAATGAAGAGGCTGG - Intergenic
965134672 3:164747362-164747384 TTGAATATGAAAAATGAGGCAGG + Intergenic
965322956 3:167269992-167270014 TAAAATCTGACTAAAGAGGTTGG - Intronic
965464950 3:169017533-169017555 TAAAATATGAATTTGGGGGCAGG + Intergenic
966089383 3:176114139-176114161 GAAAATATGAAAAATGAGGCTGG - Intergenic
966339764 3:178912662-178912684 TAAAATAAGAAAAAGTAGGTGGG + Intergenic
966351714 3:179038415-179038437 TAAAAAAAGAAAAATGAGGCAGG + Intronic
966419577 3:179724159-179724181 TAAAAAAATAATAAGAAGGCCGG + Intronic
966632134 3:182088732-182088754 AAAAGAATGAATAAGGGGGCCGG + Intergenic
966676301 3:182594042-182594064 TAAAATAATAATAATGAGACTGG + Intergenic
966706671 3:182924120-182924142 TAAAATATGAAATAAGGGGCCGG + Intergenic
966751555 3:183327028-183327050 TAAAAAATAAATAAATAGGCCGG + Intronic
967180832 3:186902463-186902485 TAAAAAAAAAAAAAGGAGGCTGG + Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967626230 3:191688233-191688255 TAAAATATGAAAAATTAGCCAGG + Intergenic
968202988 3:196771852-196771874 GAAAATATGAAAGAGGAGGCCGG - Intronic
968399181 4:275003-275025 TAAAATATTCATAAGGAAACAGG + Intronic
968417088 4:448012-448034 TAAAATATTCATAAGGAAACAGG + Intronic
969939914 4:10721881-10721903 AAAAATATGAATAAACAGCCAGG + Intergenic
969958178 4:10913250-10913272 AAAAATATGAATATGTAAGCAGG - Intergenic
971100696 4:23463834-23463856 GAAAATATGAAAAGGGAGACTGG - Intergenic
971674712 4:29611564-29611586 AAAAATATGAAAAGGGAGACTGG + Intergenic
971684697 4:29748873-29748895 GAAAATTTTGATAAGGAGGCTGG + Intergenic
971789856 4:31155513-31155535 TAACATATGAATTTGGAGGGAGG + Intergenic
971869921 4:32221180-32221202 TATAATACAAATAAGGAGGCCGG - Intergenic
972759079 4:42084212-42084234 TAAAATATAAGTACTGAGGCAGG - Intronic
973106321 4:46342957-46342979 TTAAACATGAATAAACAGGCAGG - Intronic
974623889 4:64397575-64397597 TAAACTATGAACCAGGAAGCTGG + Intronic
975063576 4:70035602-70035624 TAAAATATCAACAAGGAGATGGG + Intronic
976424484 4:84885615-84885637 AAAAATATGAACAAGGAATCTGG + Intronic
977309660 4:95369800-95369822 TAAAATATGAATAAATAGGAAGG + Intronic
977607551 4:98997122-98997144 AAAAATATGAATAAGAATGAAGG + Intronic
977673423 4:99721937-99721959 AAAAATATGAATAAGGAAGCTGG - Intergenic
977940134 4:102848655-102848677 TAAAAAATAAATAAATAGGCTGG + Intronic
978071765 4:104481231-104481253 AAAAATATAAATAGGGAGGCCGG + Intronic
979143682 4:117212669-117212691 TAAAAAATTATAAAGGAGGCCGG - Intergenic
979718479 4:123870117-123870139 TAAAGGATGAATGAGGAGGGGGG + Intergenic
979745368 4:124206077-124206099 TAAAATATAAATCATCAGGCAGG - Intergenic
979958767 4:126990196-126990218 TAAAATGTGACTAAGAAAGCTGG - Intergenic
980575011 4:134675632-134675654 TAAAAGGGGAAAAAGGAGGCAGG + Intergenic
981140089 4:141258392-141258414 AAAAATATTAATATTGAGGCAGG + Intergenic
981152218 4:141392324-141392346 AAAAATATGCATAAAGAGGGAGG - Intergenic
982059960 4:151594867-151594889 TAAAAAATGACAAAGGTGGCTGG - Intronic
983493666 4:168418362-168418384 TAAAACATGGGTAATGAGGCCGG - Intronic
983642830 4:169959171-169959193 TAAATGATGAATTAAGAGGCTGG + Intergenic
983737104 4:171074960-171074982 TAAAAGATCAAGAAGGAGGCCGG - Intergenic
983752253 4:171289624-171289646 AAGAAAATGAATAAGCAGGCCGG + Intergenic
983902779 4:173154218-173154240 AAAAAGATGATTAAGTAGGCTGG + Intergenic
984282330 4:177686272-177686294 TACAAGATGAATAAAGAGCCTGG + Intergenic
984403668 4:179299706-179299728 AAAAATGTGAATAGGGAGACTGG - Intergenic
984693290 4:182753242-182753264 TAAAAATTCAGTAAGGAGGCAGG - Intronic
984766857 4:183406476-183406498 TAAAAAAATAAAAAGGAGGCCGG + Intergenic
986191326 5:5498656-5498678 AAAAATATGAAAAAGTAGCCAGG + Intergenic
986473527 5:8099325-8099347 TAAAATATGCATAAAGAAACAGG + Intergenic
986881555 5:12178566-12178588 TAAAATATGAATAAAAAAGGTGG + Intergenic
987047919 5:14124828-14124850 AAAAAAATGGAGAAGGAGGCCGG + Intergenic
987277168 5:16374364-16374386 AAACACATTAATAAGGAGGCTGG - Intergenic
987477977 5:18415731-18415753 AAAAATATGTATATGGAGACTGG - Intergenic
987555444 5:19440784-19440806 TAAAATATGAAAAATCAGCCAGG + Intergenic
988374474 5:30416387-30416409 TAAATTATGAATAAGAAAGCAGG + Intergenic
988801746 5:34702320-34702342 AAAAATATGAAAAATTAGGCTGG + Intronic
988995036 5:36706514-36706536 TAAAAGTGGAAGAAGGAGGCAGG + Intergenic
989077978 5:37585284-37585306 TAAAAAATGGACAAGGAGGCTGG - Intronic
989157274 5:38356053-38356075 TAAAATATACATAAGAAGCCAGG - Intronic
989438764 5:41445889-41445911 TAAAAAAAGAACAACGAGGCCGG + Intronic
990096882 5:52126581-52126603 TAAAATAATAATAAAGGGGCTGG + Intergenic
990322182 5:54640761-54640783 TAAAAAAAAAATCAGGAGGCTGG + Intergenic
990544922 5:56814196-56814218 TGAAACATGATTAAGGAGGGGGG - Intergenic
991356549 5:65775017-65775039 TAAAATATGACTAATTAGGCTGG - Intronic
992454381 5:76902887-76902909 TTAAAAATAAATAAGGCGGCTGG + Intronic
992719995 5:79551156-79551178 TAAAAAATAAATAACGAGGCCGG + Intergenic
992784866 5:80159916-80159938 AAGAATATGAATAAACAGGCAGG - Intronic
992934253 5:81685427-81685449 TAAGATATGGATAATCAGGCAGG + Intronic
994642476 5:102427134-102427156 TAAAATATAAATAAGAAACCTGG + Intronic
994716668 5:103329711-103329733 CAACATATGAATATGGAGGAGGG + Intergenic
995230898 5:109761884-109761906 TAAAATGTTGATAAGAAGGCTGG - Intronic
995273441 5:110249822-110249844 TAACAAATGAATAAATAGGCAGG + Intergenic
995496655 5:112752174-112752196 GAAAATATGAATAAGAAGGCAGG - Intronic
995573773 5:113508538-113508560 TAATATATGAATTAGGGGGGTGG - Intergenic
995974838 5:118021648-118021670 CAAAATATGAATAAGAAGAAAGG - Intergenic
996914380 5:128694699-128694721 TTAAATAGGATTAAGGAGGTTGG - Intronic
996914592 5:128697138-128697160 TATAATATGAATAAAACGGCAGG - Intronic
996992013 5:129646182-129646204 TAAAAATTGGAAAAGGAGGCCGG - Intronic
998047484 5:139000319-139000341 TTAAACATGAATAAGGATGAAGG + Intronic
998238747 5:140423192-140423214 TATAATTTGAATAAATAGGCTGG - Intronic
998448286 5:142215270-142215292 TAAAATATTTAGAAAGAGGCTGG - Intergenic
999078108 5:148816679-148816701 AAAAAAATGAACAAAGAGGCAGG - Intergenic
999441948 5:151608375-151608397 TAAAAAAGGAATGAAGAGGCTGG - Intergenic
999993567 5:157070466-157070488 GAAAGAATGAATAAGAAGGCTGG - Intergenic
1000011158 5:157234276-157234298 CAAAATATTAGTAAGGAGGCTGG - Intronic
1000120460 5:158193053-158193075 TAAAATTTGAAGACGGAGGAAGG - Intergenic
1000204261 5:159042730-159042752 TAAGATATTAATAAGTAGGAGGG - Intronic
1000284950 5:159819006-159819028 TAGAAAATGAACAAGCAGGCAGG + Intergenic
1000687848 5:164274796-164274818 TAAAAAATAAAAAAGTAGGCCGG + Intergenic
1000733511 5:164868053-164868075 TAAAATACGAATGAGAAGGTTGG - Intergenic
1000865696 5:166512242-166512264 AAAAATATGAATAATTAGCCAGG - Intergenic
1001164060 5:169347481-169347503 TAAAAGATGAACAATGAGGTTGG - Intergenic
1002150706 5:177227734-177227756 TTAAATATGAATATTTAGGCCGG - Intronic
1003046299 6:2736101-2736123 TAAAATGTTAATAATGAGTCAGG + Intronic
1003096095 6:3144686-3144708 AGAGATATGAATAAAGAGGCTGG - Intronic
1003626098 6:7742864-7742886 TAAATTATGTATAATGAGACAGG + Intronic
1003777885 6:9389882-9389904 GAGAAGATGAAAAAGGAGGCAGG + Intergenic
1003953700 6:11142776-11142798 AAAAAGATGAATAAGGAGAAGGG - Intergenic
1004387211 6:15183534-15183556 AAAAAGAAGAAGAAGGAGGCTGG - Intergenic
1004515180 6:16316448-16316470 TAAAATCTGAAAGAAGAGGCCGG + Intronic
1005618683 6:27600260-27600282 TTAAATATGAACAGGGAGGTGGG + Intergenic
1005689140 6:28284919-28284941 CAAAATATGAATAAGGACTAAGG - Intronic
1005945580 6:30593006-30593028 TAAATTAAAAATAAGGAGGCCGG + Intronic
1006292020 6:33145597-33145619 TATAATAGTAATCAGGAGGCTGG + Intergenic
1006494201 6:34409813-34409835 TAAAAAATGAATAAACAGACCGG + Intronic
1006756640 6:36421832-36421854 TAAAAGAAGAGTAAGGAGGTTGG - Intronic
1006859650 6:37162388-37162410 TAAAATACGAGTAAGTAGGAAGG - Intergenic
1007620292 6:43209111-43209133 AAAAATTAGAATATGGAGGCTGG - Intronic
1007639132 6:43322848-43322870 TAAAATATAAAAAAGAAGCCAGG + Intronic
1007676707 6:43601760-43601782 TAAAAAATAAATAAATAGGCCGG + Intronic
1007934051 6:45717459-45717481 TAAAGTAGGAACAAGGAGGTTGG - Intergenic
1008175910 6:48267841-48267863 TAAAAAATGATAAAGGGGGCCGG - Intergenic
1008660033 6:53658190-53658212 CAAAATATCAATAAGGAGCTAGG + Intronic
1008930967 6:56939446-56939468 TACAATATGCACAAGGAGGAAGG + Intronic
1008953786 6:57191608-57191630 TAAAATATGAAAAATTAGCCGGG - Intronic
1009034156 6:58096199-58096221 TAACATTTGAATAAGTAGACCGG - Intergenic
1010063459 6:71652213-71652235 TAGAGAATGAATAAGGAGGCTGG - Intergenic
1010182775 6:73107200-73107222 AAAACTATGAACAAGGAGGTAGG + Intronic
1010985931 6:82424035-82424057 TTAAATATTAATTAAGAGGCTGG - Intergenic
1011433439 6:87312773-87312795 TACAATTTGAATAGGGAGGCGGG - Intronic
1011477376 6:87761281-87761303 TAAAAATGGAATAATGAGGCCGG + Intergenic
1011732851 6:90283669-90283691 TTAAAAATGCATGAGGAGGCCGG - Intronic
1012301173 6:97590270-97590292 AACTATATGAATAAGGAGGAAGG - Intergenic
1012730787 6:102877127-102877149 TAACATTTGAATCAGTAGGCTGG + Intergenic
1013034061 6:106362947-106362969 TAAAATTTAAAATAGGAGGCCGG + Intergenic
1013187519 6:107773284-107773306 AAAAATATGAATAATAAGGCCGG + Intronic
1013585923 6:111579032-111579054 AAAAAAATGATTAAAGAGGCAGG + Intronic
1014031190 6:116706865-116706887 TAAAAAATGATTATGCAGGCCGG + Intronic
1014874304 6:126637884-126637906 TTAAATATGACTAAGCAGGTTGG - Intergenic
1015403372 6:132811907-132811929 AAAAATGTGAACTAGGAGGCTGG + Intergenic
1015809855 6:137151123-137151145 AAAAAGATGAATAAAGAGGAGGG + Intronic
1015885734 6:137916140-137916162 TAAAATAAATAGAAGGAGGCAGG + Intergenic
1015987844 6:138903060-138903082 TAAAATATGGATAAGAGGGCTGG + Exonic
1016231393 6:141809426-141809448 TAGAATATGACCGAGGAGGCAGG + Intergenic
1016943567 6:149506180-149506202 TTAAATAAGAAAATGGAGGCTGG + Intronic
1017168694 6:151435142-151435164 TAAAAAATAAATAAATAGGCCGG - Intronic
1017660213 6:156666801-156666823 TAAAAAATGATAAAGGCGGCTGG + Intergenic
1017661971 6:156683759-156683781 TAAAAATTGAATAAATAGGCTGG - Intergenic
1018265969 6:162024491-162024513 TAAAATAGAAATAAGTGGGCTGG - Intronic
1018382890 6:163275805-163275827 TGAATTATTAATAAGGAGGCAGG - Intronic
1020817284 7:12921572-12921594 TAAATTATGAATAATGAAGAAGG + Intergenic
1021332951 7:19361549-19361571 TAAATAATGAATAAGGTGGAAGG + Intergenic
1021417555 7:20405612-20405634 TAAAATATTAAAAATAAGGCCGG - Intronic
1022086561 7:27073930-27073952 TAAAAGACTAAAAAGGAGGCTGG - Intergenic
1022226849 7:28371887-28371909 TAAAATCTGCTTAAGAAGGCAGG + Intronic
1022240901 7:28511643-28511665 AAAAATATGAAAAATGAGCCGGG - Intronic
1022594902 7:31704064-31704086 TGAAAAAGGAATAATGAGGCTGG + Intronic
1023308474 7:38856372-38856394 CAACATATGAATTAGGAGGTGGG + Intronic
1024772908 7:52745460-52745482 TAAAAGATTAATAAGTAGGCCGG + Intergenic
1024940110 7:54754032-54754054 TACAATATAAATAACAAGGCAGG + Intronic
1025075380 7:55937905-55937927 AAAAATAAGAATTAAGAGGCCGG + Intronic
1025716069 7:63956663-63956685 TAAAGTAAAAATAAGGAGACTGG - Intergenic
1025833238 7:65072872-65072894 TAAAAACTGAGTAAGGTGGCCGG - Intergenic
1025903000 7:65762378-65762400 TAAAAACTGAGTAAGGTGGCCGG - Intergenic
1025960401 7:66215667-66215689 AAAAATATATATTAGGAGGCTGG - Intronic
1026116148 7:67497425-67497447 TAAAAAATAAATAAAGAGGGAGG + Intergenic
1026556172 7:71410540-71410562 TATAAAATTAATCAGGAGGCTGG - Intronic
1026875911 7:73879094-73879116 AAAAATATGAAAAATTAGGCGGG - Intergenic
1026989291 7:74574296-74574318 TTAAATAAGAATAATGAGGCCGG - Intronic
1027181111 7:75940058-75940080 TAAAATAAGAGTAAAGAGGTGGG - Intronic
1027186543 7:75974821-75974843 TAAAAAAAGAAAAAAGAGGCTGG - Intronic
1027407248 7:77874582-77874604 AAAAATATGAATAGAGAGACTGG - Intronic
1027504694 7:79001209-79001231 TAAAAAGTGAATAAAGTGGCCGG - Intronic
1027619852 7:80471048-80471070 AAAAATGTGAAAAGGGAGGCTGG + Intronic
1027702841 7:81489992-81490014 TAATATATGAACAAGGAGAGAGG + Intergenic
1027947199 7:84762801-84762823 TAAAATATGAGTTATGGGGCAGG + Intergenic
1028179756 7:87705263-87705285 TAAAATATGAAAAATTAGCCAGG + Intronic
1028359726 7:89953150-89953172 GAAAATATGAATCAGGACGGGGG - Intergenic
1028385243 7:90246057-90246079 TAAAATATGAAATTGGAAGCTGG + Intronic
1030024541 7:105310388-105310410 AAAAATATGAAAAAATAGGCTGG + Intronic
1030125232 7:106146939-106146961 TGAAATATGCACAGGGAGGCAGG - Intergenic
1031094974 7:117406347-117406369 TAAAATATGAAAATAGAGGATGG + Intronic
1031132877 7:117853273-117853295 TAAAAAATGAAAAAGGAAGAGGG - Intronic
1031151162 7:118056029-118056051 TAAAAAATGCCTGAGGAGGCTGG + Intergenic
1031306016 7:120129217-120129239 TAAAATACAAAAAAGGAGCCGGG - Intergenic
1031316418 7:120262860-120262882 TAAAATATGAAAAAAGATGGCGG - Intergenic
1031574672 7:123400862-123400884 GAAAAGATGAATAATGATGCAGG + Intergenic
1031600381 7:123700598-123700620 TAAAATATGAAAAATTAGCCAGG - Intronic
1031639255 7:124141608-124141630 TACAATTTGAATAAGGAGTGTGG + Intergenic
1032227365 7:130043336-130043358 TAAAATATGAAAGAAGATGCAGG + Intronic
1032776610 7:135120704-135120726 TCAAATATGACAATGGAGGCAGG + Intronic
1033200825 7:139368440-139368462 TAAAAAATGGATAAAGAGGCCGG + Intronic
1033212361 7:139469454-139469476 CAAAAAATAAATAAGTAGGCTGG - Intronic
1033374610 7:140746102-140746124 TAAAATATGAATCTGTAGGTTGG - Intronic
1034520776 7:151617795-151617817 AAAATTGTGAATAAGGAGTCAGG - Intronic
1034533874 7:151714651-151714673 TAAATTAAGAATAAGTGGGCCGG + Intronic
1035485844 7:159225300-159225322 TAAAATATTATAAAGGATGCAGG + Intergenic
1037526381 8:19728353-19728375 TAAAAAGTGAATAAGAATGCAGG + Intronic
1039405862 8:37312023-37312045 AAAAAAAAGAATAAGGATGCTGG - Intergenic
1039604931 8:38872433-38872455 TAAAATATGGATGATGGGGCTGG + Intergenic
1039848851 8:41345106-41345128 TAAAATAGGAAAAAAGAGACTGG - Intergenic
1040515695 8:48132691-48132713 TAAAATAAGAATAAGGTGTAAGG - Intergenic
1040918112 8:52584703-52584725 TAAAATATGAGAAAAGAGGCCGG - Intergenic
1041078143 8:54187801-54187823 TAAAAAATCAATACAGAGGCTGG + Intergenic
1041719550 8:60963933-60963955 AAAAATATGCATAATGAGACAGG + Intergenic
1041721084 8:60975951-60975973 TACAATAAGTACAAGGAGGCCGG + Intergenic
1042161246 8:65897913-65897935 TAAAAAAAAAATAAGGAGGCCGG - Intergenic
1042635615 8:70870007-70870029 TATGATATGAATGAGGAGGCTGG + Intergenic
1042670704 8:71260014-71260036 TCAAATATTAATGAGGAAGCAGG + Intronic
1043291863 8:78612132-78612154 TAAAATATGAATAGGTTTGCAGG - Intergenic
1043377503 8:79667183-79667205 TCAAAGATGAAGAAGCAGGCCGG + Intergenic
1043475296 8:80599939-80599961 TAAAATATGAAAAATTAGCCGGG - Intergenic
1043767200 8:84151169-84151191 TAAAAAATAAATAAGAAGCCAGG + Intergenic
1043839507 8:85086204-85086226 TAAAAAATGAAGAAGGACGGTGG + Intergenic
1045283814 8:100772739-100772761 TAAAAAATGAATGAGTAGACTGG - Intergenic
1045497336 8:102719621-102719643 GAATAAATGAATAAGGTGGCTGG + Intergenic
1045517663 8:102874544-102874566 TAAACTGTGAATAATCAGGCAGG - Intronic
1045821381 8:106342549-106342571 TAAAAGATGAAAAGAGAGGCCGG - Intronic
1046231700 8:111366223-111366245 TAAAATATGTAAAAGAATGCAGG + Intergenic
1046492804 8:114975123-114975145 TTAAATATGAACCATGAGGCTGG + Intergenic
1046720832 8:117617300-117617322 TAAAATTTGAGTAAGTGGGCTGG + Intergenic
1047017062 8:120734990-120735012 TAAAATAGGAAGAATGAGTCAGG + Intronic
1047278086 8:123421079-123421101 AAAAAAATGAATAAATAGGCCGG - Intronic
1047357849 8:124140303-124140325 TAAAATAGGAATAATTAGGGAGG - Intergenic
1048085819 8:131178332-131178354 TAAAAAAAGTAGAAGGAGGCTGG + Intergenic
1048176922 8:132161330-132161352 AGAAATATGAATAAAGGGGCTGG + Intronic
1048582477 8:135741215-135741237 TCTAATATGAGTTAGGAGGCAGG + Intergenic
1048817847 8:138350745-138350767 TAATGTATGAATAAGGAAACAGG - Intronic
1049677268 8:143896397-143896419 TAAAAAATCAATCATGAGGCTGG + Intergenic
1050220170 9:3378850-3378872 TAGAATATGAGAAAGAAGGCCGG - Intronic
1050377304 9:4985829-4985851 TTAAAAAGGAATAAGGAGGCGGG - Intronic
1051061951 9:13055118-13055140 TAAAAAATGAATAACAAGGAAGG - Intergenic
1051633326 9:19159824-19159846 TGAAATGTGAATAATGTGGCCGG + Intergenic
1051750293 9:20334469-20334491 TGTAATGGGAATAAGGAGGCTGG + Intergenic
1052003931 9:23323527-23323549 TGAACTATTAATTAGGAGGCTGG + Intergenic
1052099422 9:24426382-24426404 TAGAATATGAAAAAGGAGAGAGG - Intergenic
1052231789 9:26163288-26163310 TGAAAAATAAATAAGAAGGCCGG + Intergenic
1052274995 9:26665297-26665319 TAAAAGATGAATAAGAAGTAAGG - Intergenic
1052958779 9:34276104-34276126 TGAATTAAGAATAATGAGGCTGG + Intronic
1053421466 9:37982494-37982516 AAAAAAATGGATAAGTAGGCCGG + Intronic
1053704490 9:40736894-40736916 TAAAAAATGATAAAGGGGGCTGG + Intergenic
1054414575 9:64860504-64860526 TAAAAAATGATAAAGGGGGCTGG + Intergenic
1055604092 9:77949797-77949819 TAGAATATGAATAAAGATACGGG - Intronic
1055692943 9:78853279-78853301 AAAAATATGAAGAAGAAGGTAGG - Intergenic
1055716455 9:79123276-79123298 TCAAATATGTTTAAGGAGGAAGG - Intergenic
1056211885 9:84372391-84372413 TAAAATGTAAATTTGGAGGCCGG - Intergenic
1056804336 9:89716883-89716905 TAAAATATGACGAAGCTGGCAGG - Intergenic
1056825869 9:89875953-89875975 TAAAAAAGAAAGAAGGAGGCTGG + Intergenic
1056952627 9:91055772-91055794 TACAATATGAAAAAGGTGGAGGG - Intergenic
1058002788 9:99883427-99883449 TAACATACTAATTAGGAGGCTGG - Intergenic
1058466183 9:105230926-105230948 AAAAATATGAAAAATGTGGCTGG + Intergenic
1059055938 9:110979601-110979623 TAAAATATCAAAAAGCAGGTAGG + Intronic
1059373177 9:113860152-113860174 TAAAAAATGAGCAAGGGGGCTGG - Intergenic
1059404407 9:114091166-114091188 TATAATATGTGAAAGGAGGCTGG + Intronic
1059946637 9:119415269-119415291 TAAAAAATGCATAAGGAGCAAGG - Intergenic
1060095701 9:120787323-120787345 TAAAATATGGGAAAGGAGGTCGG - Intronic
1060384388 9:123210534-123210556 TAAAAAATGATCAAGCAGGCCGG + Intronic
1060394930 9:123309248-123309270 TAAAATATGTTCAGGGAGGCTGG - Intergenic
1060443312 9:123662271-123662293 CAAAAGAAGAATAAAGAGGCTGG + Intronic
1060949423 9:127591933-127591955 AAAAATCTCAAAAAGGAGGCTGG - Intergenic
1061023538 9:128032652-128032674 TAAAAAATAAATAAATAGGCCGG - Intergenic
1061410889 9:130420894-130420916 TTAAAAAAAAATAAGGAGGCTGG - Intronic
1061702152 9:132424109-132424131 TAAAAAAAGAGTTAGGAGGCCGG + Intronic
1061703442 9:132433842-132433864 TAAAAGATGAATAAATAGGTTGG - Intronic
1061706627 9:132458021-132458043 TAAAATATGACGAGGGAGGGAGG - Intronic
1062559070 9:137131232-137131254 AAAAATATGAATTAAAAGGCCGG + Intergenic
1203619832 Un_KI270749v1:114954-114976 TAAAAAATCAACAATGAGGCTGG + Intergenic
1186018388 X:5225802-5225824 TAAAAAATGAAAAAATAGGCTGG + Intergenic
1186229902 X:7442078-7442100 TAAAATATAAAAAAGTAGCCAGG - Intergenic
1187103127 X:16215331-16215353 TAAAAGATAAAAAAGAAGGCTGG - Intergenic
1187644916 X:21336541-21336563 TAAAAAAAGAAAAAGGAGACAGG + Intergenic
1187743231 X:22379315-22379337 TATAATATGGAAAGGGAGGCGGG - Intergenic
1187977713 X:24719904-24719926 TAAGAGATCAATTAGGAGGCTGG - Intronic
1188087231 X:25914440-25914462 TAAAAGATTAATAAGGAGATGGG + Intergenic
1190087689 X:47409943-47409965 TAAAAAATGAAGAAGGAGGCTGG - Intronic
1191629721 X:63310158-63310180 TAAAATTTGAATCAGTGGGCTGG - Intergenic
1192104493 X:68301148-68301170 AAAAATATGAACAAGCAGCCGGG + Intronic
1193149619 X:78111243-78111265 AAAAATATGAAAAAGTAGCCAGG - Intronic
1193344950 X:80394688-80394710 TAAAAAATAAATAAGCAGGCTGG - Intronic
1193955999 X:87863523-87863545 CCAAATATGAAGAACGAGGCCGG - Intergenic
1194220083 X:91179065-91179087 AAAAATAAGAATAAGGGGCCGGG + Intergenic
1194456843 X:94115249-94115271 TATAAAAAGAATAAGGCGGCTGG - Intergenic
1194651732 X:96523374-96523396 CAAAAAATTAATAAAGAGGCCGG + Intergenic
1195474225 X:105265885-105265907 TAAGATATGCGTATGGAGGCAGG + Intronic
1196113846 X:111976124-111976146 AACAAAATGAATATGGAGGCTGG + Intronic
1196921157 X:120586542-120586564 AAAAATAGGAAGGAGGAGGCGGG + Intergenic
1197280983 X:124535592-124535614 TATAATAAGAATAATGAGGATGG - Intronic
1197496010 X:127181456-127181478 TAAAATATGAGTAAAGACTCTGG - Intergenic
1197784952 X:130189935-130189957 TAAAAAATTAAAATGGAGGCTGG - Intergenic
1197985411 X:132261665-132261687 TAAAAAATAAAAAATGAGGCAGG + Intergenic
1198465585 X:136902005-136902027 TAAAAAATAAATAAATAGGCCGG + Intergenic
1198667738 X:139043506-139043528 TAAAATATTGATAAGCAGCCAGG - Intronic
1198778813 X:140212120-140212142 TAAAAAATGAACAGGGCGGCCGG + Intergenic
1199049392 X:143219302-143219324 TAAAATATGAAGAATGAGTAGGG - Intergenic
1199526997 X:148803893-148803915 TTAAAGGTGAAAAAGGAGGCTGG - Intronic
1199701577 X:150381335-150381357 TAAACTCTGAATAAGGTGGATGG - Intronic
1200257453 X:154591711-154591733 TAAAAACTAAAGAAGGAGGCCGG - Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200556593 Y:4642825-4642847 AAAAATAAGAATAAGGGGCCGGG + Intergenic
1201451816 Y:14124058-14124080 TAAAAAATGAAAAAGTAGGCTGG + Intergenic
1201682644 Y:16665793-16665815 TAAAAAATGCATAATCAGGCTGG - Intergenic
1202329727 Y:23735791-23735813 TAAAGTTTGAACAAGTAGGCAGG - Intergenic
1202345666 Y:23922854-23922876 TAAAATTTGATGAAGTAGGCAGG - Intergenic
1202525105 Y:25747236-25747258 TAAAATTTGATGAAGTAGGCAGG + Intergenic
1202541043 Y:25934263-25934285 TAAAGTTTGAACAAGTAGGCAGG + Intergenic
1202588622 Y:26458538-26458560 TACAATATGAATATACAGGCCGG - Intergenic