ID: 1103629863

View in Genome Browser
Species Human (GRCh38)
Location 12:122251292-122251314
Sequence TCCACGGCTGCACCCACCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 195}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103629863_1103629873 10 Left 1103629863 12:122251292-122251314 CCCAGGGTGGGTGCAGCCGTGGA 0: 1
1: 0
2: 0
3: 9
4: 195
Right 1103629873 12:122251325-122251347 CTGGGCAGAGCCGGGGCTTCTGG 0: 1
1: 0
2: 4
3: 53
4: 412
1103629863_1103629870 3 Left 1103629863 12:122251292-122251314 CCCAGGGTGGGTGCAGCCGTGGA 0: 1
1: 0
2: 0
3: 9
4: 195
Right 1103629870 12:122251318-122251340 ACCTCTCCTGGGCAGAGCCGGGG 0: 1
1: 0
2: 3
3: 27
4: 266
1103629863_1103629868 1 Left 1103629863 12:122251292-122251314 CCCAGGGTGGGTGCAGCCGTGGA 0: 1
1: 0
2: 0
3: 9
4: 195
Right 1103629868 12:122251316-122251338 GCACCTCTCCTGGGCAGAGCCGG 0: 1
1: 0
2: 6
3: 48
4: 479
1103629863_1103629866 -8 Left 1103629863 12:122251292-122251314 CCCAGGGTGGGTGCAGCCGTGGA 0: 1
1: 0
2: 0
3: 9
4: 195
Right 1103629866 12:122251307-122251329 GCCGTGGAAGCACCTCTCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 86
1103629863_1103629865 -9 Left 1103629863 12:122251292-122251314 CCCAGGGTGGGTGCAGCCGTGGA 0: 1
1: 0
2: 0
3: 9
4: 195
Right 1103629865 12:122251306-122251328 AGCCGTGGAAGCACCTCTCCTGG 0: 1
1: 0
2: 0
3: 9
4: 107
1103629863_1103629874 11 Left 1103629863 12:122251292-122251314 CCCAGGGTGGGTGCAGCCGTGGA 0: 1
1: 0
2: 0
3: 9
4: 195
Right 1103629874 12:122251326-122251348 TGGGCAGAGCCGGGGCTTCTGGG 0: 1
1: 0
2: 1
3: 32
4: 319
1103629863_1103629869 2 Left 1103629863 12:122251292-122251314 CCCAGGGTGGGTGCAGCCGTGGA 0: 1
1: 0
2: 0
3: 9
4: 195
Right 1103629869 12:122251317-122251339 CACCTCTCCTGGGCAGAGCCGGG 0: 1
1: 1
2: 6
3: 57
4: 572

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103629863 Original CRISPR TCCACGGCTGCACCCACCCT GGG (reversed) Intronic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
900568416 1:3346691-3346713 ACCCCGGCTGCACCCAGACTGGG + Intronic
900585633 1:3431103-3431125 CACACGGCTGCCCCCACCTTCGG - Exonic
900732419 1:4271095-4271117 TCCAAGGCCCCACCCACCATGGG - Intergenic
901066576 1:6497303-6497325 TCCCCGCCTGCACTCACCCATGG + Intronic
901785833 1:11623874-11623896 TCCTCTGCTGCTCCCACCCCAGG - Intergenic
901846652 1:11987266-11987288 TGCACCACTGCACCCAGCCTGGG + Intronic
902695855 1:18140467-18140489 CCCACAGCTGCCCCCACTCTAGG - Intronic
903226143 1:21895102-21895124 TCCAGGGCTGCCTTCACCCTAGG - Intronic
903806020 1:26006124-26006146 ACCACTCCTGCCCCCACCCTGGG - Intergenic
904063177 1:27726534-27726556 TCCAAGGCAGCACCCAACTTTGG - Intronic
904236568 1:29121123-29121145 CCCCGGGCTGCCCCCACCCTGGG - Exonic
904284721 1:29446617-29446639 TCCAAGTCCTCACCCACCCTTGG + Intergenic
904840462 1:33368861-33368883 CCCACCCCTGCACCCAGCCTGGG - Intronic
906843816 1:49168593-49168615 TCTAGGGCTGCACCCACAATAGG - Intronic
907102675 1:51851027-51851049 TCCCTGGCCGCAGCCACCCTTGG + Intronic
908258639 1:62321985-62322007 TCCACTGCAGGACCCAGCCTGGG + Intergenic
908769477 1:67583163-67583185 ACCACAGCTGCACTCACGCTGGG - Intergenic
910577705 1:88785181-88785203 TGCACCACTGCACCCAGCCTGGG - Intronic
910644626 1:89500176-89500198 TCCAGGGCTGCTGCCACACTGGG + Intergenic
910888835 1:91995678-91995700 TGCACCACTGCACCCACCCTGGG - Intronic
912775840 1:112506048-112506070 TGCACCACTGCACCCAGCCTGGG - Intronic
914357580 1:146900079-146900101 TCAACGTCTTCACCAACCCTTGG + Intergenic
915362996 1:155297011-155297033 TCCAGGGCTGCACCCTCTCTTGG + Intronic
916650515 1:166830639-166830661 TCCTAGGCTGCACACACCATGGG - Intergenic
917838229 1:178957537-178957559 TTCTGGGCTGCACACACCCTGGG - Intergenic
922717879 1:227886538-227886560 TCCCCGGATGCTCCCTCCCTAGG + Intergenic
922889037 1:229046457-229046479 TCCACAGCAGCTCCCAGCCTGGG + Intergenic
923046517 1:230360038-230360060 TTGACGGCTGCACCCACCGGAGG - Intronic
923673736 1:236063741-236063763 CGCACCGCTGCACCCAGCCTGGG + Intronic
1065972905 10:30819095-30819117 CCCACCGCTCCACCCACTCTGGG + Intergenic
1068953900 10:62804967-62804989 GCCACGGCTGCCCCCAGCCCGGG - Exonic
1069456859 10:68560677-68560699 TCCAAGCCTGCACCAGCCCTCGG - Exonic
1070207675 10:74279982-74280004 TGCACCACTGCACCCAACCTGGG + Intronic
1072022896 10:91421575-91421597 TCCTGGGCTGCATGCACCCTGGG + Intronic
1072265939 10:93728094-93728116 TCCAGGACTGTGCCCACCCTTGG + Intergenic
1072693982 10:97589688-97589710 CCCCCTGCTGCACCCTCCCTAGG - Intronic
1076009422 10:126975422-126975444 TCCACTGCGGCAACCAGCCTGGG - Intronic
1076037310 10:127210628-127210650 TCCATGGCTGGAGCCACCCAGGG - Intronic
1076734930 10:132454572-132454594 TCCAGGGCTGCAGTCACTCTTGG + Intergenic
1077532429 11:3103513-3103535 GCCAGGGCTGCTCCCACGCTGGG + Intronic
1078146185 11:8723168-8723190 CCCACGGCAGCAGCCACACTGGG - Intronic
1079027653 11:16961526-16961548 TCCAACCCTGCACCCACCCCTGG + Intronic
1080837824 11:35956777-35956799 TGCACCACTGCACCCAGCCTGGG - Intronic
1080868175 11:36213640-36213662 CCCAGGGCCGCTCCCACCCTGGG + Intronic
1081022134 11:37959680-37959702 TCTACAGCAGCACCCACTCTTGG + Intergenic
1081854656 11:46295826-46295848 TTCTCGGCTGCACCCTCTCTTGG - Intronic
1082781244 11:57289128-57289150 TCAAAGGCTGCGCCCTCCCTAGG - Intergenic
1083936391 11:65872162-65872184 TCCCCGGCAGCAGTCACCCTGGG + Intronic
1084157288 11:67320957-67320979 TCCAGGGCTGAACCTGCCCTAGG + Intronic
1089170730 11:116509742-116509764 TGCACTTCTGCCCCCACCCTGGG - Intergenic
1091742021 12:2966007-2966029 TACACGGTTGCACTCAGCCTAGG + Intronic
1095239958 12:39846493-39846515 TGCACCACTGCACCCACCCTGGG - Intronic
1097976440 12:65691761-65691783 TGCACCACTGCACCCACTCTGGG - Intergenic
1103405289 12:120670702-120670724 TGCACCGCTGCACTCAGCCTGGG + Intergenic
1103629863 12:122251292-122251314 TCCACGGCTGCACCCACCCTGGG - Intronic
1104986570 12:132600851-132600873 GCCCCCGCTGCACCCACCCATGG - Intergenic
1106227597 13:27796784-27796806 TGCACAACTGCACTCACCCTGGG - Intergenic
1107935387 13:45341455-45341477 TCCCCCGCTCCACCCACCCAGGG - Intergenic
1114189794 14:20431681-20431703 TGCGCCGCTGCACCCAGCCTGGG + Intronic
1117791099 14:59343103-59343125 CCCAGGGCTGCACACATCCTAGG - Intronic
1118702203 14:68444593-68444615 CACAGGGCTGCACCTACCCTGGG + Intronic
1119406288 14:74401643-74401665 TCCCCGGCTGGCCCCTCCCTGGG - Intergenic
1121581845 14:95037611-95037633 TCCAAGGCTGACCCCACCCTGGG - Intergenic
1122063076 14:99149644-99149666 TGCACCACTGCACCCAGCCTGGG + Intergenic
1126660174 15:51025566-51025588 TCCAGGGCTCCTGCCACCCTAGG - Intergenic
1127899886 15:63333268-63333290 CAGACGGCTGGACCCACCCTTGG - Intronic
1130964448 15:88686493-88686515 TCCAGGGCTGCACCCACAATGGG - Intergenic
1130994834 15:88897889-88897911 TCCCACGCTGCACCCACCCCAGG + Intergenic
1131247428 15:90807442-90807464 TCAACCACTGCACCCAGCCTGGG - Intronic
1132744314 16:1430388-1430410 TCCTCAGCTGCAGCCACCCCTGG - Intergenic
1132946259 16:2532774-2532796 TCCCCTGCTGCGCCCACCCTGGG - Intergenic
1133461011 16:5986103-5986125 TACACCACTGCACCCAGCCTGGG - Intergenic
1133730527 16:8574749-8574771 GCCATGGCTGCACCAACTCTGGG - Intronic
1134480719 16:14616698-14616720 TGCACCACTGCACTCACCCTGGG + Intronic
1134692715 16:16201447-16201469 TCCAGGCCCCCACCCACCCTGGG - Intronic
1135401965 16:22172164-22172186 CCCAGGGCTGCACCTTCCCTGGG - Intronic
1136617659 16:31408536-31408558 ACCAACTCTGCACCCACCCTGGG + Intronic
1139438138 16:66948601-66948623 TCCACGGCTGGACCGACCCGGGG + Intergenic
1139965857 16:70745009-70745031 GCCACGGCCCCACCCACCATTGG + Intronic
1139976605 16:70817216-70817238 TCAACGTCTTCACCAACCCTTGG - Intronic
1140753377 16:78046113-78046135 TCCAGGCCTGCAGCCACGCTTGG + Intronic
1142109232 16:88322457-88322479 TCCACAGCCGCAGCCACCCATGG + Intergenic
1142421754 16:89974982-89975004 CTCAAGGCTGGACCCACCCTAGG - Intergenic
1142653272 17:1371366-1371388 TGCACCACTGCACCCAACCTCGG + Intronic
1144029080 17:11303894-11303916 TCCACTGCTGTACCCACCTCAGG - Intronic
1144944969 17:18965183-18965205 ACCTCTGCTGCCCCCACCCTGGG - Intronic
1145062852 17:19743574-19743596 TCTGCGGCTGCCCCCACCCTGGG - Intronic
1145274800 17:21423027-21423049 TCCTTGCCTGCAGCCACCCTGGG + Intergenic
1145821069 17:27835930-27835952 CCCCTGGCTGCAGCCACCCTTGG + Intronic
1146750629 17:35374611-35374633 TTAACCGCTGCTCCCACCCTCGG - Intergenic
1147241759 17:39095146-39095168 TCCCTGGCTGCACCCATGCTTGG - Intronic
1147466458 17:40614850-40614872 TCCCCAGCTGCACCCACACCAGG - Intergenic
1147540163 17:41350669-41350691 GCCACGGCTGCACCCTGCCCGGG - Exonic
1147543714 17:41382148-41382170 GCCACGGCTACACCCTGCCTGGG - Exonic
1148504783 17:48118830-48118852 TCCACCCCTGCCTCCACCCTTGG - Intronic
1149583016 17:57764529-57764551 TGCACCACTGCACCCAGCCTGGG - Intergenic
1149592112 17:57837930-57837952 TGCACCACTGCACCCAGCCTGGG + Exonic
1150215862 17:63468857-63468879 TGCACCACTGCACCCAGCCTGGG - Intergenic
1150429774 17:65105763-65105785 GCCACAGCTGCACCCTTCCTGGG + Intergenic
1157799951 18:50610999-50611021 CCCAGGGCTGGACACACCCTCGG - Intronic
1158438265 18:57450010-57450032 TCCATGGCTGAACCCACACCAGG + Intronic
1161584862 19:5100019-5100041 TCGAAGGCTGCACCCATCCGTGG + Intronic
1161618268 19:5284531-5284553 TGCACCGCTGCACTCAGCCTGGG - Intronic
1161648528 19:5469633-5469655 TCCACGGCTGCACCTTCGCAAGG + Intergenic
1163426631 19:17244216-17244238 CCCAGGTCTGCACCCACCCCTGG + Intronic
1163514700 19:17755836-17755858 ACCAGGGCTGAACCCAGCCTTGG + Intronic
1163831385 19:19548661-19548683 CCCCCAGCTGCAGCCACCCTGGG + Intergenic
1165487264 19:36103417-36103439 CCCACATCTGCACCCACCCCAGG + Exonic
1168273993 19:55266065-55266087 CCCACACCTGCACCCACCCCAGG + Intronic
927553424 2:24017359-24017381 CCCACGGCTGCACTCACGGTAGG - Exonic
928081997 2:28319959-28319981 TCCACCGGGACACCCACCCTCGG + Intronic
928833750 2:35519199-35519221 TCTAAAGCTGCACCCACCCATGG + Intergenic
929327402 2:40633384-40633406 TCCACAGCTTCACCAACACTTGG + Intergenic
938181818 2:129191128-129191150 ACCCAGCCTGCACCCACCCTGGG - Intergenic
938605013 2:132883377-132883399 TCCACCTTTGCCCCCACCCTTGG + Intronic
942238234 2:173933551-173933573 TCCATGGCTACACCCAACTTCGG + Intronic
942950054 2:181712096-181712118 TCCAAGGCTGCACACAGCATGGG - Intergenic
944575856 2:201090469-201090491 TGCACCACTGCACCCAGCCTGGG - Intergenic
944871572 2:203917598-203917620 TGCACCACTGCACCCAGCCTAGG - Intergenic
947669246 2:231926143-231926165 CCCACGACAGCACCCACCTTCGG + Exonic
948335947 2:237207185-237207207 AGCACGGCTGAACCCACCCAGGG + Intergenic
1169227116 20:3863842-3863864 TCCATGGCTGCTCCCACTCATGG + Intronic
1172117483 20:32581504-32581526 TCTCTGGCTGCCCCCACCCTGGG - Intronic
1173250644 20:41362632-41362654 CCGACGGCTGCACCGACTCTGGG - Exonic
1176053179 20:63131256-63131278 CCCTGAGCTGCACCCACCCTGGG - Intergenic
1179627593 21:42657491-42657513 TCCTCAGCTGCCCCTACCCTGGG + Intronic
1180597721 22:16989710-16989732 TCCCAGGCTGCACCCTCCCTGGG - Intronic
1180786473 22:18550506-18550528 TCCTGGGCTGCTCCCACCATAGG - Intergenic
1181131754 22:20736229-20736251 TCCTGGGCTGCTCCCACCATAGG - Intronic
1181243393 22:21490059-21490081 TCCTGGGCTGCTCCCACCATAGG - Intergenic
1181802479 22:25356666-25356688 TGCAGGGCTGCACCCAGCATAGG + Intronic
1182275046 22:29182759-29182781 TGCACCACTGCACCCAGCCTGGG - Intergenic
1183360204 22:37379391-37379413 TGCATGGCTGCACCCCTCCTGGG - Intronic
1184478860 22:44735917-44735939 TCCAGGGCTACACCAAGCCTGGG - Intronic
1184640728 22:45868609-45868631 GTCACGGCTGCACCTTCCCTGGG + Intergenic
950550398 3:13662645-13662667 CCCACGGCTGTGCCCACGCTAGG + Intergenic
951692714 3:25413621-25413643 TCCACATCTTCACCAACCCTTGG + Intronic
952535253 3:34302611-34302633 TCCACAGCCCCACCCACACTTGG + Intergenic
954049876 3:47966111-47966133 TACACCGCTGCATTCACCCTGGG - Intronic
954370669 3:50168244-50168266 ACCCCAGCTGCACCCTCCCTGGG - Intronic
955929966 3:64046602-64046624 TCCCTGCCTGCTCCCACCCTGGG - Intergenic
961761580 3:129173087-129173109 TCCATGGCTTCAACCAACCTTGG + Intronic
961887521 3:130106132-130106154 TCCACAGCTGGTCCCATCCTAGG + Intronic
963203298 3:142606604-142606626 TCCCCAGCTGCCCCTACCCTAGG + Intronic
963443659 3:145374252-145374274 TCCACCGCTCCCCCAACCCTGGG + Intergenic
966166663 3:177027037-177027059 TGCACAGCTGCATCCATCCTGGG - Intronic
966411943 3:179653552-179653574 TCCTCGGCTGCAGCAGCCCTGGG - Intronic
967099077 3:186201115-186201137 TCCACTGCTCCACCCTCCCCAGG + Intronic
968115643 3:196087281-196087303 TGCACCACTGCACCCAGCCTGGG + Intergenic
968115703 3:196087788-196087810 TGCATTGCTGCACCCAGCCTGGG + Intergenic
969375534 4:6761041-6761063 TCCATGGCTCCACCCAGGCTGGG + Intergenic
982484806 4:155953898-155953920 TCCTCGGCTCCTCCCAGCCTGGG + Exonic
985214316 4:187634377-187634399 TCCATGCCTGCAGCTACCCTGGG + Intergenic
985510885 5:313124-313146 TCCCAGGCTGTCCCCACCCTTGG + Intronic
985532581 5:442921-442943 TCCAGGACTGCGCCCGCCCTGGG + Exonic
986210222 5:5664959-5664981 TCCACTGGTGGACCCAGCCTCGG - Intergenic
992856848 5:80870662-80870684 CCCACTTCAGCACCCACCCTTGG + Intronic
993288932 5:86039738-86039760 TGCACCACTGCACCCAGCCTGGG + Intergenic
993983012 5:94565383-94565405 TGCACCACTGCACCCAGCCTGGG - Intronic
998030720 5:138865283-138865305 TTCTAGGCTCCACCCACCCTTGG + Intronic
1000352173 5:160360530-160360552 TGCAAGGCTGGCCCCACCCTAGG - Intronic
1000370906 5:160535713-160535735 TCCCAGGCAGCCCCCACCCTGGG + Intergenic
1001334185 5:170783951-170783973 TCCAGGCCTGCCCCCTCCCTCGG - Intronic
1001483233 5:172102593-172102615 TCCAGGCCTCCACACACCCTTGG - Intronic
1002196220 5:177503055-177503077 ACCTCAGCTGCACACACCCTTGG - Intronic
1004818415 6:19337586-19337608 ACCACTGCTACACCCAGCCTGGG - Intergenic
1007497709 6:42272373-42272395 TTCACTGCTGCAGCCATCCTTGG - Intronic
1010442706 6:75916520-75916542 TGCATAGCTTCACCCACCCTCGG + Exonic
1014129046 6:117810593-117810615 TCCACGGCTGCCCCTTCCCCCGG + Intergenic
1014730990 6:125031152-125031174 CCCTCAGCTGCACACACCCTGGG + Intronic
1015603457 6:134932969-134932991 ACCAGGGCCTCACCCACCCTGGG + Exonic
1017116263 6:150979781-150979803 TGCACCACTGCACCCAGCCTAGG + Intronic
1020068840 7:5212191-5212213 TTCACGGCTGCACCACCCCCAGG - Intronic
1021061328 7:16116616-16116638 TGCACCACTGCACCCAGCCTGGG + Intronic
1024213281 7:47225819-47225841 TCCACGGCCACACCCACCAGGGG - Intergenic
1025888418 7:65621425-65621447 TGCACCACTGCACCCAGCCTGGG + Intergenic
1026656391 7:72260417-72260439 TCCACGGGTGCACAGACCCCAGG + Intronic
1029180863 7:98700778-98700800 TCCCTGGCTGCACCCATCCCTGG + Intergenic
1029181574 7:98705622-98705644 TCCCTGGCTGCACCCACTCCAGG + Intergenic
1031854021 7:126900551-126900573 TGCACCACTGCACCCAGCCTGGG - Intronic
1032080572 7:128856589-128856611 TGCCCGGGTGCACACACCCTCGG + Exonic
1032084365 7:128876301-128876323 TTCACAGCCACACCCACCCTGGG - Intronic
1035159289 7:156939355-156939377 TGCACAGCTGCTGCCACCCTGGG + Intergenic
1035373087 7:158391710-158391732 TGCAGGGCTGCATCCAGCCTGGG - Intronic
1041391457 8:57350705-57350727 CCCACTTCTGCACACACCCTAGG + Intergenic
1044704924 8:94999458-94999480 TGCACCACTGCACCCAGCCTGGG - Intronic
1048355651 8:133652114-133652136 TGCATGGCTGCAAGCACCCTGGG - Intergenic
1049363463 8:142225215-142225237 TCCACGGCTTCGCCTGCCCTTGG + Intronic
1049452619 8:142670156-142670178 CCCACGCCTCCCCCCACCCTGGG - Intronic
1051106622 9:13587846-13587868 TCCTCCGCTCCTCCCACCCTGGG + Intergenic
1051597041 9:18834638-18834660 ACCACTACTGCTCCCACCCTAGG + Intronic
1056148351 9:83758079-83758101 TCCACAACTGCACCAACGCTAGG - Intronic
1058917955 9:109585853-109585875 ACCACGGCTGCAGACACACTGGG - Intergenic
1060884127 9:127138677-127138699 TCCACATCTCCACACACCCTGGG + Intronic
1060945465 9:127567564-127567586 TCCAGGGCCGCACCCATGCTGGG - Intronic
1061313930 9:129782316-129782338 CGCACTACTGCACCCACCCTGGG - Intergenic
1062567567 9:137170084-137170106 CCCACGGCTGGATCCACGCTTGG + Intronic
1192669840 X:73128003-73128025 TCCACGGCTTCCGCCACCCCAGG - Exonic
1193821451 X:86170612-86170634 TCCATAGCTGCTGCCACCCTAGG + Intronic
1200141879 X:153906559-153906581 TCAACAGCTGCACCAACCCCTGG + Exonic
1200166067 X:154036202-154036224 TCCTCAACTGCCCCCACCCTGGG - Intronic
1201247628 Y:12021503-12021525 TGCACCACTGCACCCAGCCTGGG - Intergenic
1201598464 Y:15699358-15699380 TGCACGACTGCACTCAGCCTGGG + Intergenic
1202044992 Y:20728928-20728950 TACACCACTGCACCCAGCCTAGG - Intergenic