ID: 1103623012

View in Genome Browser
Species Human (GRCh38)
Location 12:122200356-122200378
Sequence ACAGAAGTGCAGCCTGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 274}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103623012_1103623025 28 Left 1103623012 12:122200356-122200378 CCATCCACAGGCTGCACTTCTGT 0: 1
1: 0
2: 1
3: 21
4: 274
Right 1103623025 12:122200407-122200429 CCCATGGGAGCCGCACTCCCTGG 0: 1
1: 0
2: 0
3: 14
4: 143
1103623012_1103623014 -2 Left 1103623012 12:122200356-122200378 CCATCCACAGGCTGCACTTCTGT 0: 1
1: 0
2: 1
3: 21
4: 274
Right 1103623014 12:122200377-122200399 GTCCTTGTTCCTGTTCCCATCGG 0: 1
1: 0
2: 0
3: 22
4: 204
1103623012_1103623018 12 Left 1103623012 12:122200356-122200378 CCATCCACAGGCTGCACTTCTGT 0: 1
1: 0
2: 1
3: 21
4: 274
Right 1103623018 12:122200391-122200413 TCCCATCGGGCTGTCCCCCATGG 0: 1
1: 0
2: 0
3: 10
4: 86
1103623012_1103623020 13 Left 1103623012 12:122200356-122200378 CCATCCACAGGCTGCACTTCTGT 0: 1
1: 0
2: 1
3: 21
4: 274
Right 1103623020 12:122200392-122200414 CCCATCGGGCTGTCCCCCATGGG 0: 1
1: 0
2: 0
3: 8
4: 69
1103623012_1103623015 -1 Left 1103623012 12:122200356-122200378 CCATCCACAGGCTGCACTTCTGT 0: 1
1: 0
2: 1
3: 21
4: 274
Right 1103623015 12:122200378-122200400 TCCTTGTTCCTGTTCCCATCGGG 0: 1
1: 1
2: 1
3: 17
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103623012 Original CRISPR ACAGAAGTGCAGCCTGTGGA TGG (reversed) Intronic
902208185 1:14885208-14885230 CCAGGAGTCCAGCCTGGGGAAGG + Intronic
902502239 1:16918627-16918649 GCAGGTGTGCAGCCTGTAGAGGG + Intronic
902801537 1:18833027-18833049 ACAGAGGAGCAGCCTGGGCAAGG - Intergenic
903532546 1:24042886-24042908 ACAGAAGAGCAGGCTGGGCATGG + Intergenic
903580085 1:24364334-24364356 AGTGAAGTGCAGGCTGTTGACGG - Exonic
903640874 1:24859331-24859353 ACAGAAGTGCAGGGTCGGGAGGG + Intergenic
903833643 1:26189338-26189360 AGAGAAGTTCCGCCAGTGGAAGG + Exonic
904114485 1:28151502-28151524 GCAGAGGTGTGGCCTGTGGAAGG + Intronic
906412299 1:45588392-45588414 AAAGAAGTGTAGCCTGGGCACGG - Intronic
906694359 1:47814209-47814231 GCTGGAGTGCAGCCTGTGGCTGG + Intronic
907744571 1:57199897-57199919 TAAGAAGTTCAGCCTATGGACGG + Intronic
907754863 1:57301658-57301680 AATGAAATGCAGCTTGTGGAAGG - Intronic
908221391 1:62010189-62010211 TCAGAAGTGGAGCCTGAAGATGG - Intronic
908751955 1:67431987-67432009 ACAGAACCAGAGCCTGTGGAAGG - Intergenic
911083687 1:93958262-93958284 AAAGAAGAGAAGCCTTTGGATGG - Intergenic
911646304 1:100340871-100340893 ACAGAAGTGCAGGCTATTCATGG - Intergenic
912055477 1:105592925-105592947 ACTGAAGTGGGGGCTGTGGATGG - Intergenic
914686541 1:149984897-149984919 AAAGAGCTGTAGCCTGTGGAAGG - Intronic
916203535 1:162294263-162294285 ACTGCAGTGCAGTCTGAGGAAGG + Intronic
916347032 1:163804690-163804712 ACAGAATTTCAGGCTGAGGAGGG - Intergenic
917982068 1:180275941-180275963 ACAGCAGTGCAGTCTGTCGCAGG - Exonic
918251022 1:182703414-182703436 ATAGAATTGGAGCTTGTGGAGGG + Intergenic
919169366 1:193934889-193934911 GCAGGAGCGCAGCCTGTGGCTGG - Intergenic
919199989 1:194343734-194343756 AGAGAAGTGCAGCCTGAATAAGG - Intergenic
919537759 1:198809705-198809727 AGTGAAGTGAAGCCAGTGGATGG - Intergenic
920788856 1:209069544-209069566 ATAGAAGTCCTGCCAGTGGAGGG - Intergenic
920945471 1:210524505-210524527 ACAGAAGGGGAGCCTGGGGCTGG + Intronic
922345947 1:224696477-224696499 TCAGCAGCGCAGCCTGTGCAGGG + Intronic
924439949 1:244077766-244077788 ACAGCAAAGCAGCCTGTGGGTGG - Intergenic
924526577 1:244857090-244857112 ACAGAAGCCTAGCCAGTGGAAGG + Intronic
1062834040 10:624406-624428 ACACAAGCACAGCCTGAGGAAGG + Intronic
1062895507 10:1100328-1100350 GAGGCAGTGCAGCCTGTGGACGG + Intronic
1063268090 10:4476047-4476069 ACAGATGTGCTGCCTGAGAAGGG - Intergenic
1063450547 10:6147409-6147431 GCAGAAGCACAGCCTGGGGAGGG - Intronic
1064128930 10:12690387-12690409 ACAGAAGCACAGCCTGTAGAAGG + Intronic
1064266149 10:13827139-13827161 ACAGAATTGGACTCTGTGGAGGG + Intronic
1065962327 10:30743794-30743816 ACACAAGTGATGCCTGTGGCTGG + Intergenic
1067039414 10:42941042-42941064 GAAGAAGAGCAGCCTGTCGAAGG + Intergenic
1068950560 10:62772707-62772729 AGAGCAGTGCAGGCTTTGGATGG + Intergenic
1073118893 10:101109101-101109123 ACTGCACTCCAGCCTGTGGATGG + Intronic
1074382501 10:112992144-112992166 AGAGCAGTGAAGCCTGAGGAGGG + Intronic
1076783728 10:132738828-132738850 GCAGAAATGCAGCCAGTGAAAGG - Intronic
1076808371 10:132871629-132871651 TCAGAAGTGGAGCCTGAAGATGG + Intronic
1077793018 11:5461635-5461657 ACAGAACTCCAGTCTGTGCAAGG - Intronic
1078534620 11:12163074-12163096 AGAGAAATGCATCCTGAGGAAGG - Intronic
1079125189 11:17714018-17714040 ACAGGAGTCCACACTGTGGAGGG - Intergenic
1080413455 11:32048070-32048092 ATATAAGAGCTGCCTGTGGATGG + Intronic
1083956801 11:65988339-65988361 TAAGAACTGCAGCCTCTGGAAGG - Intergenic
1084631258 11:70352702-70352724 ACAGCACTACAGCGTGTGGAGGG + Intronic
1087287223 11:96278014-96278036 ACAGAATTGGAGACTGGGGATGG - Intronic
1087290693 11:96317118-96317140 ACTGAAATGGTGCCTGTGGAAGG + Intronic
1088713311 11:112527367-112527389 AGAGAAATCCAGCCTGAGGAAGG + Intergenic
1088761238 11:112930773-112930795 GGAGAAATGCAGCCTCTGGAGGG - Intergenic
1089281211 11:117375873-117375895 ACAGAAATGCACCCTGTGATGGG - Intronic
1090164920 11:124536574-124536596 ACAGTAGTGCAGAGTGTGGCAGG - Intergenic
1091105975 11:132920356-132920378 ACAGATGAGGAGCCTGAGGAAGG - Intronic
1092039198 12:5368625-5368647 TCTGCAGTGCAGGCTGTGGAGGG - Intergenic
1093976486 12:25427522-25427544 ATAGAAGGGCAGCATGAGGAAGG - Intronic
1097808314 12:63989727-63989749 ACAGGCTTCCAGCCTGTGGATGG - Intronic
1098571232 12:71989580-71989602 ACAGATGTGCAGATTTTGGATGG + Intronic
1100480466 12:94973007-94973029 ACAGAACTGCAGCCCGGGGGTGG + Intronic
1103621520 12:122190004-122190026 ACAGGGGTGCAGGCCGTGGATGG + Intronic
1103623012 12:122200356-122200378 ACAGAAGTGCAGCCTGTGGATGG - Intronic
1104091904 12:125524731-125524753 ACAGAAGTTCAACCTCAGGATGG + Intronic
1104352356 12:128055875-128055897 ACAGAGGTGAAGGCTGTGGCCGG + Intergenic
1105288476 13:19028838-19028860 AAAGAAGTGGAGCCTGCAGATGG - Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105848951 13:24317828-24317850 ACAGGGGAGCAGCCAGTGGAGGG + Intronic
1106287473 13:28330030-28330052 ACAGAAGGGAAGCCTTTGGAAGG - Intronic
1108268986 13:48739990-48740012 GCATATGTGCAGTCTGTGGAAGG + Intergenic
1110227119 13:73131399-73131421 TCAGAAGTGGAGGCTGTGGTGGG - Intergenic
1110485556 13:76037625-76037647 CCAGAGGTGAAGCCTGTGGTAGG + Intergenic
1110697098 13:78503984-78504006 TCAGAAGTCCAGACTGTCGATGG - Intergenic
1112550724 13:100418083-100418105 ACAGGAGTGGTGTCTGTGGATGG - Intronic
1113514772 13:110885709-110885731 GCAGGATTGCAGCCTGTGGGAGG - Intronic
1117008634 14:51447715-51447737 ACAGGACTGCAGCCAGTGGTAGG - Intergenic
1118977790 14:70692448-70692470 TCAGAAGTGAGGCCTGTTGACGG + Intergenic
1121326706 14:93024342-93024364 CCAGCTGTGCAGCCTGGGGAAGG + Intronic
1121490603 14:94356423-94356445 ACAGCAGTGCCTGCTGTGGACGG - Intergenic
1122323086 14:100867122-100867144 GCAGAAGTGCTGCCTCCGGAGGG + Intergenic
1122651247 14:103228354-103228376 CCTGAAGTGCAGCCTTTGCAGGG + Intergenic
1123007838 14:105332972-105332994 ACAGGAGCGGAGCCTGGGGAGGG - Intronic
1125471258 15:40006201-40006223 ACAGAAGTGAGGAATGTGGAAGG - Intronic
1125481812 15:40086207-40086229 ACAGAAGACCATGCTGTGGAAGG + Intergenic
1125888871 15:43250945-43250967 AGAGAAGTGGAGCCAGTGAATGG - Intronic
1126066342 15:44828920-44828942 ATGAAAGTGCTGCCTGTGGAGGG - Intergenic
1126093540 15:45071946-45071968 ATGAAAGTGCTGCCTGTGGAGGG + Intronic
1126722861 15:51600495-51600517 ACGCAAGTGCAACCAGTGGATGG - Intronic
1127624455 15:60766655-60766677 AAAAAAGTGCAGTCTGTGAAGGG - Intronic
1128104032 15:65029662-65029684 ACAAGGGTGCAGCCTGGGGAGGG + Intergenic
1129425110 15:75456905-75456927 GCAGAAGTGCCTCTTGTGGAAGG + Intergenic
1130078746 15:80712480-80712502 ACAGAAGTCCAGGCAGTTGAAGG - Intronic
1130913767 15:88289254-88289276 ACGGAAGAGCATCCTGGGGAAGG + Intergenic
1132096269 15:98987454-98987476 ACAGAAGTAAAGCCTGAGGTGGG + Intronic
1132142287 15:99405875-99405897 ACAGGAGTGCTGCATCTGGATGG + Intergenic
1132927128 16:2436675-2436697 ACAGAATTGCAGGCTTTAGAGGG - Intronic
1134828515 16:17304419-17304441 ACAGAAATGCTGTATGTGGATGG + Intronic
1138711528 16:58975953-58975975 ACATTAGTGCAGCGTGTTGATGG + Intergenic
1141393022 16:83680466-83680488 ACAGGATTCCAGCCTGGGGAGGG + Intronic
1142102399 16:88282245-88282267 ACAGGGGTGCACCTTGTGGATGG + Intergenic
1143500305 17:7335013-7335035 ACAACATTGCAGCCTGTTGAGGG + Intergenic
1144262149 17:13532238-13532260 ACACAAGTGCAGCCAGTGCTTGG - Intronic
1145388480 17:22435837-22435859 GCAGAAGTGCAGCCTGAGCACGG - Intergenic
1145716374 17:27027109-27027131 AAGGAAGTGGAGCCTGTGGATGG - Intergenic
1146061256 17:29608658-29608680 ACAGAAGAGCAACCTGAGGTCGG - Intronic
1147891402 17:43720031-43720053 ACCGAAGTGGTGGCTGTGGAGGG + Intergenic
1148497792 17:48064252-48064274 ACTGAAGTAAGGCCTGTGGAAGG + Intergenic
1151025577 17:70672393-70672415 ACAGAAGTGAAACCTGAGGCTGG - Intergenic
1151059746 17:71078350-71078372 ACAGAAGTAAAGCCTGAGGCTGG + Intergenic
1152786306 17:82249730-82249752 AGAAACGTGCAGCCTGTGGGGGG - Intronic
1153822050 18:8840436-8840458 ACAGTAGTGAAACCTGTTGATGG - Intergenic
1155266007 18:24094250-24094272 TCAGAAGTGGAGCCTGAAGATGG - Intronic
1155755413 18:29489051-29489073 ACAGAAATGAGGACTGTGGAAGG - Intergenic
1156624054 18:38887077-38887099 AAACAAGTGCAGCCTGTGTATGG + Intergenic
1157392169 18:47311967-47311989 ACACAGGTGCAGACTGTGAAAGG - Intergenic
1157950092 18:52026782-52026804 ATAGAAGTGCAGCAAATGGAGGG - Intergenic
1158523011 18:58187368-58187390 TAAGAAGGGCAGCCTTTGGAAGG + Intronic
1160890726 19:1377466-1377488 GCAGAAGCGCAGCCTTTGTATGG + Exonic
1160910993 19:1473749-1473771 ACAGAAGTGCAGGGTGGGAAGGG + Exonic
1161327236 19:3669780-3669802 ACCGGGGTGCAGCCTCTGGATGG - Intronic
1161500272 19:4610513-4610535 AAAGAAGTGGAGCCTGGGAAGGG + Intergenic
1162031467 19:7919209-7919231 ACAGGGGTGGAGCCTGGGGACGG + Intergenic
1163813343 19:19448244-19448266 ACAAAGGTGCCGCCTGTGAAGGG - Intronic
1164874154 19:31671414-31671436 GCAGAAGTGAAGCCTCAGGAGGG - Intergenic
1166234235 19:41444041-41444063 ACAGCTGTGCAGCCTGGGGCTGG + Exonic
1166321415 19:42021481-42021503 AGAGACGTGCAGCGTGTGGATGG + Intronic
1166389250 19:42399946-42399968 TCAGAAGTGCAGTCTGGGGCTGG - Intergenic
925524024 2:4779834-4779856 CCAGGACTGCAGCCTGTGCATGG - Intergenic
925580935 2:5409844-5409866 ACAGGAGTGCAAGCTTTGGAAGG - Intergenic
926131531 2:10305793-10305815 TTAGAAGTGCAGTCTATGGAAGG + Intronic
926206489 2:10837629-10837651 ACAGAATTGCAGCTTGTTCAGGG + Intronic
926235895 2:11043486-11043508 ACATGAGTGAAGCCTGTCGAAGG - Intergenic
927754497 2:25697918-25697940 ACAGAGATGCTGCCTGCGGAAGG + Intergenic
928009835 2:27596704-27596726 ACAGAAGTCCTGGCTCTGGAGGG - Intronic
928034568 2:27809838-27809860 GCAGAAGTGGAACCTGTGGTTGG - Intronic
928296811 2:30090835-30090857 ACTGATGTGCATCCTTTGGAAGG - Intergenic
933557714 2:83851253-83851275 GCACCAGTGCAGCCTGTGGCTGG + Intergenic
938374442 2:130796528-130796550 ACAGAGGAGAAGGCTGTGGAAGG - Intergenic
938387822 2:130880237-130880259 TCAGAAGTGGAGGCTGAGGAAGG + Intronic
940263965 2:151817088-151817110 ACATATGTGCAGCTTGTGTAGGG - Intronic
941687484 2:168461999-168462021 ACAAGAGGGCAGCCTGAGGATGG - Intronic
943139791 2:183967947-183967969 ATGGAAGTGCATCCTGTGCAGGG - Intergenic
943916633 2:193643752-193643774 ACAGCAGTTCAGCCTGAAGATGG + Intergenic
946158815 2:217823661-217823683 ACAGACGGGCAGGCTGTGGCTGG - Intronic
946440704 2:219692867-219692889 GGAGAAGTGCAGGTTGTGGAAGG + Intergenic
947670956 2:231935015-231935037 ACAGCAGTTCAGCCTGGGCAGGG + Intergenic
948721254 2:239901906-239901928 TCAGAAGTGGAGCCTGAAGATGG + Intronic
948765033 2:240215222-240215244 ACAGCTGTGCAGCAGGTGGAAGG + Intergenic
1168799858 20:637471-637493 AGAGAAGGGCAGCCTGGGGAGGG - Intergenic
1169207405 20:3748207-3748229 ACACTAGTCCAGCCTGGGGATGG - Exonic
1169239758 20:3966608-3966630 GCAGAAGAGCTCCCTGTGGAAGG - Intronic
1171752280 20:29062955-29062977 ATGGAAGGGCAGCGTGTGGAAGG - Intergenic
1172706600 20:36886799-36886821 CCAGAAGTGCAGCCTGGGACTGG - Intronic
1172996191 20:39072145-39072167 ACAGAGTTGGAGCCTATGGAGGG - Intergenic
1174087592 20:48020057-48020079 ACAGAGGGGCAGCCTGGCGAGGG + Intergenic
1174251591 20:49223913-49223935 ACTGCACTCCAGCCTGTGGATGG - Intronic
1175051650 20:56161102-56161124 ACAGGAGTGCAGCCTGTGTGAGG - Intergenic
1175446560 20:59024203-59024225 AAAGAAGTGCAGGCGGGGGAAGG - Exonic
1175730877 20:61353116-61353138 CCAGAAGCGAAGCCTGTGGCTGG - Intronic
1176029226 20:63003283-63003305 AGAGATGTGCAGGCTGTGGGAGG - Intergenic
1176290243 21:5040102-5040124 GCAGCAGTGCACCATGTGGAAGG + Intronic
1176803238 21:13454186-13454208 AAAGAAGTGGAGCCTGCAGATGG - Intergenic
1178356430 21:31913516-31913538 ACAGTAGGGCCACCTGTGGATGG + Intronic
1179520662 21:41942251-41942273 ACAGAGGGGCAGCATGAGGAGGG + Intronic
1179867012 21:44223539-44223561 GCAGCAGTGCACCATGTGGAAGG - Intronic
1180184254 21:46131654-46131676 CCAGGAGGGCAGCCTGTGCAGGG + Intronic
1180232873 21:46437808-46437830 AAGGACGTTCAGCCTGTGGAGGG - Intronic
1180625243 22:17189903-17189925 ACAGAAGGGCTGCCTGTTAAGGG - Intronic
1181454994 22:23054119-23054141 ACAGGAGGGAAGCCTGTGTAGGG - Intergenic
1181712177 22:24697540-24697562 AGAGAGGTGCAGCCTTTGCAGGG + Intergenic
1182148139 22:28010090-28010112 ATAGGACTGCAGCCTGTGGGCGG + Intronic
1182829008 22:33289817-33289839 ACAGAAGAGGAGGCTGTGGGGGG - Intronic
1182952583 22:34391123-34391145 ACAGGGGTGCAGCCCATGGAGGG - Intergenic
1183100092 22:35578599-35578621 ACAGAAGACCAGGATGTGGATGG + Intergenic
1183676269 22:39300501-39300523 ACAGAAGTGCATCCTGCTGCCGG + Intergenic
1184107575 22:42377058-42377080 TAAGAAGTGCAGGCTCTGGAAGG - Intergenic
1184244363 22:43228465-43228487 TCAGATGAGAAGCCTGTGGAGGG - Intronic
1184368702 22:44068977-44068999 ACAGAGGGTCAGGCTGTGGAAGG - Intronic
1185268475 22:49917746-49917768 AGAGAACTCCTGCCTGTGGAAGG - Intronic
950542166 3:13619125-13619147 ACAGAAGCACACCCTTTGGAGGG - Intronic
950939634 3:16880120-16880142 AAAGAAATGCAGACTTTGGAAGG + Intronic
951280897 3:20748137-20748159 ACTGATGTGGAGACTGTGGAAGG + Intergenic
952194962 3:31065675-31065697 ACTGAGGTGCAGCCTGGGCATGG + Intergenic
958050324 3:88335975-88335997 ACAGCAGGGCAGCCGGTGGGGGG + Intergenic
958135196 3:89479527-89479549 ACGGAAGTGGTGGCTGTGGAAGG + Exonic
958622298 3:96576581-96576603 ACAGGGGTGCAGCCCATGGAAGG - Intergenic
960986404 3:123284096-123284118 ACAGGAGTGCTGGCTTTGGAGGG - Exonic
961075708 3:123979938-123979960 GCAGCAGTGCAGCCGGGGGAGGG - Intronic
961307977 3:125972576-125972598 GCAGCAGTGCAGCCGGGGGAGGG + Intronic
961677337 3:128575834-128575856 CCAGATGTGCTTCCTGTGGAAGG - Exonic
962483141 3:135815299-135815321 ACAGAAGTGAAGTCTGTGTCAGG - Intergenic
964495163 3:157280998-157281020 ACAGAAGTGTAGGCAGAGGATGG + Intronic
965198037 3:165624407-165624429 AGAGAAGTACAACCTGGGGATGG + Intergenic
965971242 3:174558896-174558918 ACAGAACTGCAGCAAGTGGAGGG - Intronic
969399058 4:6941619-6941641 ACAGATGTGCAAGCTGAGGAAGG - Intronic
970404065 4:15745678-15745700 AAAGAAGTACAGCCCATGGAAGG - Intergenic
970661242 4:18288091-18288113 ACTGGGGAGCAGCCTGTGGATGG + Intergenic
970691289 4:18623976-18623998 ACAAAATGGCAGCCTGGGGAAGG - Intergenic
972796689 4:42428348-42428370 AAGGAAGAGCAGCCTTTGGAGGG - Intronic
974004769 4:56544894-56544916 ACAGAAGCGCAGCCTGCGATGGG - Intronic
974061231 4:57037943-57037965 GCAGAAATGCAGTCCGTGGATGG - Intronic
974446584 4:61992210-61992232 ACTGAAGTCCAGCTTGTGAATGG - Intronic
976668772 4:87628685-87628707 TAAGAGGTGGAGCCTGTGGAAGG + Intergenic
977418332 4:96764034-96764056 ACACAGGTGCAGGCTGTGGTGGG + Intergenic
978263310 4:106790210-106790232 ACAGCAGTGCAACCTTTGGTTGG + Intergenic
980991315 4:139740895-139740917 CCAGAAAGGCAGCTTGTGGAAGG - Intronic
985347371 4:189020237-189020259 ACAGAACTGCAGCCTCAGGGTGG + Intergenic
985400083 4:189585657-189585679 ACAGCAGGGCAGCCTGGCGATGG + Intergenic
985571424 5:647582-647604 ACACAGCTGCAGCCTGGGGAGGG + Intronic
986485742 5:8234844-8234866 TCAGAAGTGGAGCCTGAAGATGG - Intergenic
986801301 5:11262843-11262865 TCAGAAGTTCAGCCTGTGAATGG - Intronic
987546111 5:19312131-19312153 ATAGAAGTGAAGACTGTGGAAGG - Intergenic
988408092 5:30850171-30850193 ACAGAAGACCATGCTGTGGAGGG + Intergenic
988718550 5:33853028-33853050 ACAGCAGTGCACCCTGGGGACGG - Intronic
989768052 5:45109635-45109657 ACAGAAGTGCTGAGAGTGGAGGG - Intergenic
990203656 5:53406023-53406045 ATAGATGTGGAGCCTTTGGAGGG + Intergenic
990243462 5:53838588-53838610 TCCGAAGTGCAGACTTTGGAAGG + Intergenic
990809049 5:59701651-59701673 ATAGAAGTGCTGGTTGTGGAAGG + Intronic
992317154 5:75567812-75567834 ACAGAGGAACAGCCTGAGGAAGG + Intronic
996366607 5:122708047-122708069 ACAGATGTGGAGCCTTTGTATGG + Intergenic
997004926 5:129805433-129805455 ACAGTGGTGCAGCCCATGGAGGG - Intergenic
1001860246 5:175047942-175047964 ACAGAAGGGCAGCATGGAGAGGG + Intergenic
1002307711 5:178293595-178293617 ACTGGAGTGGAGCATGTGGAGGG + Intronic
1004879210 6:19989489-19989511 AAAGCAATGCAGCCTGTGGCAGG - Intergenic
1006603699 6:35242196-35242218 ACAGCACTGCAGCCTCTAGAGGG - Exonic
1007728138 6:43929222-43929244 ACAGAAGAGCTGCCTGGAGAAGG - Intergenic
1007770189 6:44185985-44186007 CCAGAAGGGGAGGCTGTGGAGGG - Intergenic
1009945451 6:70336941-70336963 ACAGTGGTGCAGCCCATGGAGGG - Intergenic
1010278851 6:74000903-74000925 ACACAAGTGCATCCAGGGGAGGG - Intergenic
1013434540 6:110089113-110089135 ATTGAATTGCAGCCTTTGGAAGG - Intergenic
1015715207 6:136185254-136185276 ACAGAACTGCAGCCTCTGTAGGG + Intronic
1016490945 6:144601499-144601521 TTAGAAGTGGAGCCTGAGGATGG + Intronic
1017647630 6:156553643-156553665 ACACATGTGGTGCCTGTGGAGGG - Intergenic
1017650684 6:156578752-156578774 ATAGAAGAGAAGACTGTGGATGG - Intergenic
1018150387 6:160931656-160931678 AAACAAGGTCAGCCTGTGGAAGG - Intergenic
1018504158 6:164445797-164445819 ACAGGAATGCAGTCTCTGGATGG + Intergenic
1019593880 7:1849559-1849581 CCAGCAGTGCAGGCTGAGGAGGG - Exonic
1020082872 7:5296125-5296147 CCGGGAGTGCAGCCTGGGGACGG - Intronic
1020373824 7:7462566-7462588 ACAGAAATGCAGGCTGAGCACGG + Intronic
1022798389 7:33751515-33751537 ACAGAACTGCAGCCAGGGAAGGG + Intergenic
1023115355 7:36856647-36856669 ACAGAACTCCAGCCTCTGGGAGG - Intronic
1024562160 7:50653725-50653747 ACAGTGGTGAAGCGTGTGGAAGG - Intronic
1025078325 7:55962559-55962581 ACAGAGGTGGACCCTGTGGATGG - Intronic
1025211396 7:57021063-57021085 CCGGGAGTGCAGCCTGGGGACGG + Intergenic
1025660557 7:63555784-63555806 CCGGGAGTGCAGCCTGGGGACGG - Intergenic
1028376290 7:90148856-90148878 ACAGAAGTTCAGCATTTGGGGGG + Intergenic
1030197974 7:106871233-106871255 ACAGAAGTGAAACCTGAAGAAGG + Intronic
1032395803 7:131588740-131588762 ACAGAAGTGAAGCAGGTGCAGGG - Intergenic
1032584657 7:133135059-133135081 TAGGAAGTGCAGCCTATGGAAGG - Intergenic
1034450112 7:151132710-151132732 ACAGAAGTGCAGGCGGAGGCTGG + Intronic
1035397392 7:158544090-158544112 TCAGGAGTGCACCCGGTGGAGGG + Intronic
1037346262 8:17904610-17904632 ACATAATTCCAGCCTGTGCAGGG + Intronic
1038972699 8:32654676-32654698 ACAGATGTCCAGCCTCCGGAGGG - Intronic
1039532159 8:38272474-38272496 TCAGAAGAGCTGCCTGTGGCTGG - Exonic
1040526151 8:48226829-48226851 AGAGGAGTGCAGACTGAGGATGG - Intergenic
1040728956 8:50419341-50419363 ACATCAGTGCAGCCTGGTGAGGG - Intronic
1041124285 8:54619536-54619558 ACAAATGAGCAGCATGTGGAAGG - Intronic
1041691645 8:60693461-60693483 ACAGAGGTCTTGCCTGTGGAAGG - Intronic
1042952304 8:74213755-74213777 AAAGAAGTGCAGCCTTTAGGAGG - Intergenic
1043815357 8:84794361-84794383 TCAAGAGTGCAGCCTGGGGAAGG - Intronic
1044016527 8:87053417-87053439 AGAGGAGTGCAGGCTGAGGATGG + Intronic
1045256953 8:100533920-100533942 AGAGAAGTGCAGCCTGGGTGGGG - Intronic
1046575207 8:116019579-116019601 ACAAAAGTGTAGCCTGAGGATGG + Intergenic
1046816522 8:118590291-118590313 ACCTAAGTGCAGCCTGGTGAGGG - Intronic
1047333910 8:123918570-123918592 AGAGAAGTGTAGGCTGTGGGAGG + Intronic
1047895621 8:129363328-129363350 ATAGAAATGCAGCCTTTAGAGGG - Intergenic
1048452323 8:134544212-134544234 AAGGATTTGCAGCCTGTGGAGGG - Intronic
1049329492 8:142042740-142042762 ACAGGAGTGCACCTTCTGGAAGG + Intergenic
1049388245 8:142354986-142355008 ACAGAAACACAGCCTGAGGAAGG + Intronic
1050162928 9:2736578-2736600 ACAGAAGAGCACACTGTGGATGG - Intronic
1057139990 9:92720584-92720606 ACAGAAGAACAGCCTGCGCAAGG - Exonic
1057197936 9:93125400-93125422 ATAGAACTGCAGCTTGTGGCAGG - Intronic
1058704933 9:107630249-107630271 ACAGAACCTCTGCCTGTGGAGGG + Intergenic
1059730721 9:117054349-117054371 ACAGAAGTCCAGCCAGGGGAAGG - Intronic
1060658572 9:125389255-125389277 ACAGAGGGGCAGCACGTGGAAGG - Intergenic
1060792908 9:126497906-126497928 ACTGAAGTACTGCCTGGGGAGGG + Intronic
1061485906 9:130920373-130920395 ACAGATGAGCAGCCTGTGAAGGG + Intronic
1061506863 9:131036484-131036506 GCAGAAGGGGAGCCTGGGGAGGG + Intronic
1061679363 9:132235443-132235465 ACACTATTTCAGCCTGTGGAGGG - Intronic
1061810671 9:133161222-133161244 ACAGCTGTGCAACATGTGGACGG + Intronic
1062102968 9:134738013-134738035 ACAGAAGTTCAGCCTGGAGCTGG + Intronic
1062425511 9:136504409-136504431 ACAGGAGTGCCGCCTGTCCAGGG + Intronic
1187451303 X:19399058-19399080 ACAGAAGTGCAGCTTATACACGG + Intronic
1188355705 X:29188152-29188174 ACAGAGGAGTAGTCTGTGGAAGG - Intronic
1189173505 X:38931955-38931977 ACAGAAGTGGGGCCTCAGGATGG - Intergenic
1190059409 X:47201266-47201288 ACAGAAGAGCTGCCTGTAGAGGG - Exonic
1192198996 X:69052077-69052099 ACAAAATTTCAGCCTTTGGAGGG - Intergenic
1192430176 X:71106497-71106519 ACAGAACTAGAGTCTGTGGATGG - Intronic
1193588012 X:83351276-83351298 ACATAACTGCAGCCTGAGGAAGG - Intergenic
1196316165 X:114226811-114226833 ACAGCAGTGCAGGCTGTGAAAGG - Intergenic
1198450835 X:136766173-136766195 ACAGAATTCCAGACTGTGGCTGG + Intronic
1198562205 X:137863066-137863088 AGAGAAGTCCAGCCAGAGGAGGG + Intergenic
1198759579 X:140017542-140017564 ATAGGAGTGCAGGCTGAGGAAGG - Intergenic
1198779209 X:140216508-140216530 ATAGGAGTGCAGGCTGAGGAAGG + Intergenic
1198811890 X:140544227-140544249 ACACATGTGCAGCCTGAGCAGGG + Intergenic
1199641820 X:149869329-149869351 ACAGGAGTGCAGCCTCTGGAGGG - Intergenic
1199700512 X:150372087-150372109 AAAGAAATGCAGCCAATGGAGGG + Intronic