ID: 1103626810

View in Genome Browser
Species Human (GRCh38)
Location 12:122226211-122226233
Sequence AACCGCCGGAACTTCCGCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 9}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103626806_1103626810 -8 Left 1103626806 12:122226196-122226218 CCGCGCAAGGCAACCAACCGCCG 0: 1
1: 0
2: 0
3: 0
4: 18
Right 1103626810 12:122226211-122226233 AACCGCCGGAACTTCCGCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 9

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103626810 Original CRISPR AACCGCCGGAACTTCCGCGC GGG Exonic
1062937480 10:1399189-1399211 AACAGCCGGCACTTCAGCACAGG - Intronic
1103626810 12:122226211-122226233 AACCGCCGGAACTTCCGCGCGGG + Exonic
1117647146 14:57865177-57865199 AACCGGAGTAACTCCCGCGCTGG + Intronic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1132580001 16:680388-680410 CGCCGCCGGAACTTCCGGCCGGG - Exonic
946407227 2:219498194-219498216 CACCCCCGGACCTTCCGCCCTGG + Intronic
984992760 4:185396789-185396811 GACCGCTGGGACTTCCGGGCCGG - Exonic
985392411 4:189504377-189504399 AACCCCTGGAACTTCCTGGCAGG + Intergenic
1001427757 5:171635253-171635275 AACTGCCGGACCTTCAGCCCTGG + Intergenic
1019058649 6:169240721-169240743 AACTTCCGGAACTTCCACCCAGG - Intronic