ID: 1103629780

View in Genome Browser
Species Human (GRCh38)
Location 12:122250916-122250938
Sequence CCCGTTCCTCCTCCCTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 5, 3: 23, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103629780 Original CRISPR CCCGTTCCTCCTCCCTTTTG GGG Intronic
903059529 1:20660402-20660424 CCCACCCCTCCTCCCATTTGAGG - Intronic
903574204 1:24328061-24328083 CGCCTTCCTCCTGCCTTGTGTGG + Intronic
904303802 1:29573908-29573930 CCCCTTCCTCCACCCTTGAGAGG - Intergenic
904625459 1:31799654-31799676 CCCCTTCCCCCACCCCTTTGGGG + Intronic
906859939 1:49348614-49348636 CACGGTCCTCCTCCCTCTGGAGG - Intronic
908667770 1:66511106-66511128 CCGGTTCTTTCTCACTTTTGTGG - Intergenic
908902334 1:68969892-68969914 CCCATTTCTCCTCCCCTGTGTGG - Intergenic
909563029 1:77026007-77026029 TCAGTTCCTCTTCCATTTTGTGG - Intronic
911234425 1:95395887-95395909 TCCTTCCCACCTCCCTTTTGTGG - Intergenic
912523230 1:110261530-110261552 CCCACTCATCCTCCCTTTAGTGG - Intronic
915669142 1:157472803-157472825 CCCTTTCCTCCTCCATCATGTGG - Intergenic
916346352 1:163796078-163796100 CCATTTCCACCTACCTTTTGTGG - Intergenic
916939760 1:169665989-169666011 CCAGTTCCTCTTTGCTTTTGAGG + Intronic
917151558 1:171950958-171950980 CCTCTTCCTCCTCCATTTTTTGG + Intronic
920700344 1:208213578-208213600 CCCCTTCTTCCTCTCTTTTCTGG + Intronic
921351468 1:214240038-214240060 CTGGTTGCTTCTCCCTTTTGAGG + Intergenic
924260980 1:242231231-242231253 CCTCTTCCTCCTCCCTGTTGAGG + Intronic
1062913796 10:1231821-1231843 AACATTCCTCCTCCTTTTTGCGG - Intronic
1064191361 10:13208691-13208713 CCCCTTCCTCCTCTTTTTTTTGG - Intronic
1065240054 10:23695453-23695475 CCAGTCCCTCCTCCCAGTTGGGG - Intronic
1065550407 10:26863776-26863798 CCTGTTCCTCCTCACCTTTAAGG - Intergenic
1066434822 10:35387584-35387606 CACTCCCCTCCTCCCTTTTGTGG - Intronic
1069893884 10:71668429-71668451 TCCCTTGCTCCTCCCTTTGGTGG - Intronic
1070126805 10:73629040-73629062 CCAGTTCCTCATCCCCTTAGTGG + Intergenic
1070955045 10:80458165-80458187 CCTGGTCCTCCCCACTTTTGTGG + Intronic
1071384630 10:85106911-85106933 CCTATTTCTCCTCCCTTTTGAGG + Intergenic
1073205568 10:101767595-101767617 CCCAGTCCTCCTCCATTTTCTGG + Intergenic
1074046503 10:109844371-109844393 TCCCTTCCTCTTCCCCTTTGTGG - Intergenic
1075541751 10:123319402-123319424 CCCGTTCCACCAGCGTTTTGAGG + Intergenic
1077097112 11:803748-803770 CCCCTGCCTCCTTCCATTTGCGG - Intronic
1077167363 11:1149862-1149884 CCAGGGCCTCCTTCCTTTTGGGG + Intergenic
1077240463 11:1507973-1507995 GCCACTCCTCCTCCCTTGTGGGG - Intergenic
1080329483 11:31119020-31119042 CCCACTCCTCCTCCTCTTTGTGG - Intronic
1083427867 11:62598259-62598281 TCCTTTCCCCCTCTCTTTTGCGG + Intronic
1084383634 11:68828833-68828855 CCCGTTCCTTCTTCCTCCTGGGG + Intronic
1084472508 11:69371318-69371340 CCCGTTCTTATTCCATTTTGTGG + Intergenic
1085741692 11:79082807-79082829 CCTTTTCCTCCACCCCTTTGAGG - Intronic
1085860896 11:80234329-80234351 GTCCTTCCTCCTCCATTTTGTGG - Intergenic
1089352152 11:117827957-117827979 CCCATTCCTCCTCCCTGCTCAGG - Intronic
1090592782 11:128290611-128290633 CCTGTTGCTCCTCACTTCTGGGG - Intergenic
1091049786 11:132356895-132356917 CCCTCCCCTCCTTCCTTTTGTGG + Intergenic
1091393358 12:139067-139089 CCTCTTCCTCCTCTGTTTTGGGG - Exonic
1092472555 12:8792239-8792261 CCAGTTCCTCTTTGCTTTTGAGG + Intergenic
1092882718 12:12900470-12900492 TCTGTTCCTCCTCCCCTTTAGGG - Intronic
1092957403 12:13563061-13563083 CCCTTTCATCCCCACTTTTGGGG - Exonic
1096251184 12:50033433-50033455 CCCCAGCCTCCTCCCTGTTGGGG - Intergenic
1096518912 12:52173304-52173326 CCCCTTCCACCTCCCTTTCTGGG + Intronic
1096586846 12:52628393-52628415 CTCTCTCCTCCTCCCTTTTGTGG + Intergenic
1096713334 12:53474795-53474817 CCTGTACTTACTCCCTTTTGTGG + Intronic
1098944132 12:76571806-76571828 CTCTTTTCTCCTCCCTTTTTTGG - Intergenic
1099670194 12:85681443-85681465 CCTGTTCCTCTTCCTTTTTGGGG + Intergenic
1101991214 12:109487031-109487053 CTCATCCCTGCTCCCTTTTGGGG + Intronic
1102171096 12:110843035-110843057 CCCAATCCTCCTTCCTTCTGTGG - Intergenic
1102259885 12:111437364-111437386 CTCTTTCCTCCTCCCCTGTGGGG + Intronic
1102574430 12:113847116-113847138 CCGTTTCCTCATCCCTATTGGGG + Intronic
1103629780 12:122250916-122250938 CCCGTTCCTCCTCCCTTTTGGGG + Intronic
1104956789 12:132470670-132470692 CCCCTTCCTTTTCCCTTCTGTGG - Intergenic
1105873765 13:24535412-24535434 CCAGCTCCTTCTGCCTTTTGGGG + Intergenic
1106817446 13:33424382-33424404 TTCGTTTCTCCTCCCTTTTAAGG - Intergenic
1106854931 13:33841207-33841229 CCCCTTCCTCCAGCCTTCTGGGG + Intronic
1107203668 13:37754248-37754270 ACTCTTCCTCCTTCCTTTTGTGG + Intronic
1107712523 13:43164290-43164312 CCCTCTCCTCCTCTCTTTTCTGG + Intergenic
1107853864 13:44595739-44595761 CCCTTTCCTCCTGCCCTTTGCGG - Intergenic
1108184728 13:47877226-47877248 CCAGTTCCACCACCCTTGTGGGG + Intergenic
1109424689 13:62154224-62154246 CCAGTTTCTCTTCGCTTTTGAGG + Intergenic
1109877178 13:68420682-68420704 TCCCTTCCTCCTTCCTTTTGGGG + Intergenic
1113701357 13:112390997-112391019 CCAGACTCTCCTCCCTTTTGTGG - Intronic
1114277797 14:21163400-21163422 CCCTTTCCTCCTGCCTTTTGTGG - Intergenic
1114538319 14:23436835-23436857 CCCTTTCCTCCCCTCCTTTGTGG - Intergenic
1115862416 14:37702054-37702076 CCCTTTTCTCCTTTCTTTTGAGG - Intronic
1119640445 14:76310541-76310563 CCAGTTCCTCCTCCCCTTCATGG + Intergenic
1120421624 14:84293207-84293229 CTCCTTACTCCTCCCTTTTTTGG + Intergenic
1121519034 14:94573075-94573097 CCCGTTGCTGCTCCCCTGTGGGG + Intronic
1121936603 14:98025438-98025460 TCCTTTCCTCCTGCCTTTTAGGG - Intergenic
1122623273 14:103071591-103071613 CCAGCTCCTCCTCCCCTTTCAGG - Intergenic
1125605442 15:40937542-40937564 GCCTTTCCTTCTGCCTTTTGTGG + Intronic
1126855190 15:52831967-52831989 TCTGTTCCTCGTCCCTTTTCAGG + Intergenic
1128905619 15:71465427-71465449 GCTGTTCCTGCTACCTTTTGGGG + Intronic
1129411877 15:75354780-75354802 CCCCTTCCTCCTCCCCTTCTTGG - Exonic
1133230741 16:4365408-4365430 CGAGTTCCTCCTCTCTCTTGGGG + Intronic
1133520109 16:6549074-6549096 CTCTTCCCTCCTCCCTTTTTTGG - Intronic
1133689403 16:8198855-8198877 CCCGTTCCACCTCCGATGTGAGG - Intergenic
1137506696 16:49060183-49060205 CCCCTTCCTCCACCCTCTAGTGG + Intergenic
1141716550 16:85730247-85730269 CCCGTTCTTATTCCCTTTGGAGG - Intronic
1142631868 17:1230456-1230478 CCCGTTCCATCTCCTCTTTGCGG + Intergenic
1142695309 17:1629702-1629724 CCCGTTCCCCGTCCCTTTCAGGG + Intergenic
1143155691 17:4834561-4834583 CCCGTTCATTGTCCCTTGTGGGG + Intronic
1143513497 17:7408145-7408167 CCCGCCCCTCCTCCCTCCTGGGG + Intronic
1147468313 17:40630831-40630853 CCCTTTCCTCCTGCCTTTTGCGG + Exonic
1149215281 17:54347100-54347122 CCAGCCCCTCCTCCCTTTTGAGG - Intergenic
1150307165 17:64095568-64095590 CCCATCCCTCCTCCCTTTCCAGG + Intronic
1152278399 17:79371413-79371435 CCCTTTCCTGCTCCCTGTGGGGG + Intronic
1152519831 17:80848972-80848994 CAGGTTCCTCCTCCCTCTGGAGG + Intronic
1155053805 18:22168990-22169012 CACGTTCCCCCTTCCTTCTGGGG + Intergenic
1156585731 18:38428914-38428936 CGCTTTCCTCCTCCCTTTTGAGG - Intergenic
1157857329 18:51114894-51114916 CCAGTTCCTCTTTGCTTTTGAGG - Intergenic
1160009885 18:75098382-75098404 CCCCATCCACCTCCCTTTTGTGG - Intergenic
1160013829 18:75125916-75125938 CCTGTTCCTCCTCCCTCTGCAGG + Intergenic
1160671622 19:367418-367440 CCCTTTGCTCAGCCCTTTTGGGG - Intronic
1161535319 19:4815839-4815861 CCGCTTCCTGTTCCCTTTTGCGG + Intergenic
1161586616 19:5109188-5109210 CCCTTTCCCCCTTCCTCTTGAGG + Intronic
1162532842 19:11245763-11245785 CCCCTTCCTTCTCCTTGTTGGGG - Intronic
1163019076 19:14473164-14473186 CCCTCTCCTCTTCCTTTTTGGGG - Intronic
1163851992 19:19669300-19669322 CCAGTTCCTCCTCCCTTAGGCGG + Intronic
1163916638 19:20246058-20246080 CCCATTCCTCAGCCCTTTGGGGG - Intergenic
1164849315 19:31468382-31468404 TCCCTTCCTGCTCCCTTTTTGGG - Intergenic
1165433575 19:35785176-35785198 CCCTTTCCTCCTGCGGTTTGGGG - Exonic
1166750575 19:45162378-45162400 CCCCTTTCTCATCCCATTTGGGG + Intronic
1166937499 19:46343283-46343305 CCCCTCCCTCCTCCCTCTGGAGG + Exonic
926332648 2:11838074-11838096 CCCACTCCTCCTCCCTTTAGTGG - Intergenic
927039694 2:19215977-19215999 CCTGTTCCTTCTTCCATTTGTGG + Intergenic
927216203 2:20669070-20669092 CCTCTCCCTCCTCCCTCTTGGGG + Intronic
927806379 2:26150398-26150420 CCCTTTCCTCCTGCCTTTTGCGG - Intergenic
928025567 2:27736098-27736120 ACCTTTCCCCCTCCCTGTTGGGG + Intergenic
929414468 2:41733299-41733321 GCAGTTCCAGCTCCCTTTTGTGG - Intergenic
930426177 2:51215978-51216000 ACTGTTGCTCTTCCCTTTTGTGG - Intergenic
935535118 2:104284908-104284930 GCCTTTCCTCCTCTCTTTGGAGG - Intergenic
938097777 2:128474708-128474730 TCCGCTCCTCCTGCCTTTGGGGG - Intergenic
939496115 2:142930404-142930426 ACCCTTTCTCCTCCCTTTTCTGG - Intronic
940220347 2:151345110-151345132 CCAGTTTCTCTTCCCTTCTGAGG + Intergenic
940859105 2:158753934-158753956 CCCTTTTCTCCTCCCCTTGGTGG + Intergenic
941171064 2:162137416-162137438 CCCTTTTCTCCAACCTTTTGAGG + Intergenic
947740551 2:232482948-232482970 CCCGTGCCTCCTGCAGTTTGAGG - Exonic
1169237667 20:3944521-3944543 CCCTTTCCTTCTCCCTTTCTGGG - Intronic
1169382648 20:5121526-5121548 CCCTTTCCTGTTCCCTTTTAAGG - Intronic
1170033668 20:11968215-11968237 CCAGTTCTTCCTCACTGTTGGGG - Intergenic
1172765917 20:37350705-37350727 CCCCATTCTCCTCCCTGTTGGGG + Intronic
1172781337 20:37438518-37438540 CCCGCTCCTCCTCCCTGCTCTGG - Intergenic
1173554090 20:43953367-43953389 CCCCTTCCTCCTGTCTGTTGTGG + Intronic
1177873400 21:26600664-26600686 CTCCTTCCTCCTACCTTGTGAGG + Intergenic
1177882645 21:26712410-26712432 TGTGTTCCTCCTCCCCTTTGGGG + Intergenic
1179502986 21:41821511-41821533 CCCCCTCCTCCTCCCTGCTGAGG - Intronic
1179580960 21:42343685-42343707 CCCCTTCCTCCTCCTTTGGGGGG - Intergenic
1181778913 22:25178848-25178870 CCCGTTGCCCCTCCCTCATGGGG + Intronic
1182113268 22:27739519-27739541 CATTTTCCTGCTCCCTTTTGTGG + Intergenic
1183455175 22:37918671-37918693 CCCCCTCCTCCTCCCCTTTGCGG - Intronic
1184761376 22:46546742-46546764 CCCCTGCCTCCTCCCTCATGAGG + Intergenic
949737775 3:7194150-7194172 ACCTTTCCTCCTCCAGTTTGTGG + Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
950449969 3:13059985-13060007 CCGGCGCCTCATCCCTTTTGAGG - Intronic
953794575 3:45974711-45974733 CCCTTCTCTCTTCCCTTTTGAGG + Intronic
954390301 3:50265018-50265040 CCTGTTCCCCTTCCCTTCTGAGG - Intergenic
954680732 3:52344613-52344635 CCTGCTCCTCCTCCTTCTTGGGG - Exonic
955423641 3:58764793-58764815 CCTCTTCCTCCTTCCTCTTGAGG + Intronic
956086554 3:65617300-65617322 CCCATTCCTCCTCACTTTTCTGG - Intronic
957183110 3:76907225-76907247 CACGTTACTCCTTCCTTTTTGGG + Intronic
959386020 3:105708117-105708139 CCATTTCCTCCACCCTTTTCTGG + Intronic
960115049 3:113885203-113885225 CCCGTTCCCCCTCCCTTCGGCGG + Intronic
961198922 3:125028374-125028396 CCTGTTCCTCCTCTCCTTTGTGG + Intronic
963288618 3:143463588-143463610 TCCGGTTCTCCTCCCTTCTGTGG - Intronic
964010492 3:151886171-151886193 CTGGTTTTTCCTCCCTTTTGTGG - Intergenic
964064728 3:152563788-152563810 CCAGTTCCTCTTTGCTTTTGAGG + Intergenic
964473868 3:157081772-157081794 GCCGCTCCTCCTGCCTGTTGTGG - Intergenic
966884574 3:184369480-184369502 CCTCTTCCTCCTCCCTGCTGAGG - Intronic
967004615 3:185372309-185372331 CCCCTTCCTCCTCCTTTTTCTGG + Intronic
967408053 3:189139137-189139159 CCAGGTCCTCCTCCTTTGTGAGG - Intronic
967712608 3:192726894-192726916 CCTCCTCCTCCTCCATTTTGGGG + Intronic
967795881 3:193598148-193598170 CTCTTTCCTCCTGCCCTTTGAGG - Intronic
967950751 3:194838380-194838402 CCTGCTCCCCTTCCCTTTTGAGG - Intergenic
969351057 4:6598165-6598187 CCTGTTCTTCCTCCCCTCTGGGG + Intronic
969693851 4:8724040-8724062 GCCGGTTCTCCTCCCTTCTGGGG + Intergenic
971136267 4:23871938-23871960 CCCTTTCCTCTTCCCTCTGGAGG - Intronic
973759583 4:54103890-54103912 CCTGCGCCTCCTCCCTTTCGTGG - Intronic
974358012 4:60837084-60837106 CCCCTTGCACTTCCCTTTTGAGG + Intergenic
979145376 4:117240020-117240042 CAGGTGCCTCCTCCCCTTTGAGG + Intergenic
981806996 4:148728235-148728257 CCTCTTCCTCCTCCCTCTAGTGG - Intergenic
984958531 4:185070889-185070911 CCCTTTCCTTTCCCCTTTTGAGG + Intergenic
985164795 4:187081966-187081988 CCAGTTCCTGCTCCCTTGGGAGG + Intergenic
985844072 5:2331097-2331119 CCCATTCCTCCTCTCTTTGGAGG + Intergenic
985997044 5:3602826-3602848 CCCGTTCCTGGTCCCTGTAGAGG + Intergenic
990632884 5:57690264-57690286 CCAGTCCTTCCTCCCTTCTGAGG + Intergenic
993419449 5:87682731-87682753 GCCCTTCCTCCTGTCTTTTGGGG - Intergenic
993726443 5:91372968-91372990 ACTGTTCTTCCTGCCTTTTGAGG + Intronic
995601932 5:113807001-113807023 CTCTTTCCTCCTCCTTTCTGAGG + Intergenic
996692440 5:126354994-126355016 CCTGTTCCTCCTTCCGTGTGAGG - Intergenic
998052005 5:139043608-139043630 CCTTTCCCTCCTCCCTTTGGAGG - Intronic
1000311801 5:160052167-160052189 CCCCATCCCCCTCCCTTTTTTGG - Intronic
1001740882 5:174051875-174051897 ATCGTTCCTCCACCCTTCTGAGG - Intronic
1002437535 5:179240877-179240899 CCTGTTCCTCTTCCCTTTACCGG - Intronic
1003498913 6:6687805-6687827 CCTCTCCCTCCTTCCTTTTGGGG + Intergenic
1004148791 6:13094842-13094864 CCCCTTCTTTCTCCCTTTTATGG + Intronic
1006610474 6:35291565-35291587 CCCGTTCCAGTGCCCTTTTGAGG + Exonic
1006963396 6:37957177-37957199 CCCTTTCTTCCTCTCTTTTCAGG + Intronic
1007961959 6:45968076-45968098 CCCTTTCTTCCTCCATTCTGAGG + Intronic
1009471013 6:64028595-64028617 CCAGTTCCTCTTTGCTTTTGAGG + Intronic
1011164366 6:84429902-84429924 CCCTTTCCTCCTGCCTTTTGTGG + Intergenic
1012987506 6:105890670-105890692 CCCTTTCCTCCTCCCTGCTTGGG + Intergenic
1017343451 6:153353347-153353369 CCACTTCCTCCTCCCTGGTGGGG + Intergenic
1018863499 6:167730466-167730488 CCTGTTCATCATTCCTTTTGCGG + Intergenic
1020900052 7:13992129-13992151 CCCCTTCTCCCTCCCTTTAGTGG + Intergenic
1021821725 7:24504993-24505015 CCAGTTCCTCCAACCTCTTGAGG - Intergenic
1022806051 7:33823878-33823900 CCGGTTCTTCCTCCCTTTAGTGG - Intergenic
1023629827 7:42153137-42153159 CCCTTTCCTCCTAGCTTTTGAGG + Intronic
1024261514 7:47577311-47577333 CCTCTTCCTCTTCTCTTTTGGGG - Intronic
1024381279 7:48698994-48699016 GCCTTTCCTCCACTCTTTTGAGG - Intergenic
1024697178 7:51869695-51869717 CTCTTTCTTCCTCCCTTTAGTGG - Intergenic
1025927323 7:65970371-65970393 CCTGTTTCTTCTGCCTTTTGTGG - Intronic
1030268325 7:107643665-107643687 CCCTTTTCTCCTTCGTTTTGTGG - Intergenic
1030659472 7:112205129-112205151 CCTTTTCCTCCTCCCATTTCAGG - Intronic
1032002896 7:128276757-128276779 CCCAACCCTCCTCCCTTCTGAGG - Intergenic
1032065781 7:128769305-128769327 CCCATTCCTCCTCCTCTCTGAGG + Exonic
1032287115 7:130547643-130547665 CACGTATCTCCTCCCTTCTGAGG + Intronic
1034997022 7:155584063-155584085 CCCCATCCTCCTCCCTCTTCTGG + Intergenic
1036973318 8:13380444-13380466 CCCCTTCCTCCACCTTTTTGTGG + Intronic
1037578209 8:20228045-20228067 CCCTGTCCTCCACCCATTTGGGG - Intergenic
1038638992 8:29308940-29308962 CCAGTTCCTCTTTGCTTTTGAGG + Intergenic
1039382172 8:37096033-37096055 CCCTTTTCTCCTGCCTTTTGCGG - Intergenic
1040622800 8:49108451-49108473 CCTGATCTCCCTCCCTTTTGGGG + Intergenic
1043670832 8:82882102-82882124 CCCATTCCTTGTCCCTGTTGTGG + Intergenic
1044817181 8:96125203-96125225 CCTCTTCCACCTCCCTTTTCAGG - Intergenic
1046689442 8:117266771-117266793 CCCTTTCCTTCTGCCTTGTGAGG - Intergenic
1050409702 9:5350480-5350502 GCCTTTACTCCTCCCTGTTGAGG - Intergenic
1054860845 9:69951457-69951479 CCCTTTCCACATCACTTTTGAGG + Intergenic
1055941007 9:81649746-81649768 CCGGTACCTCCTCCCCTCTGGGG + Intronic
1060361447 9:122962100-122962122 TCCCTTCCCCCTGCCTTTTGTGG - Intronic
1187215224 X:17269357-17269379 TCCCTTCCTCTTCCCTTTTTCGG - Intergenic
1189377011 X:40474297-40474319 CCCATCCCTCCTCCCTTCTCAGG - Intergenic
1190437242 X:50437693-50437715 CCTCTTCCTCCTCCCTTTCCAGG - Intronic
1192236921 X:69301947-69301969 TCCATTTCTCCTCCCTGTTGTGG - Intergenic
1195274633 X:103269670-103269692 CCCTGTCCTCTTTCCTTTTGGGG + Intergenic
1195975056 X:110517598-110517620 CCTGTTCCTACTACCTTTTCTGG - Intergenic
1197297407 X:124735926-124735948 CCCGCCCATCCTCCCTTTTTTGG - Intronic
1197308286 X:124871149-124871171 CCCCTTCCTCCTCCCCTGTTTGG + Intronic
1197343856 X:125307902-125307924 CCCTTTCCTCCTCCTTTTTCTGG - Intergenic
1197721889 X:129750845-129750867 CCTGGTCCTCCTCCCCTTAGTGG - Intronic
1198657008 X:138925631-138925653 CCTGTTACTCATCCCTTTTGGGG - Intronic
1200122590 X:153798146-153798168 CTGGTCCCTCCTCCTTTTTGGGG + Intronic
1200418348 Y:2935815-2935837 CCCGTCCCTCCTCCCCTTCGCGG - Intronic
1201403943 Y:13631771-13631793 CCAGTTTCTCTTCGCTTTTGAGG + Intergenic