ID: 1103631063

View in Genome Browser
Species Human (GRCh38)
Location 12:122261434-122261456
Sequence CTCGTCTATCTTCACTGCAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103631063 Original CRISPR CTCGTCTATCTTCACTGCAA AGG Exonic
900326830 1:2112384-2112406 CTCGTTCATCCTCATTGCAATGG - Intronic
903003798 1:20285058-20285080 CTCTTCTACCTGCCCTGCAAAGG - Intergenic
904369347 1:30038611-30038633 CTTTTCTATCTTCAATGCCAGGG + Intergenic
904994039 1:34617146-34617168 TTCGTCTTCCTTCACTGTAAAGG + Intergenic
906384446 1:45355331-45355353 CTCAGCTACCTTCACTTCAAAGG - Exonic
913420465 1:118661776-118661798 CTCGTCTATCTTTAATTCATTGG - Intergenic
915825425 1:159070845-159070867 CTCTTCTATGTTCACAGCATCGG + Intronic
916901654 1:169231079-169231101 CTAGTATATCTTCCTTGCAAAGG + Intronic
918991950 1:191708211-191708233 CTGGTGTAACTTCACTGAAAAGG - Intergenic
923607157 1:235454383-235454405 CTCCTTTATCATCACTACAAAGG + Intronic
924790648 1:247244391-247244413 CTTGTCTTTCTTTACTGAAATGG + Intergenic
1063826891 10:9908368-9908390 CAGGTCTTTCTTCACAGCAATGG - Intergenic
1066239643 10:33521158-33521180 CTTTTCTTTCTTTACTGCAAGGG - Intergenic
1073204257 10:101760471-101760493 CTCGTCTGTCTTCTCTGTGAAGG + Intergenic
1074823947 10:117201462-117201484 CTGGTGCATCTTCAGTGCAAAGG - Intronic
1074839611 10:117336571-117336593 ATCTTCTATCTTCTCTGCCACGG - Intronic
1074874020 10:117600526-117600548 CTAGTCTATGGTCACAGCAAGGG - Intergenic
1074938979 10:118216277-118216299 CTTGTTCATCTTGACTGCAAGGG - Intergenic
1075987997 10:126804736-126804758 CTCCACTATCTTCACATCAAAGG + Intergenic
1078133709 11:8635112-8635134 CTTCTCTTTCTGCACTGCAATGG - Intronic
1095320584 12:40820721-40820743 CCCGTGAATCTTCTCTGCAAGGG - Intronic
1102297041 12:111745124-111745146 CTCCTGTATCTTCACTGCCTGGG - Intronic
1103631063 12:122261434-122261456 CTCGTCTATCTTCACTGCAAAGG + Exonic
1104940669 12:132393126-132393148 CTGGACCATCTTCACTGCGATGG + Intergenic
1106177034 13:27340471-27340493 CTCGTATGTATTCAGTGCAACGG - Intergenic
1108204912 13:48078577-48078599 CTCATCTAACTTCTCTGCCATGG + Intronic
1114996526 14:28359543-28359565 CTCTTCTACCTTTTCTGCAAAGG + Intergenic
1115170515 14:30500340-30500362 CACTTTTATCTTCACTGTAAGGG - Intergenic
1115213224 14:30989273-30989295 TTCCTCTATCTTCACAGCAATGG + Intronic
1119975692 14:79021390-79021412 CTCCTCTCCCTTCACTGCAAAGG - Intronic
1125759698 15:42088210-42088232 CTCAGCTATCTGCACTGTAAGGG + Intronic
1126441629 15:48695938-48695960 CTCCCCTAGCCTCACTGCAAAGG - Intergenic
1129446310 15:75621043-75621065 CTCTTCCATCTTCCCTACAAAGG + Exonic
1131517886 15:93091306-93091328 CTTGGCTTTCTTTACTGCAAAGG + Intergenic
1131539528 15:93264672-93264694 CTGCTCTATCTTCATGGCAAGGG + Intergenic
1133357209 16:5145310-5145332 CTCTTCTACATTCACTGCCAGGG - Intergenic
1135265420 16:21021519-21021541 CTCTACTATCTGCACTCCAAAGG + Intronic
1140320468 16:73946418-73946440 CTCTTCTGGGTTCACTGCAATGG - Intergenic
1144597150 17:16580189-16580211 CTGGTCTGTCTTTACTGTAATGG - Intergenic
1149016073 17:51909874-51909896 CTTCTCTATTTTCACTGCACTGG + Intronic
1153179923 18:2421441-2421463 CTCGTCAGTCTTCACTGCAAAGG + Intergenic
1154530905 18:15344262-15344284 TTCCTCTATCTCAACTGCAAGGG + Intergenic
1156718957 18:40046546-40046568 CTGGTCTCTCATCAATGCAAAGG + Intergenic
1165392125 19:35544941-35544963 CTCGTCCATCTTCGATGCTAAGG + Exonic
1165793366 19:38505325-38505347 CTCGTCTATGTTCTCTCCATAGG - Exonic
1168178644 19:54644345-54644367 CTCGTCCATCTGCACAGCCAGGG + Intronic
925224602 2:2172423-2172445 CTCATCTAATTTAACTGCAAAGG + Intronic
929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG + Intronic
931577565 2:63735249-63735271 TTGGTCTCTCTTAACTGCAAGGG - Intronic
931601433 2:64007279-64007301 CTCGTCTGTCTTCTCTCCCACGG - Intronic
932469051 2:71942116-71942138 GTCGCCCATCTTCACTGCTAGGG + Intergenic
932798700 2:74720439-74720461 TTCCTCTATCTCAACTGCAACGG - Intergenic
937884289 2:126889480-126889502 CACGTCTATCTCCATTTCAAAGG - Intergenic
938609805 2:132935766-132935788 CTACTCCATCTTCACTGCCAAGG - Intronic
939693957 2:145300681-145300703 TTCTTCTAGCTTCACTGGAAGGG + Intergenic
941074471 2:160991273-160991295 GTTGTCTACCTTCACTCCAAAGG - Intergenic
947595718 2:231410424-231410446 CTTGGCTACCTTCACTGCACAGG + Intergenic
948239439 2:236417279-236417301 CTCGTCTTGCTTGACTGCACAGG + Intronic
1176766508 21:13024200-13024222 TTCCTCTATCTCAACTGCAAGGG - Intergenic
1179394007 21:41021486-41021508 CTGGTCTATCTCCACCTCAATGG + Intergenic
1180120069 21:45739945-45739967 CTCGTCTAATTTCACAGCCAAGG + Intronic
1180869874 22:19140059-19140081 CTCCTCTTTCCTGACTGCAAAGG - Intronic
950904663 3:16527104-16527126 CTCCTCCTTCTTCTCTGCAATGG - Intergenic
955966193 3:64391693-64391715 CTCCTCTATTTTCACTCCCAGGG + Intronic
960809118 3:121611621-121611643 TTCCTCTATCTCAACTGCAAGGG + Intronic
962580225 3:136791354-136791376 CTCCTCTGTCTACCCTGCAAGGG + Intergenic
962815864 3:138999351-138999373 GTCCTGTATCTTTACTGCAATGG - Intergenic
965600656 3:170451310-170451332 CTCCACTGTTTTCACTGCAATGG + Intronic
966771891 3:183511439-183511461 TTCCTCTATCTCAACTGCAAGGG + Intronic
969633510 4:8352238-8352260 CTCGTCTATCTCCTAGGCAAGGG + Intergenic
983725161 4:170912906-170912928 CTCTTCCATCTTGACTGCAGTGG + Intergenic
986171504 5:5318264-5318286 CTCACCTTTCTTCTCTGCAATGG - Exonic
990741759 5:58919602-58919624 CTAGTCATTCTTCATTGCAAGGG + Intergenic
992116145 5:73540269-73540291 CTCTTCTCTTTCCACTGCAAAGG - Intergenic
995204649 5:109465776-109465798 ATAGTCCATCTTCACTCCAATGG - Intergenic
996760900 5:126984755-126984777 CTCCTCTTTCTTCAGTGCATAGG - Intronic
997973143 5:138420764-138420786 CTCGTTCAACTCCACTGCAAAGG + Exonic
998057760 5:139093515-139093537 CTCTTCTATCCTCAGCGCAATGG - Intronic
999918373 5:156289039-156289061 CTCCTCTATTTCCTCTGCAATGG + Intronic
1000592987 5:163181300-163181322 CTCATCCATCTTCTCTGCATTGG + Intergenic
1001484739 5:172111350-172111372 CTCGTCTCTCTTCTCAGGAAGGG - Intronic
1004698548 6:18056958-18056980 CTGCTCTGTCTTCACTGCACAGG + Intergenic
1005150140 6:22739551-22739573 ATTGTCTGTCTTCACTGTAAGGG - Intergenic
1015371316 6:132456804-132456826 CTGGTCTACCTGCACTGCAGAGG - Exonic
1020378734 7:7518026-7518048 CACATCTGGCTTCACTGCAAAGG - Intronic
1020883917 7:13798894-13798916 CTCGTCTATCTTCTTAGCGATGG - Intergenic
1023869050 7:44252865-44252887 CTCGTCTTCCTCCACTCCAAGGG + Intronic
1024285077 7:47750190-47750212 CTTGTCTATATTCAGTGAAATGG + Intronic
1025873183 7:65454254-65454276 CTTTTCTATCTGCAGTGCAAAGG + Intergenic
1030576434 7:111292010-111292032 CTGTTCTTTCTTCACTGCAGGGG - Intronic
1040676846 8:49760694-49760716 CTCATCTCTTTTCTCTGCAAGGG + Intergenic
1042956882 8:74260414-74260436 CTGGTTTATCTGCTCTGCAAAGG + Intronic
1044045592 8:87427773-87427795 CTCGTCTGTCTTCAGTGCATTGG + Intronic
1044067425 8:87716177-87716199 CTTGTCTATTTTCACTGTAGAGG - Intergenic
1052911570 9:33887301-33887323 ATCCTCTAACTTCACAGCAAGGG + Intronic
1053875670 9:42542054-42542076 CTCTTCTATCTCAACTGAAAAGG - Intergenic
1053896979 9:42752575-42752597 CTCTTCTATCTCAACTGAAAAGG + Intergenic
1054236029 9:62559670-62559692 CTCTTCTATCTCAACTGAAAAGG + Intergenic
1186704110 X:12123931-12123953 CTTGTATATCTTAAGTGCAATGG - Intergenic
1187437233 X:19283751-19283773 CTGGCCTTACTTCACTGCAAGGG + Intergenic
1197005148 X:121487496-121487518 CTCAGCTTTCTTTACTGCAAGGG + Intergenic
1202364686 Y:24150112-24150134 CTAGTCTATCATTATTGCAATGG + Intergenic
1202369709 Y:24188442-24188464 CTAGTCTATGTCCACTGCAGTGG - Intergenic
1202501076 Y:25481675-25481697 CTAGTCTATGTCCACTGCAGTGG + Intergenic
1202506095 Y:25520010-25520032 CTAGTCTATCATTATTGCAATGG - Intergenic