ID: 1103635583

View in Genome Browser
Species Human (GRCh38)
Location 12:122302472-122302494
Sequence GGGGACCCATTGGGAAAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103635583_1103635594 19 Left 1103635583 12:122302472-122302494 CCAATTTTTCCCAATGGGTCCCC 0: 1
1: 0
2: 2
3: 22
4: 166
Right 1103635594 12:122302514-122302536 CCCACTCTCTTTTCTTTTTGCGG 0: 1
1: 2
2: 4
3: 61
4: 668

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103635583 Original CRISPR GGGGACCCATTGGGAAAAAT TGG (reversed) Intronic
900346587 1:2213303-2213325 GGGGACCCATTGAGGACACTGGG - Intergenic
903015739 1:20360803-20360825 GGGCTCCTAATGGGAAAAATTGG + Intergenic
903365471 1:22802974-22802996 GGGGACCCACTGGGGAGACTAGG + Intronic
907964233 1:59313793-59313815 GGGGACTCAGTGGGAAAGAGCGG + Intronic
909090055 1:71214570-71214592 GGGGACTCAGGGGGAAAAGTGGG - Intergenic
915260410 1:154672974-154672996 GAGGACCGACTGAGAAAAATCGG - Intergenic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
924188520 1:241522287-241522309 GGGGAAACATTAGGAAAAAATGG + Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1063059622 10:2537876-2537898 GGGGAACCTGTGGGATAAATAGG - Intergenic
1063669011 10:8084635-8084657 GGGCATCCATTGACAAAAATGGG - Intergenic
1064841239 10:19594821-19594843 GGGGACTCAAGGGGAAAGATTGG + Intronic
1066790129 10:39053127-39053149 GGGAGCCCATTGAGAAATATGGG + Intergenic
1067485093 10:46641217-46641239 GGGTAGCCATTTGGAAAAAAGGG - Intergenic
1067609663 10:47700440-47700462 GGGTAGCCATTTGGAAAAAAGGG + Intergenic
1068064020 10:52105973-52105995 GGGGACTCAGTGGGAAGAGTGGG - Intronic
1068574664 10:58671588-58671610 GGGTTCCAATTGGGACAAATTGG + Intronic
1071625255 10:87162052-87162074 GGGTAGCCATTTGGAAAAAAGGG + Intronic
1072084983 10:92070020-92070042 TGGGACACATTTGGAAAAAAAGG + Intronic
1076437274 10:130454778-130454800 GAGGTCCCAGTGGGGAAAATGGG + Intergenic
1077590300 11:3485846-3485868 GGGGACCATTTGGGAAAGAAGGG - Intergenic
1078359554 11:10657835-10657857 GGTTCCCCATTGGTAAAAATGGG - Intronic
1078700748 11:13679941-13679963 GGGGAAGTATTGGGGAAAATAGG + Intronic
1079002199 11:16767379-16767401 GGGGACCCCTTGGTCAAAAGGGG + Intergenic
1079876439 11:25863325-25863347 TGGGACCAATTAGAAAAAATTGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081596729 11:44464358-44464380 AGGGGCCCAGTGGGAAAAAACGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1084246019 11:67857627-67857649 GGGGACCATTTGGGAAAGAAGGG - Intergenic
1084325208 11:68396223-68396245 GGAGACACATTTGGAACAATGGG + Intronic
1084826656 11:71736873-71736895 GGGGACCATTTGGGAAAGAAGGG + Intergenic
1085039698 11:73319730-73319752 GGGGACACACGGGGAAAACTTGG + Intronic
1089328892 11:117676509-117676531 CTGGACCCTTTGGGAAAAAGAGG - Intronic
1091705509 12:2690729-2690751 GGGCACCCATGGGGAACAAGTGG - Intronic
1093431795 12:19093152-19093174 GGGGATCTCTTGAGAAAAATAGG + Intergenic
1093506461 12:19872228-19872250 GGGGACTCAGTGGGGAAAAAGGG + Intergenic
1093616465 12:21231454-21231476 GAGGAGTCCTTGGGAAAAATAGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1095610387 12:44121169-44121191 AGGGACCCAGTGGGAGAAAATGG - Intronic
1098829260 12:75339917-75339939 GGGGACTCATGGGGAAGAGTGGG - Intronic
1099029526 12:77508117-77508139 GTGGAGCAATTGGGAAAATTGGG - Intergenic
1101318257 12:103649701-103649723 TGGGATGCCTTGGGAAAAATGGG - Intronic
1103224772 12:119277265-119277287 GGGAACCAAGAGGGAAAAATCGG + Intergenic
1103635583 12:122302472-122302494 GGGGACCCATTGGGAAAAATTGG - Intronic
1103972194 12:124679268-124679290 GGTGTCCCCTTGGGCAAAATGGG + Intergenic
1104406736 12:128524222-128524244 GGGTACCCTTTGGAAAAAATTGG + Intronic
1110391341 13:74978268-74978290 GTGGACACAGTGTGAAAAATTGG + Intergenic
1113844130 13:113376166-113376188 GGGGACTGATTGGGACTAATGGG + Intergenic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1120141777 14:80937846-80937868 GGGGACCTATTGGGATAATCTGG - Intronic
1120801080 14:88689521-88689543 TGAGTCCAATTGGGAAAAATGGG - Intronic
1121658340 14:95615273-95615295 GTTGAGCCATTTGGAAAAATGGG - Intergenic
1127744403 15:61951649-61951671 GGGGACCCATTTTGAAAAGCTGG - Intronic
1128289817 15:66469420-66469442 GGAGACCCATAAGGAAAAACAGG + Intronic
1128793122 15:70447771-70447793 GGGAACCCAGTTGGAAGAATAGG + Intergenic
1130143012 15:81247573-81247595 GGGAACCAATGGGGAAAACTGGG - Intronic
1130585074 15:85174308-85174330 GGGGAGCTAGTGGGAAACATGGG - Intergenic
1131409310 15:92192985-92193007 CCGGACCCATTGGGAAAAGTGGG - Intergenic
1131533257 15:93212763-93212785 GGGGACCCATTGGGCGTACTAGG + Intergenic
1132655911 16:1041580-1041602 GGGGACCCTTGGGGAAAAGTGGG - Intergenic
1133355668 16:5134920-5134942 GGGGACCATTTGGGAAAGAAGGG - Intergenic
1135824401 16:25713834-25713856 GGGGACACATTTGCAAATATGGG + Intronic
1137908828 16:52354564-52354586 TGGGAACAATTGGGAAATATAGG + Intergenic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1138016753 16:53435052-53435074 GGGGTCCCGTTGAGGAAAATGGG + Intronic
1140606909 16:76549832-76549854 GGAGACCTAATGTGAAAAATTGG + Intronic
1143652011 17:8269058-8269080 GGGGACCCATTGGGATTCAGAGG - Exonic
1143988836 17:10939240-10939262 GGGGGCTCCTTGGAAAAAATTGG + Intergenic
1146212190 17:30951322-30951344 GGGAAACCATTGGGAAAAAAAGG - Intronic
1146372036 17:32270682-32270704 TGGGACCCATGGGGAAGAATCGG - Intronic
1148003007 17:44401182-44401204 GGGGACCCCATTGCAAAAATTGG - Exonic
1150827553 17:68490279-68490301 AGGGCCCCAATGGGATAAATGGG - Intergenic
1152944716 17:83192624-83192646 GGGGACCCGTGGGCAAAACTTGG + Intergenic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1155620353 18:27771072-27771094 GGAGACTCATTAGGAAACATGGG - Intergenic
1165444670 19:35850307-35850329 GGGTTCCCATGGGGAAAATTAGG + Intronic
1165862627 19:38917267-38917289 GGTGACCCATTGTAAAAAACTGG - Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1167156645 19:47742965-47742987 GGGGACCCCATGGAAAAGATGGG + Exonic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168123585 19:54270266-54270288 GGGGACTCACAGGGAACAATGGG - Intronic
1168178884 19:54646063-54646085 GGGGACCCAGGGGGAGCAATGGG + Intronic
925733514 2:6941027-6941049 AGGCACCCATAGGGAGAAATGGG - Exonic
931143236 2:59486802-59486824 GGGTAGCGATAGGGAAAAATAGG - Intergenic
938901492 2:135802008-135802030 GGGGACCCATTGTGATCATTTGG + Intronic
940552222 2:155174157-155174179 GGGGACTCAGTGGGAAAAGGTGG - Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942887484 2:180944511-180944533 GGGGACCACTTTGGAAAAAGTGG + Intergenic
943984443 2:194602301-194602323 GGGGTCCCCTTGGGCAAAATGGG + Intergenic
947046967 2:225998702-225998724 GGGGACTCAGGGGGAAAAAGTGG - Intergenic
1169325301 20:4670845-4670867 GGGGATTCAATGGTAAAAATAGG - Intergenic
1174418405 20:50383203-50383225 GGGGCCCCACTGGGAAAATTTGG + Intergenic
1175273049 20:57748493-57748515 GGGGACACTTTGGAAGAAATCGG - Intergenic
1178765085 21:35442892-35442914 GGCCACCCATGAGGAAAAATAGG - Intronic
1181745786 22:24953945-24953967 GGGGACCCTCTGGGCAAAATGGG + Intronic
1183090857 22:35520781-35520803 GGGTTCCCATAGGGAATAATGGG + Intergenic
950394813 3:12726000-12726022 GGGGAGCAGTGGGGAAAAATGGG + Intergenic
950914621 3:16631981-16632003 GGGCACCCATTGGGAAAAGGGGG + Intronic
952298700 3:32085165-32085187 AGGGACCCAGTGGGAATCATGGG - Intergenic
953701723 3:45201240-45201262 GGTGACCCATTGGGAAATCTAGG - Intergenic
957060349 3:75476352-75476374 GGGGACCATTTGGGAAAGAAGGG - Intergenic
957726247 3:84071137-84071159 GGGGATTCCTTGGGAAAAATAGG - Intergenic
959855386 3:111149050-111149072 GTTATCCCATTGGGAAAAATGGG - Intronic
960045270 3:113191382-113191404 GGGGACTCATGGGAAAAAGTGGG - Intergenic
961118259 3:124350201-124350223 GAGGAACAGTTGGGAAAAATGGG - Intronic
961293043 3:125863058-125863080 GGGGACCATTTGGGAAAGAAGGG + Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
961646165 3:128393891-128393913 GGGGACCCATTTGGTCACATAGG + Intronic
961705067 3:128778348-128778370 GGGGAGACATTAGGAAAAAAAGG - Intronic
962068197 3:132005701-132005723 GAGGACCCACTGGGAAACTTGGG - Intronic
962131517 3:132683063-132683085 GGGGAGCCATTGGGCAATAAAGG - Intronic
962522442 3:136209869-136209891 GGGAACTCAGTAGGAAAAATAGG + Intergenic
962657819 3:137566465-137566487 GACGTCCCATTGGGAAAAAATGG - Intergenic
962952509 3:140232433-140232455 GGGGACCCCTGGGGAGAGATGGG - Intronic
964223851 3:154374480-154374502 GGGGACCCTTGGGGAATATTAGG - Intronic
966496704 3:180589917-180589939 GGTGACCCAGTGGGGAAAATTGG - Intergenic
967648896 3:191961456-191961478 GGGGTCCCCTTGGCCAAAATGGG - Intergenic
968962541 4:3752849-3752871 GGGGAACAGTTGGGAAAAAGAGG + Intergenic
969004236 4:4006428-4006450 GGGGACCATTTGGGAAAGAAGGG - Intergenic
969809668 4:9638286-9638308 GGGGACCATTTGGGAAAGAAGGG + Intergenic
970619616 4:17803827-17803849 GGGGACACAATGGGAACAATGGG + Exonic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
973100253 4:46258788-46258810 GGGGATTCCTTGAGAAAAATAGG + Intronic
974806191 4:66883299-66883321 GGGGACACAGTGGGAGAAATTGG - Intergenic
977559082 4:98514491-98514513 GGGGACCCAATGGGAAAACTGGG - Intronic
978373205 4:108050022-108050044 GGGGCCGCATTGGGCATAATTGG - Intronic
980402930 4:132316063-132316085 GGGGACCCCTTGGGAAAGAGGGG + Intergenic
982628507 4:157800857-157800879 GGGGACTCAGTGGGAGAATTGGG - Intergenic
983801358 4:171934093-171934115 GGAGTCCCTTTGGGATAAATAGG + Intronic
988568472 5:32340847-32340869 TGAGACCCTTTGGGAAAAACAGG - Intergenic
988853903 5:35207827-35207849 GAGGACGCATTGGCAAGAATAGG + Intronic
996342633 5:122455371-122455393 GGGGTCCCATAGGCAAAATTAGG - Intronic
996374534 5:122790519-122790541 GACCACTCATTGGGAAAAATGGG - Intronic
997105488 5:131014308-131014330 GGGGACTCAGTGGGAAAGAGGGG - Intergenic
998285233 5:140853432-140853454 GGAGACCTATTAGGCAAAATAGG - Intronic
1000551262 5:162668013-162668035 TGTGAGCCATTGGGAAAATTGGG - Intergenic
1004097034 6:12566592-12566614 GGGGACTCAGAGGGAAGAATGGG + Intergenic
1006512467 6:34529064-34529086 GGAGACCCATGGGCAAAAAGGGG + Intronic
1007642184 6:43350334-43350356 GGGGTCCCATTGGCCAAATTTGG + Intronic
1013918124 6:115366586-115366608 GGAGACCCAGGGGGAAAACTTGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1020181038 7:5922568-5922590 GGGGACCTAGTGGGAAAAGCTGG - Intronic
1020301895 7:6802320-6802342 GGGGACCTAGTGGGAAAAGCTGG + Intronic
1021347939 7:19550484-19550506 GGGGACCCAGTGGCAAAAGGGGG - Intergenic
1026483983 7:70801939-70801961 GGGGACTCAGTGGGGAAGATTGG - Intergenic
1027525408 7:79262916-79262938 TGGTAACCATAGGGAAAAATAGG - Intronic
1027566020 7:79795629-79795651 GGGGACCCCTTGGCCAAGATGGG + Intergenic
1028450611 7:90977962-90977984 GGGGACAAACTAGGAAAAATAGG + Intronic
1028496826 7:91470817-91470839 GGGGACTCAGAGGGAAGAATGGG - Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030541474 7:110835884-110835906 AGTGACCCATTGGGAAAAATGGG - Intronic
1033784456 7:144714068-144714090 GGGGACACCGTGGGAAAAGTAGG - Intronic
1035453700 7:158996002-158996024 GGGGACACGTCGGGAAATATGGG - Intergenic
1036371696 8:8168028-8168050 GGGGACCATTTGGGAAAGAAGGG + Intergenic
1036570965 8:9979634-9979656 GGGAACCCATTGGGAGAAGTAGG + Intergenic
1036879207 8:12497616-12497638 GGGGACCATTTGGGAAAGAAGGG - Intergenic
1037695096 8:21216692-21216714 GGAAACCCACTGGGAAAAATGGG - Intergenic
1037759189 8:21730563-21730585 GAGGAGCCACTGGGAAAATTAGG - Intronic
1041562674 8:59237745-59237767 GGAGACACACTGGGTAAAATGGG - Intergenic
1043348958 8:79336074-79336096 GGGGACCCAGGGGGAAAGAGTGG + Intergenic
1043614493 8:82108707-82108729 GGGGAGCCTGTGGTAAAAATAGG + Intergenic
1044957892 8:97500554-97500576 GGGGACTCAGTGGGAAGGATGGG - Intergenic
1045571451 8:103372114-103372136 GGGGACCCCTTGGGAAGGGTGGG + Intronic
1048278221 8:133083890-133083912 GGGGAGCCAGGGGGAAAACTGGG - Intronic
1050675581 9:8049119-8049141 GGGGACTCATTGGGGAAGAGGGG + Intergenic
1054778633 9:69145878-69145900 GGGGACCCATATAGAAAAAAGGG + Intronic
1055156786 9:73072561-73072583 GGGGACTCAGGGGGAAAAGTTGG + Intronic
1055564854 9:77558000-77558022 AGGGTCCCATTTGTAAAAATGGG - Intronic
1055859311 9:80729870-80729892 GGGATCCCTTTGGGAAAAATGGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058576922 9:106413881-106413903 GTGGACCCACTGTGAAAAAGTGG + Intergenic
1058895511 9:109397457-109397479 GTGGGCTCTTTGGGAAAAATGGG - Intronic
1060038931 9:120283168-120283190 TGGGACTCATTGGAAAAATTTGG - Intergenic
1060656777 9:125377333-125377355 GTGGACATATTGAGAAAAATTGG - Intergenic
1187528891 X:20078925-20078947 GGGGACCCATTGGGTAGGCTAGG + Intronic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1191901109 X:66041355-66041377 GAGGACCCGGTGGGAAAAAATGG - Intergenic
1192684885 X:73293177-73293199 GGGGACCCAGAGAGAAGAATGGG + Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1195105026 X:101595228-101595250 GGGGGCCTGTTGGGAAAACTAGG + Intergenic
1197744255 X:129920370-129920392 GGGAACCCATTGGGTAGTATGGG + Intronic
1198090925 X:133329110-133329132 GAGGACACAGTGGGAAAAACAGG + Intronic
1199008367 X:142729567-142729589 TAGGTCCCATTGGGAAAAGTTGG - Intergenic
1199059495 X:143337732-143337754 TGGCCCCCATTGGTAAAAATTGG + Intergenic
1200009531 X:153110661-153110683 AAGCACCCAGTGGGAAAAATGGG + Intergenic
1200030069 X:153289261-153289283 AAGCACCCAGTGGGAAAAATGGG - Intergenic
1200829329 Y:7675612-7675634 GGGAACAAATTGGAAAAAATAGG - Intergenic
1201496585 Y:14595923-14595945 GAGGACCGACTGAGAAAAATCGG + Intronic