ID: 1103623694

View in Genome Browser
Species Human (GRCh38)
Location 12:122203877-122203899
Sequence GGCCGCGGGGTGCAAAGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 137}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103623694_1103623707 8 Left 1103623694 12:122203877-122203899 CCGTGCCTTTGCACCCCGCGGCC 0: 1
1: 0
2: 3
3: 11
4: 137
Right 1103623707 12:122203908-122203930 GGTCCCCCAGGGTCCCCGCGAGG 0: 1
1: 0
2: 1
3: 14
4: 174
1103623694_1103623716 25 Left 1103623694 12:122203877-122203899 CCGTGCCTTTGCACCCCGCGGCC 0: 1
1: 0
2: 3
3: 11
4: 137
Right 1103623716 12:122203925-122203947 GCGAGGACGCCGGCCCCGCCCGG 0: 1
1: 0
2: 5
3: 25
4: 199
1103623694_1103623701 -3 Left 1103623694 12:122203877-122203899 CCGTGCCTTTGCACCCCGCGGCC 0: 1
1: 0
2: 3
3: 11
4: 137
Right 1103623701 12:122203897-122203919 GCCCGCTCCCCGGTCCCCCAGGG 0: 1
1: 0
2: 2
3: 18
4: 199
1103623694_1103623700 -4 Left 1103623694 12:122203877-122203899 CCGTGCCTTTGCACCCCGCGGCC 0: 1
1: 0
2: 3
3: 11
4: 137
Right 1103623700 12:122203896-122203918 GGCCCGCTCCCCGGTCCCCCAGG 0: 1
1: 0
2: 2
3: 32
4: 299
1103623694_1103623717 26 Left 1103623694 12:122203877-122203899 CCGTGCCTTTGCACCCCGCGGCC 0: 1
1: 0
2: 3
3: 11
4: 137
Right 1103623717 12:122203926-122203948 CGAGGACGCCGGCCCCGCCCGGG 0: 1
1: 0
2: 3
3: 22
4: 229
1103623694_1103623712 15 Left 1103623694 12:122203877-122203899 CCGTGCCTTTGCACCCCGCGGCC 0: 1
1: 0
2: 3
3: 11
4: 137
Right 1103623712 12:122203915-122203937 CAGGGTCCCCGCGAGGACGCCGG 0: 1
1: 0
2: 1
3: 6
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103623694 Original CRISPR GGCCGCGGGGTGCAAAGGCA CGG (reversed) Intronic
901063667 1:6485209-6485231 GGCCGCGGGGCCCATAGTCACGG + Intronic
901285574 1:8075959-8075981 GGCCGCCAGGAGGAAAGGCATGG + Intergenic
901519291 1:9770510-9770532 GGTCGGGGGGTGCAGAGGCAGGG - Intronic
901757793 1:11451886-11451908 GGCCGAAGGGTGAACAGGCACGG - Intergenic
904282102 1:29427764-29427786 GGCTGCAGGGTGCAGAGGGAGGG - Intergenic
905275281 1:36813699-36813721 GGCAGAGGGGTGACAAGGCAGGG + Intronic
906240144 1:44237884-44237906 GGCCGCCGGGAGCCAAGGCCAGG - Intronic
915914981 1:159935462-159935484 GGGTGCAGGGAGCAAAGGCATGG - Intronic
916194371 1:162209768-162209790 GGGGGCGGGGGGCAAGGGCAGGG + Intronic
918327068 1:183419924-183419946 GGCTGCTGGGTGGAAAGGGAGGG + Intergenic
921944949 1:220879949-220879971 GGCGGCGGGGTCCAAGGGGAAGG - Exonic
922503340 1:226112124-226112146 GGCTGCAGTGTGCAAAGGCCTGG + Intergenic
1062970978 10:1649088-1649110 GTACCCGGGGTGCACAGGCACGG + Intronic
1065022121 10:21509640-21509662 GGGCGCGGGGGGCGCAGGCAGGG - Intergenic
1068040406 10:51817156-51817178 GGCAGCGGGGCCCAAAGGAATGG + Intronic
1069024236 10:63522049-63522071 AGCCGCGGGATACAAAGGCTCGG - Intronic
1070370921 10:75781015-75781037 GGATGCCAGGTGCAAAGGCATGG - Intronic
1074386505 10:113020577-113020599 GGCAGCTGGGTGCAGAGGCGGGG + Intronic
1075921789 10:126219367-126219389 GCCCACGGGGAGAAAAGGCATGG - Intronic
1076845909 10:133069484-133069506 GGCCCTGGGGTGCAGAGTCAAGG + Intergenic
1076845917 10:133069507-133069529 GGCCGTAGGGTGCAGAGTCAGGG + Intergenic
1076845963 10:133069662-133069684 GGGCGCAGGGTGCAGAGTCAGGG + Intergenic
1076845984 10:133069728-133069750 GGGCGCAGGGTGCAGAGTCAGGG + Intergenic
1076846009 10:133069817-133069839 GGCCCGGGGGTGCAGAGTCAGGG + Intergenic
1076846038 10:133069905-133069927 GGCCACAGGGTGCAGAGTCAGGG + Intergenic
1076846046 10:133069928-133069950 GGCCCTGGGGTGCAGAGTCAGGG + Intergenic
1077155887 11:1090638-1090660 GGCCGGGGATTGGAAAGGCAGGG - Intergenic
1077227574 11:1445108-1445130 GGCCACGGAGGGCCAAGGCAGGG - Intronic
1081258946 11:40934355-40934377 GCCTTCGGAGTGCAAAGGCAGGG - Intronic
1083596185 11:63919190-63919212 GGCCACGGGGTCCAGAGGGAAGG + Intergenic
1083659839 11:64246881-64246903 GGCCGCGGGGGACAAAGGGCGGG - Exonic
1083973778 11:66100421-66100443 GGACGCAGGGTGCTGAGGCAGGG - Intronic
1084030062 11:66475993-66476015 GGCCGCAAGGTGCAAAGGCATGG - Exonic
1084970055 11:72766527-72766549 GGACGAGTGGTGCAAAGGCCTGG + Intronic
1091221977 11:133935174-133935196 AGACGCGGTGTGGAAAGGCAGGG + Intronic
1101730824 12:107425735-107425757 GGCCGCTGGGTTCACAGGCATGG - Intronic
1103623694 12:122203877-122203899 GGCCGCGGGGTGCAAAGGCACGG - Intronic
1105411856 13:20177513-20177535 GGCCGCGGGGCGAAAAGAAACGG - Intergenic
1105913870 13:24894780-24894802 GCCCTCGGGGTGCAAAGGGAGGG + Intronic
1106226345 13:27789843-27789865 GGCCGCGGGGTGGGGAGGCCGGG + Intergenic
1109286839 13:60419632-60419654 GGGGGCGGGGGGCAAAGGGAGGG + Intronic
1113565078 13:111314896-111314918 GGCCTCGGCTTGCAAAAGCAGGG + Intergenic
1117197674 14:53356518-53356540 TGCCGAGGGGGGCAAAGGGAAGG + Intergenic
1119744006 14:77031666-77031688 GGCCCCTGAGTGCAAAGGAAAGG + Intergenic
1121629012 14:95409096-95409118 GCCCGCGGCCTGCAAAGGAAAGG + Intronic
1122783953 14:104155436-104155458 GGCCGAGGGGCGCAGAGCCAAGG - Intronic
1128210684 15:65899339-65899361 GGCCAAGGAGTCCAAAGGCATGG - Intronic
1130521207 15:84661908-84661930 GGCCGCGGGTTGGACAGGCTTGG + Intergenic
1133732638 16:8589974-8589996 GGGCCCGGGGTCCAAAGGAAAGG - Intergenic
1136136238 16:28258527-28258549 GGCCTCGGGGAGCAGAGGGAAGG - Intergenic
1139082572 16:63541099-63541121 GGCCTCGGGTTGGAAAGGCTTGG - Intergenic
1141657611 16:85424419-85424441 GGCCACAGGATGCAATGGCAGGG + Intergenic
1141667289 16:85472397-85472419 GGCCGCGGGAGGAGAAGGCAGGG - Intergenic
1142186966 16:88699221-88699243 GGCCATGGCGTGCAGAGGCACGG - Intronic
1142196997 16:88743549-88743571 GGCCTCGGGGCGCAAACTCAGGG + Intronic
1143098275 17:4490170-4490192 GGCTGCGAGGTCCAAGGGCAGGG - Intergenic
1143296050 17:5872991-5873013 GGCCGCGGGATGCAAAGCCACGG - Intronic
1144193292 17:12866412-12866434 TGCTGTGGGGTGCAAAGGCAGGG - Intronic
1146398402 17:32486422-32486444 GGCCGCGCGCTGCCAGGGCAGGG + Intergenic
1147648657 17:42049643-42049665 GGCAGAGGGGTGCAAAAGCAAGG + Intronic
1147986133 17:44308684-44308706 GGGCACCGGGCGCAAAGGCAGGG + Exonic
1148094126 17:45040702-45040724 GGCAGCAGGGTGCAAAGAAAAGG + Intronic
1150840404 17:68601077-68601099 GGCCGCCGGCTGCAAAGCCCGGG + Exonic
1152467786 17:80475717-80475739 TGCTGCGGGGTGCAAGGGCGGGG + Exonic
1203192329 17_KI270729v1_random:200538-200560 GGCGGCGGGGGAAAAAGGCACGG - Intergenic
1156464427 18:37339851-37339873 GGGGGCAGGGGGCAAAGGCAAGG + Intronic
1158602131 18:58864134-58864156 GGGGGCGGGGGGCGAAGGCAGGG - Intronic
1160717075 19:581295-581317 GGCCTAGGGGACCAAAGGCAAGG - Exonic
1160983833 19:1828395-1828417 GGCCGCGGGGCGCCAGGGCGGGG + Exonic
1161586565 19:5108903-5108925 GGGCGTGGGGGGCAGAGGCACGG - Intronic
1163513137 19:17747895-17747917 GGCTGCGGAGGGCAAAGGCGCGG + Intronic
1165067803 19:33239250-33239272 GGCCGCTGGGAGCCACGGCAGGG - Intergenic
1165940770 19:39413700-39413722 GGCCGCGGGGTCCCAGGGGAGGG - Intronic
927651853 2:24918149-24918171 GGCACAGGGGTGAAAAGGCAGGG + Intronic
928394115 2:30931083-30931105 AGCAGTGGGGAGCAAAGGCAGGG - Intronic
932297960 2:70642468-70642490 GTCTGCTGGCTGCAAAGGCAGGG + Intronic
937882364 2:126878041-126878063 GTGCGCGGGGAGCACAGGCAGGG - Intergenic
938109680 2:128555480-128555502 GGCCACCTTGTGCAAAGGCATGG - Intergenic
941662452 2:168209140-168209162 GGCCTAGGGGTGCAAAGGAAAGG - Intronic
941978936 2:171434154-171434176 GGCCGCGGCAGGCAGAGGCAGGG + Intronic
945241523 2:207681360-207681382 GGCCGCGGGGGACAAAGGGCGGG + Intergenic
1171473316 20:25389841-25389863 GGCGGCGGGGTGCTAGGGGAAGG - Intronic
1172092942 20:32446541-32446563 GGCAGCGGGGTGTGAGGGCAAGG + Exonic
1174361537 20:50031926-50031948 TTCCTGGGGGTGCAAAGGCATGG + Intergenic
1175794676 20:61764267-61764289 GGCCCCGGGGTTCACGGGCAAGG - Intronic
1175837222 20:62003962-62003984 GGGCGTGGGGTGCAAAGGAAGGG - Intronic
1177807686 21:25890154-25890176 GGCAGCAGGGTGGAAAGGAACGG - Intronic
1180613319 22:17111378-17111400 AGCCCCAGGGTGCAAGGGCAAGG + Exonic
1184684463 22:46089914-46089936 GGGTGGGGGGCGCAAAGGCAGGG - Intronic
1184688887 22:46108594-46108616 GCGCACGGGGTGCAAAGGCCAGG - Intronic
1184847914 22:47100384-47100406 GGCTGTGGGGTGCAGGGGCAAGG + Intronic
949135114 3:555034-555056 GGCCACTGGGTGAAAAGGTAAGG - Intergenic
949918645 3:8984695-8984717 GGCCTCCGGGTGGAAGGGCAGGG + Exonic
952178687 3:30894808-30894830 AGCCGCGGGCTGCAAAAGCCTGG - Intergenic
952723739 3:36560352-36560374 GGTCGAGGGGTGCTGAGGCAGGG + Intergenic
954887760 3:53891646-53891668 GGCCGCGGGGCGCTAAGCCCGGG + Intronic
956510245 3:69985473-69985495 GGAGGCGGGGAGCCAAGGCAAGG + Intergenic
962386547 3:134936928-134936950 GACCGTGGGATGCAAATGCAGGG + Intronic
963061661 3:141231573-141231595 GCCCTCGGCGTGCAAAGCCACGG - Intronic
965530374 3:169764965-169764987 GCGCGCGGGGAGCAAAAGCACGG + Intergenic
968876476 4:3270360-3270382 GGCCTCGGGGTCCAAAGTCCAGG - Intronic
968969903 4:3788339-3788361 GGCCCCAGGGGGCACAGGCAGGG + Intergenic
969244715 4:5924898-5924920 GGCCGCCAGGTGCCAGGGCAAGG + Intronic
969468309 4:7370798-7370820 GGCCCCTGTGTGCAAAGGCAGGG - Intronic
969713465 4:8857586-8857608 GGCTGCGGGTTCCACAGGCAGGG - Intronic
979985533 4:127309472-127309494 AGCCACGAGGTGCAAAGGAATGG - Intergenic
981885566 4:149668509-149668531 GGCAGCGGGGGGCAAGGGGAGGG + Intergenic
985553751 5:546183-546205 GGCTGCAGGGAGCACAGGCAGGG + Intergenic
986708542 5:10470984-10471006 GTCCCCCGGGTGGAAAGGCAGGG + Intronic
993519541 5:88883646-88883668 GGCAGCGCGAAGCAAAGGCAAGG - Intronic
994303717 5:98178029-98178051 GGGCAAGGGGTGGAAAGGCATGG - Intergenic
996252085 5:121348016-121348038 GGCCGTGGGGGGCAAGGGGAGGG - Intergenic
1001575019 5:172757706-172757728 GGACGCTGGGTGCACAGGGATGG - Intergenic
1002089320 5:176795095-176795117 GGCCTCGGTGGGCAAAGGGAGGG + Intergenic
1002512687 5:179733089-179733111 GGCCGCGGGCTGCACGGGCCGGG - Exonic
1002712091 5:181201503-181201525 GGCTGAGGGGGGCAAAGTCAGGG + Intronic
1005912529 6:30323612-30323634 GGCTGCTGGGTTCGAAGGCATGG - Intergenic
1008461502 6:51779282-51779304 GGCAGAGGGGGGCAGAGGCAAGG - Intronic
1009454615 6:63841750-63841772 GGTGGCGGGGGGCAAAGGGAGGG - Intronic
1019446341 7:1073653-1073675 GGCGGCGGGGTGCGGAGTCAGGG - Intronic
1019662528 7:2232725-2232747 GGGCGCGGGGTCCTGAGGCACGG + Intronic
1019791100 7:3014423-3014445 GACCCTGCGGTGCAAAGGCAGGG + Intronic
1020211840 7:6163691-6163713 GGCCCTGGGGTGCAGAGGCCCGG - Exonic
1021234046 7:18120607-18120629 GGCAGCGGGGAGAAAAGACAGGG + Intronic
1021402015 7:20220110-20220132 GGCCGTGGGGTGCAGAGTCCAGG + Intergenic
1024555627 7:50600869-50600891 GGCTGTGGGGTGGAAGGGCAGGG - Intronic
1026987691 7:74565045-74565067 GGCCTCGGGTTGCAGAGGGATGG + Intronic
1027185612 7:75968940-75968962 GGAAGCGGGGTGCCAAGGGATGG - Intronic
1027579648 7:79977592-79977614 GGCCGAGGAGTGCAAGCGCATGG - Intergenic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1034644551 7:152633600-152633622 GACCGCGGTGTGGAGAGGCAGGG + Intergenic
1035105131 7:156435663-156435685 GGCCGCTGGGAGCAAAGGCGCGG - Intergenic
1035728841 8:1841029-1841051 GGCCGGTGGGTGGAAGGGCAAGG + Intronic
1035817910 8:2561358-2561380 GGTCGGGGGGTGCAGAGGCTCGG - Intergenic
1037882864 8:22581381-22581403 GGCCGAGCGGGGCAAAGCCAAGG + Exonic
1038659584 8:29485875-29485897 GGCCGCTGGCTGCTATGGCAAGG - Intergenic
1038670174 8:29576856-29576878 GGCCCAGGGGTACAAAGGCTAGG - Intergenic
1040573212 8:48627484-48627506 GGGCCTGGGGTGCACAGGCAGGG + Intergenic
1041874096 8:62667811-62667833 AGAGGTGGGGTGCAAAGGCAGGG - Intronic
1043372746 8:79612643-79612665 GGCCCCGGGGTGAAAAGGCAGGG + Intronic
1050439796 9:5650099-5650121 GGCCCCAGGGTACACAGGCATGG + Intronic
1052535165 9:29737261-29737283 GGGTGCGGGGGGCAAGGGCAGGG - Intergenic
1052659653 9:31411730-31411752 GGTGGTGGGGTGCAAAGGGAGGG + Intergenic
1056845919 9:90037987-90038009 AGCCCAGGGGTGCAAGGGCATGG + Intergenic
1057620335 9:96629039-96629061 GGCAGCGGGGGCCAAAGGCAGGG - Intergenic
1060106764 9:120877386-120877408 GGCCGCGGGCTCCAATGGCGAGG - Intronic
1060811607 9:126613865-126613887 GGCCGCGGGGTTCAAATGTCAGG + Intergenic
1060941570 9:127545780-127545802 GGCCTCGAGGTGTAAAGGAAAGG - Intronic
1061235104 9:129337525-129337547 GGCCGTGGGGATCAAAGACAGGG - Intergenic
1062689338 9:137833404-137833426 GGCCTCGGGCTGCACAGGCAGGG + Intronic
1190393291 X:49954242-49954264 GGCCGCGGGTTGCACAAGCTTGG - Intronic
1192149856 X:68705532-68705554 GTCCACGGTGTGCAAAGGCTAGG + Intronic