ID: 1103625063

View in Genome Browser
Species Human (GRCh38)
Location 12:122212429-122212451
Sequence TCTCACTTTTTGATGGTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103625063 Original CRISPR TCTCACTTTTTGATGGTAGT TGG Intronic
900712904 1:4125851-4125873 TCTCACTATTTGGTGGTGGTGGG - Intergenic
901442458 1:9286769-9286791 TTTCAGTTTCTGATGGTTGTGGG + Intergenic
904129811 1:28267294-28267316 ACTCCCTTTTTGAAGGTAGCTGG + Intronic
904825183 1:33269707-33269729 TCTCACTTTTTAATGTCTGTGGG + Intronic
908753589 1:67447402-67447424 TCTCACTTTCTGAGGGTACCAGG - Intergenic
909539750 1:76777907-76777929 AATAATTTTTTGATGGTAGTTGG - Intergenic
909938797 1:81586800-81586822 TCTCCCTCTTTGAAGGTGGTAGG - Intronic
916704924 1:167339410-167339432 TCTCTATTTTAGATGATAGTTGG + Intronic
919519222 1:198566544-198566566 GCCCACTTTTTAATGGTATTTGG + Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
923059133 1:230454325-230454347 TCTAACTTTATTATGGTAATGGG - Intergenic
1066175602 10:32901635-32901657 TCTCACTTTTTTTTTGTTGTAGG - Exonic
1066190796 10:33053959-33053981 TCTTGCCTTTTGATGGTGGTGGG - Intergenic
1066240849 10:33533431-33533453 TCCCACTTTGAGATGATAGTTGG - Intergenic
1068839100 10:61590290-61590312 TTTCACATTGTGATGGTGGTAGG + Intergenic
1068929245 10:62572287-62572309 TATCAATTTTTGGTGGTGGTGGG - Intronic
1071093026 10:81942364-81942386 CCTCAGTTTTTGATGTAAGTAGG + Intronic
1073857199 10:107691134-107691156 TCTCCCTTTTCAATGGTGGTAGG + Intergenic
1075097060 10:119479076-119479098 TTTCAGTTGTTGATGGGAGTTGG - Intergenic
1078667082 11:13334728-13334750 TCCCAGTTTTGGATGGTAGGTGG - Intronic
1079827848 11:25220783-25220805 TCTTCCTGTTTGATGGTATTTGG - Intergenic
1080799345 11:35595231-35595253 TCTCACTTTTTAAAGGTATGGGG - Intergenic
1081019258 11:37923246-37923268 TCCCACATTTTGGTAGTAGTGGG - Intergenic
1081921087 11:46777969-46777991 TCTCAAGATATGATGGTAGTTGG - Intronic
1088896740 11:114084187-114084209 TTTCATTTTTTGGTGGCAGTAGG + Intronic
1090141876 11:124274289-124274311 TCTCTCTTTTTGGTGGTGGGTGG + Intergenic
1093854928 12:24090292-24090314 TCTCACTTTGGAATGATAGTTGG + Intergenic
1100197088 12:92258922-92258944 ACTCACTTATTGATTCTAGTGGG + Intergenic
1102363476 12:112310427-112310449 TCTCTCTATATGATGGTAATTGG + Intronic
1102741560 12:115211823-115211845 GCCCACATTTTGATGGTAATGGG - Intergenic
1103625063 12:122212429-122212451 TCTCACTTTTTGATGGTAGTTGG + Intronic
1104613249 12:130247372-130247394 TCTCATTTTTATATCGTAGTAGG + Intergenic
1107334824 13:39343848-39343870 TCCCACCTTTTGAAGGTAGGTGG + Exonic
1110624835 13:77641795-77641817 TGTCACTTTTTGAAAGTAATAGG - Intronic
1111830255 13:93320213-93320235 TTTCACTTTTTAAAGGTATTAGG - Intronic
1112121302 13:96414954-96414976 TCTCATTTTTTGAAGGGAGGGGG - Intronic
1114488191 14:23077171-23077193 TCTGACTTTTGGAGGGTAGTGGG - Intronic
1117034325 14:51712077-51712099 TCTCCCTTTTTGATGGCTGCAGG - Intronic
1117780159 14:59223735-59223757 TTGCACTTTTTGATGGTAGGAGG + Intronic
1120119124 14:80656795-80656817 TCACAGTTTTTGCTGGTTGTGGG + Intronic
1120793851 14:88609787-88609809 TCTTACTTTTGGATGATAGAAGG - Exonic
1125746230 15:41999474-41999496 TCTCACTTATTCATAGCAGTGGG - Intronic
1125790985 15:42365534-42365556 TCTCACTTGCTGATGGTGGCTGG + Intronic
1130900443 15:88202985-88203007 TCCCACTTTTTGATGCTAGCTGG + Intronic
1131005697 15:88975955-88975977 GCCCACTTTTTGATGGGATTTGG + Intergenic
1136241723 16:28948743-28948765 TCTAACTTTATGATGGTAAGTGG + Intergenic
1136531532 16:30873062-30873084 ACTCACGTTTTGATGGAACTAGG + Intronic
1138887354 16:61095729-61095751 TCTAACTTTTTTATGGTTTTAGG - Intergenic
1141322171 16:83021478-83021500 GCTCAGTTTTTAATGGTAGGTGG + Intronic
1143746966 17:9002177-9002199 TTTCTCTTTTTTTTGGTAGTGGG - Intergenic
1144178157 17:12728430-12728452 TCTCACCTTTTCATGGGACTGGG + Intronic
1144614512 17:16757056-16757078 TCCCAGTTTTTGGTGGCAGTGGG + Intronic
1144898194 17:18558618-18558640 TCCCAGTTTTTGGTGGCAGTGGG - Intergenic
1146168995 17:30618164-30618186 TCTCAATTTCTGTTGGGAGTGGG + Intergenic
1146170567 17:30629285-30629307 TCTCAATTTCTGTTGGGAGTGGG - Intergenic
1146344020 17:32045306-32045328 TCTCAATTTCTGTTGGGAGTGGG - Intronic
1150781944 17:68130695-68130717 TCTCAATTTCTGTTGGCAGTGGG + Intergenic
1150966217 17:69972265-69972287 TCTCAGCTTTTGAGAGTAGTAGG + Intergenic
1153070569 18:1099555-1099577 TTTCTCTTTTTGAAAGTAGTGGG + Intergenic
1153606319 18:6836908-6836930 TATCACTTTTTGAAATTAGTAGG + Intronic
1154289190 18:13091433-13091455 TTTCACTTTTTCATGTTGGTTGG + Intronic
1156595972 18:38548180-38548202 TCTTTCTTTTTAATGGCAGTAGG - Intergenic
1156862449 18:41854004-41854026 TCTCACTTTTCCCTGGTAGATGG - Intergenic
1156908850 18:42386991-42387013 TTTCACTTTTAAATGGTAGAAGG + Intergenic
1157928541 18:51793103-51793125 TCTCACTTTTTGATGGTTTGGGG - Intergenic
1159072547 18:63641888-63641910 TCTCCCTTTTTGATGTTTGAAGG - Exonic
1159400634 18:67929062-67929084 TTTCACTTTTTGTTGGAAGATGG - Intergenic
1160482045 18:79250359-79250381 TTTCACTTTTTAATGGGATTTGG + Intronic
1165049842 19:33134500-33134522 TTTCAATTTTTAATGATAGTTGG + Intronic
1165282110 19:34806450-34806472 TTTCACTTTCTGATGGTGCTTGG - Intergenic
926088552 2:10035433-10035455 TCTTACTGTTTGATGGTGTTGGG - Intergenic
927746157 2:25623375-25623397 AGTAACTTTTTGATGGTACTGGG + Intronic
928025756 2:27737144-27737166 TCTCTCTCTTTGCTGGAAGTGGG + Intergenic
934030090 2:88036889-88036911 TGTCACTTTTTAAATGTAGTGGG - Intronic
935608411 2:104994769-104994791 TCCCACTTTTTGGTTGTAGATGG + Intergenic
936280444 2:111135595-111135617 TCTCCCTCTTTGATGCTAGATGG + Intronic
937769829 2:125707263-125707285 AATCCCTTTTTGATGGTAATAGG + Intergenic
939998017 2:148938488-148938510 TCTCTCTTTTTGGTGGGAGAAGG + Intronic
940693335 2:156947288-156947310 TCTCAATTTTGGAAGATAGTTGG - Intergenic
943073052 2:183164702-183164724 TATCTCTTTTTAATGGTAGGAGG + Intergenic
943377481 2:187097598-187097620 TTTTACTTTTTGGTTGTAGTGGG + Intergenic
945220558 2:207479183-207479205 TCTCCCTATTAGATGCTAGTAGG - Intergenic
945330316 2:208531614-208531636 GCTCACTTTGTGGTGTTAGTTGG - Intronic
947977577 2:234380324-234380346 TCTCAGATTTTGAGGCTAGTGGG - Intergenic
1171789303 20:29504711-29504733 ACTGACTTCTTGATGGTAGCTGG + Intergenic
1172661197 20:36570276-36570298 GCTCCCTTTTTGATGGAAGTGGG - Intergenic
1174624717 20:51904552-51904574 ACTCACTTTTTGATAGAAGCAGG + Intergenic
1174958232 20:55124831-55124853 TCTGACTTCTTGATGGTCTTGGG - Intergenic
1175456780 20:59121468-59121490 CCTCACTTCTTGATGGGGGTGGG - Intergenic
1176946778 21:14991603-14991625 TCTCCCTTTTTGTGGGTAATAGG - Intronic
1177401908 21:20615332-20615354 TCTCAATTGTTGATGGTATGTGG + Intergenic
1177523434 21:22261826-22261848 TCTCTATCTTTCATGGTAGTAGG - Intergenic
1179400919 21:41082449-41082471 TTTGACTTTTTTTTGGTAGTGGG + Intergenic
1181444685 22:22959961-22959983 TGTCACATTTTGCTGGCAGTGGG - Intergenic
951353205 3:21631414-21631436 TCTGAATTTATAATGGTAGTAGG - Intronic
951883043 3:27498167-27498189 ACTTACTGTTTGATGGTAGGGGG - Intergenic
954472709 3:50711988-50712010 TCTTACTTTTATAAGGTAGTTGG + Intronic
956079153 3:65539006-65539028 TGTGTCTGTTTGATGGTAGTTGG - Intronic
956079159 3:65539060-65539082 TGTGTCTGTTTGATGGTAGTTGG - Intronic
956079175 3:65539276-65539298 TGTTTCTGTTTGATGGTAGTTGG - Intronic
956079181 3:65539381-65539403 TGTGTCTTTTTGATGGTAGTTGG - Intronic
956807756 3:72833862-72833884 TCTCACTTGTGGTTGGTAGCAGG - Intronic
957883076 3:86247909-86247931 TCTCCCTTTTTTATGGGAGGTGG + Intergenic
958933718 3:100235155-100235177 TCACACTCTCTGATGGAAGTGGG + Intergenic
961377944 3:126479364-126479386 TCCCAAATTTTGATGGGAGTGGG + Intergenic
963047879 3:141116499-141116521 TCCCACTTCTTCATGGGAGTTGG + Intronic
963180739 3:142353119-142353141 TGTCACTTTATGCTGGTAGTTGG - Intronic
964129489 3:153270962-153270984 AGTCACTTTTTTATGGTAGATGG + Intergenic
968056088 3:195693028-195693050 TCTCTCTTTTTGTTGGCAGATGG + Intergenic
969519978 4:7671159-7671181 TCTTATTTTTTGATGGTTGTTGG - Intronic
972067950 4:34975086-34975108 TCTCACTTTTTCATGGCATTTGG + Intergenic
973073064 4:45889283-45889305 TGTCTTTTTTTGATGGTTGTTGG + Intergenic
974165798 4:58199962-58199984 TCTCATTTTTTGATCTTAATTGG + Intergenic
975834312 4:78405940-78405962 TCTCACTTTAAGAAGATAGTAGG + Intronic
978104061 4:104880323-104880345 ATTCACATTTTGATGGTATTTGG - Intergenic
978250289 4:106622647-106622669 ACTTTCCTTTTGATGGTAGTTGG - Intergenic
979200450 4:117971511-117971533 TCTCAATTTTTCATGGTCTTTGG + Intergenic
979429175 4:120606718-120606740 TCTGACTTTTTGTTTCTAGTAGG + Intergenic
979834321 4:125344267-125344289 TCTCAATTCTTCAAGGTAGTTGG - Intronic
980173320 4:129315430-129315452 GCTCACTTTTTGATGGGGTTGGG - Intergenic
980305480 4:131055131-131055153 ACCCACTTTTTGATGGTGCTGGG + Intergenic
982079022 4:151769262-151769284 TATCACTTTTCTATGGTAGTTGG + Intergenic
983127856 4:163976503-163976525 TTCCACTTTTTGATGGAAGTTGG - Intronic
983547976 4:168982950-168982972 TCTAACTTTTTGATGTATGTGGG - Intronic
984340013 4:178445219-178445241 GCTCAATTTTTGAAGTTAGTAGG + Intergenic
984900121 4:184579145-184579167 TTTCACTTTTTGATGTAAGAAGG - Intergenic
985503977 5:267871-267893 TCTCTCTTTTTGTTGGCAGATGG + Intergenic
986278484 5:6302838-6302860 TCTCACTTTTCGAGGGCAGGAGG + Intergenic
987758888 5:22132729-22132751 TCTCTCTTTTTGAAAGTATTTGG - Intronic
988281444 5:29152637-29152659 TATCACTTATTGATGGTTGGAGG - Intergenic
988459772 5:31424133-31424155 TATCACCTTTTGGTGGTGGTGGG + Intronic
989222948 5:38989382-38989404 TCTAAGTTTTTTATGGTTGTAGG - Intronic
991893594 5:71366166-71366188 TCTCTCTTTTTGAAAGTATTTGG - Intergenic
994441185 5:99805505-99805527 TTTCACTTTTTGATACTTGTTGG + Intergenic
995836150 5:116401556-116401578 TCTCTCTTTTTGATGATGGAGGG + Intronic
997305589 5:132833655-132833677 TCTCCCTTAGTGATGGTGGTTGG + Intergenic
998327320 5:141292870-141292892 GCTCATTGTTTGATGGTGGTGGG - Intergenic
1001136809 5:169109314-169109336 TCCCACTTTTTGCTGGCTGTTGG - Intronic
1009541335 6:64962752-64962774 TCTCTTTTTTTGAGGGTTGTTGG - Intronic
1014334362 6:120114195-120114217 TCTCACCTGTTGATGATATTTGG + Intergenic
1015404487 6:132821784-132821806 TTTCACTTTTTGATGATAAAGGG + Intergenic
1016316551 6:142795280-142795302 TCTCATTTATTGATGTTATTTGG + Intronic
1016565570 6:145449508-145449530 TCTCACTTTGTGAGGTGAGTTGG + Intergenic
1018130083 6:160721659-160721681 GCTCACTTTTTGGTGGACGTAGG + Intronic
1018591352 6:165426936-165426958 TCTGACTTTTTCATTATAGTGGG - Intronic
1020689874 7:11340606-11340628 TCTCCTTTTTTGAGGGTAATAGG + Intergenic
1022146205 7:27543557-27543579 TCTCACTTATAGATAGTATTTGG - Intronic
1026878393 7:73893108-73893130 TTACACTTTGTGCTGGTAGTCGG - Intergenic
1028318745 7:89435615-89435637 TGTGCCTTTTTGGTGGTAGTAGG - Intergenic
1028424365 7:90670051-90670073 TTTCACTATTTTATAGTAGTTGG + Intronic
1029063346 7:97822683-97822705 CGTCACCTTTTGATGGAAGTTGG - Intergenic
1030437786 7:109547083-109547105 TCTCCCTTTTTAATACTAGTGGG - Intergenic
1033824117 7:145168831-145168853 TCTCATTTTGTGGTGGTTGTTGG - Intergenic
1034129596 7:148702801-148702823 TTTAACCTTTTGATTGTAGTTGG + Intronic
1034562268 7:151888620-151888642 TCTCACTCTGTGGTGGGAGTGGG - Intergenic
1036578414 8:10050313-10050335 TCTCAGTTTTTGGCTGTAGTAGG + Intergenic
1037072305 8:14666394-14666416 CCTCATTTTATGATGGTAATTGG + Intronic
1038376289 8:27043158-27043180 TCTCACCTTTTCATGGTGATAGG - Intergenic
1039616293 8:38957222-38957244 TCTTCCTTTTTTATGGTAGAGGG + Intronic
1040350250 8:46559240-46559262 AGTCCCTTTTTGATGGAAGTTGG - Intergenic
1041162721 8:55061372-55061394 TCTCACCTTAGCATGGTAGTAGG + Intergenic
1041451598 8:58012339-58012361 TGTCATTTTTGGCTGGTAGTTGG + Intronic
1042013549 8:64279904-64279926 TTTCATTTTTTAATGGTATTGGG + Intergenic
1045874856 8:106968491-106968513 TCTCATATTTTGTTGGTAGATGG + Intergenic
1046832634 8:118763085-118763107 TCTGTTATTTTGATGGTAGTGGG + Intergenic
1047919468 8:129618920-129618942 TCCCAATGTTTGAAGGTAGTGGG - Intergenic
1048096056 8:131295786-131295808 TCTCATTTTTTAATGGGAATAGG + Intergenic
1049055258 8:140231387-140231409 TCTCTCTTTTTGCTGGAAGATGG - Intronic
1050908404 9:11035460-11035482 TTTTACTTTTTGGTGGTAGTGGG + Intergenic
1053189997 9:36056891-36056913 TTTCACTTCTTAATTGTAGTTGG + Intronic
1055229610 9:74046251-74046273 TTTCATTTTGTGATGGTATTTGG - Intergenic
1057298428 9:93862520-93862542 TCTCACTTTCTGTTGGCACTGGG - Intergenic
1058584748 9:106494868-106494890 GCCCACTTTTTGATGGGGGTTGG + Intergenic
1060049105 9:120364494-120364516 TCTCAATATTTAATGGTGGTGGG + Intergenic
1186137739 X:6536873-6536895 TCTCAATTATTGATTTTAGTTGG - Intergenic
1186314433 X:8353707-8353729 TCTCTCATTTTTATTGTAGTTGG + Intergenic
1187245430 X:17549425-17549447 TGTCTCTTTTTCATGGTAGTGGG - Intronic
1187395901 X:18919236-18919258 TTTCACTTTTAGATAGTAGTTGG - Intronic
1188130961 X:26432327-26432349 ATTCACATTTGGATGGTAGTGGG - Intergenic
1190542176 X:51488415-51488437 TCTCAGTTTTTGGTAGTGGTAGG + Intergenic
1191142258 X:57127884-57127906 TCTCACTTTTTAACGTAAGTGGG + Intergenic
1192304106 X:69940471-69940493 TCTCTCTTTTTGTAGTTAGTTGG + Intronic
1197153722 X:123247716-123247738 TCTCACTTCTGGGTGGTAATGGG - Intronic
1197947419 X:131854682-131854704 TTTAACTTTTTGGTGGTAATAGG - Intergenic
1198624885 X:138559691-138559713 TCTCACATGATGATTGTAGTTGG + Intergenic
1199085278 X:143621366-143621388 TTTCACTGTTTTTTGGTAGTTGG - Intergenic
1200036915 X:153336946-153336968 TCTCCCTTTTGGATGGGAGAGGG + Intronic
1200140438 X:153899441-153899463 TATCACTTTTTTATGTTTGTAGG - Intronic
1201439080 Y:13988686-13988708 TCTCAATTATTGATTTTAGTTGG - Intergenic
1201445493 Y:14054022-14054044 TCTCAATTATTGATTTTAGTTGG + Intergenic