ID: 1103636358

View in Genome Browser
Species Human (GRCh38)
Location 12:122309827-122309849
Sequence CTTGCAACGCTGAAAGCTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 119}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103636355_1103636358 8 Left 1103636355 12:122309796-122309818 CCCAGCTCCTCAGCAAGTTTAAC 0: 1
1: 0
2: 3
3: 7
4: 188
Right 1103636358 12:122309827-122309849 CTTGCAACGCTGAAAGCTGCTGG 0: 1
1: 1
2: 0
3: 8
4: 119
1103636356_1103636358 7 Left 1103636356 12:122309797-122309819 CCAGCTCCTCAGCAAGTTTAACG 0: 1
1: 0
2: 1
3: 1
4: 67
Right 1103636358 12:122309827-122309849 CTTGCAACGCTGAAAGCTGCTGG 0: 1
1: 1
2: 0
3: 8
4: 119
1103636357_1103636358 1 Left 1103636357 12:122309803-122309825 CCTCAGCAAGTTTAACGTTCTCT 0: 1
1: 0
2: 2
3: 8
4: 112
Right 1103636358 12:122309827-122309849 CTTGCAACGCTGAAAGCTGCTGG 0: 1
1: 1
2: 0
3: 8
4: 119
1103636354_1103636358 9 Left 1103636354 12:122309795-122309817 CCCCAGCTCCTCAGCAAGTTTAA 0: 1
1: 0
2: 1
3: 20
4: 229
Right 1103636358 12:122309827-122309849 CTTGCAACGCTGAAAGCTGCTGG 0: 1
1: 1
2: 0
3: 8
4: 119
1103636353_1103636358 18 Left 1103636353 12:122309786-122309808 CCTGCTTCTCCCCAGCTCCTCAG 0: 2
1: 1
2: 13
3: 94
4: 785
Right 1103636358 12:122309827-122309849 CTTGCAACGCTGAAAGCTGCTGG 0: 1
1: 1
2: 0
3: 8
4: 119
1103636352_1103636358 19 Left 1103636352 12:122309785-122309807 CCCTGCTTCTCCCCAGCTCCTCA 0: 2
1: 0
2: 8
3: 88
4: 837
Right 1103636358 12:122309827-122309849 CTTGCAACGCTGAAAGCTGCTGG 0: 1
1: 1
2: 0
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103636358 Original CRISPR CTTGCAACGCTGAAAGCTGC TGG Exonic
900669903 1:3845296-3845318 CTTTCATCACTGAAATCTGCAGG + Exonic
902812348 1:18895661-18895683 CTTGCAACCCTGACATCTCCTGG - Intronic
907367959 1:53978286-53978308 CTAGCAAGTCTGAAATCTGCAGG - Intergenic
910396473 1:86799163-86799185 CATGCAACACTGTCAGCTGCAGG + Intergenic
910978131 1:92929883-92929905 CATGTAGCTCTGAAAGCTGCTGG - Intronic
916420236 1:164630941-164630963 CTTGCTACCTGGAAAGCTGCTGG - Intronic
916791653 1:168130391-168130413 CTGGCAAGGGGGAAAGCTGCAGG - Intronic
920672869 1:208017918-208017940 CTAGCAAGTCTGAAATCTGCAGG - Intergenic
920916888 1:210264933-210264955 CTTACAAGACTGAAAGCTCCAGG - Intergenic
923764040 1:236875886-236875908 CTGGCAAGACTGAAATCTGCAGG + Intronic
924061735 1:240181982-240182004 CTTGAAATTCTGAAAGCTGATGG - Intronic
924802276 1:247336164-247336186 CTTGCAAGTCTAAAATCTGCAGG - Intergenic
1068778540 10:60894191-60894213 CTTGCAATGCAGAAAACTGCAGG + Intronic
1070520331 10:77247294-77247316 CTTGAAATTCTGAAAGCTACAGG + Intronic
1071672094 10:87618397-87618419 CTGGCAAGTCTGAAATCTGCAGG - Intergenic
1074727505 10:116326916-116326938 CCAGCAATGCTGAAAGCTGGTGG + Intronic
1075342682 10:121660178-121660200 CTGGCAAGTCTGAAATCTGCAGG + Intergenic
1075928658 10:126274264-126274286 CTTGCAACGGCGAAGGATGCAGG + Intronic
1077882585 11:6363140-6363162 CTTGCAGCTCCCAAAGCTGCTGG + Intergenic
1078354105 11:10621389-10621411 CTTGCCCCGCTTCAAGCTGCTGG - Intronic
1078550261 11:12275440-12275462 CTTGTAACACTGAAAGATCCCGG - Intergenic
1083917202 11:65755643-65755665 CTTCCAAAACAGAAAGCTGCAGG - Intergenic
1086809187 11:91284124-91284146 CTGGCAATGCTGAAATCTTCAGG - Intergenic
1087063166 11:94002595-94002617 CTTGCCATGCTGAAAGCTCTAGG + Intergenic
1091128409 11:133122896-133122918 CTTATAATGCTGAAAGCAGCTGG - Intronic
1091353916 11:134920975-134920997 CTTGCAACGCAGACACTTGCAGG + Intergenic
1091960990 12:4694101-4694123 CTTGCAACTCTGTAAGCTGTAGG + Exonic
1093862747 12:24187313-24187335 CTTGCAGCTCAGAAAGCAGCAGG - Intergenic
1102150476 12:110686441-110686463 CATGCAAAGCTGAACTCTGCTGG - Intronic
1102951776 12:117036041-117036063 CATTCAACACTCAAAGCTGCAGG - Intergenic
1103636358 12:122309827-122309849 CTTGCAACGCTGAAAGCTGCTGG + Exonic
1108685672 13:52816800-52816822 CCTGCTTTGCTGAAAGCTGCAGG + Intergenic
1109913490 13:68948209-68948231 CTTGCAAAGATGAATGCTGCTGG - Intergenic
1111847624 13:93531357-93531379 CTGGCAAGTCTGAAATCTGCAGG + Intronic
1114303908 14:21403525-21403547 CTTCCAAAGCTTAAAGCTGGTGG - Exonic
1116976280 14:51119651-51119673 CTTGCACCTGTCAAAGCTGCAGG + Intergenic
1118368819 14:65118548-65118570 CTTTGGACGCTGACAGCTGCTGG + Intergenic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1122821968 14:104351892-104351914 CTTGCAACCTTGCATGCTGCTGG - Intergenic
1124360369 15:29032465-29032487 CTGGCAAATCTGAAATCTGCAGG - Intronic
1124924499 15:34058002-34058024 CTAGCAAATCTGAAATCTGCAGG + Intronic
1126034521 15:44534559-44534581 CTGGCAAGTCTGAAATCTGCAGG + Intergenic
1133307381 16:4818971-4818993 CCTGCAACCCTGAGAGCTGGGGG + Intronic
1133833110 16:9342443-9342465 CTGGCAGCCCTGAAAGCTGAGGG - Intergenic
1135042507 16:19128791-19128813 CTTGCATGGCAGAAAACTGCAGG + Intronic
1137373898 16:47934241-47934263 CTTCCAACTCTGAAAGCACCAGG - Intergenic
1141403650 16:83772831-83772853 TTGGCAAGGCTGAAAACTGCAGG - Intronic
1141603827 16:85142014-85142036 TTTGAAAGCCTGAAAGCTGCCGG + Intergenic
1144752874 17:17662108-17662130 CTTGAAAGGCTGTAGGCTGCAGG - Intergenic
1147670817 17:42175881-42175903 GTTACAAGGCTGAAGGCTGCGGG + Intronic
1148201771 17:45754051-45754073 CCTGCAGAGCTGGAAGCTGCAGG - Intergenic
1151322959 17:73362497-73362519 CTTGGAAGGCTGAAAGTGGCAGG - Intronic
1154164762 18:12006470-12006492 CTGGCTAGGCTGAAAGCTCCAGG + Intronic
1156262887 18:35461118-35461140 CTGGCAAGTCTGAAAACTGCAGG + Intronic
1157640469 18:49207754-49207776 CTTGCAAGTCTGAAATCTGTAGG - Intronic
1157828301 18:50832593-50832615 CTTCCAACGCTGGAAGCTCCAGG + Intergenic
1158840004 18:61375319-61375341 CATGCAGCGCTGAATTCTGCAGG + Intronic
1158961109 18:62588298-62588320 CTTGCAACCCTGGGAGCTGGAGG - Intergenic
1160485021 18:79282979-79283001 CTCTCAACTCTGAAAGCAGCTGG + Intronic
1161388669 19:4010062-4010084 GTTGAAACTCTGGAAGCTGCCGG + Intronic
1161479617 19:4504023-4504045 CCTGCACCGCTGATAGCTGGGGG + Exonic
1161825067 19:6558025-6558047 CTGGCAAGTCTGAAATCTGCAGG + Intergenic
1162902697 19:13804861-13804883 CTTGCAGCGATCAAAGCTGATGG - Exonic
1168085567 19:54043318-54043340 CTGGCAAGTCTGAAATCTGCAGG - Intronic
926333129 2:11841850-11841872 CGTGCAAGCCTGAAATCTGCAGG + Intergenic
926736960 2:16081040-16081062 CTTGCAAATCTGAAATTTGCGGG - Intergenic
927288046 2:21377482-21377504 TGTGCATCACTGAAAGCTGCAGG + Intergenic
934543298 2:95194011-95194033 ATCGCAAGGCTGAATGCTGCAGG + Intergenic
935803411 2:106722900-106722922 CTTACAAAGGTGAAAACTGCTGG + Intergenic
937119910 2:119433835-119433857 CCTGCATCACTGAAAGCTGGTGG + Intronic
938943620 2:136191039-136191061 CTTGCTAAGCTGAAGGCTGTTGG + Intergenic
940898781 2:159107321-159107343 CTTGAAACACTGTAAGCGGCTGG - Intronic
945849610 2:214989587-214989609 CTTGCATAGCTGAATGCTGTTGG + Exonic
945963553 2:216161790-216161812 CTTGGACCACTGAAATCTGCCGG + Intronic
948714875 2:239854557-239854579 CTTGCCACGCTGATAGGAGCTGG - Intergenic
1173094375 20:40010871-40010893 CTTGCCACCCTGAGAGCTTCAGG - Intergenic
1175377006 20:58534805-58534827 CTAGTAAGGCTGAAATCTGCAGG + Intergenic
1177184976 21:17783324-17783346 CTGGCAAGTCTGAAACCTGCAGG - Intergenic
1178914053 21:36697324-36697346 CTGGCTGCGCTGACAGCTGCCGG - Intergenic
1180085251 21:45505351-45505373 CCGGGAACGCTGATAGCTGCAGG - Exonic
951188359 3:19740729-19740751 AATGCAAAGCTGTAAGCTGCTGG - Intergenic
953194112 3:40715748-40715770 CTTGCAGGGCTGACAGCTACAGG - Intergenic
956206251 3:66758132-66758154 CTGGCAATGCTGAAATCTGTGGG - Intergenic
958963218 3:100530276-100530298 CTGGCAAGTCTGAAATCTGCTGG + Intronic
961387124 3:126529015-126529037 CTTGCAACACTGTAACCTGCTGG + Intronic
963106007 3:141647797-141647819 CTGGCAAGTCTGAAATCTGCAGG + Intergenic
968574492 4:1358913-1358935 CATGGAACGCTGCTAGCTGCAGG + Intronic
970696604 4:18685532-18685554 CTGGCAAGTCTGAAATCTGCAGG + Intergenic
973834293 4:54793597-54793619 CTTACAACTCTGAATGCTTCAGG + Intergenic
977251493 4:94693897-94693919 CTGGCAAGTCTGAAACCTGCAGG - Intergenic
980013482 4:127622833-127622855 TTTGCAGCGCTAGAAGCTGCAGG + Intergenic
980270571 4:130578880-130578902 CTTGCAACACTGAAAGCTGCTGG + Intergenic
980983833 4:139676427-139676449 CTGGCAAGTCTGAAATCTGCAGG + Intronic
981820773 4:148884997-148885019 CTTGTAAGGCTTAAAACTGCTGG - Intergenic
985597459 5:801742-801764 CTTGCAACGCTGAATGTGTCGGG + Intronic
987845061 5:23273457-23273479 CTTCTAACGTTGAAAGCTTCAGG + Intergenic
990968241 5:61472750-61472772 CTTGCAACGATCAAAGCTGATGG - Exonic
993692740 5:91022874-91022896 ATAGCAACACAGAAAGCTGCAGG - Intronic
994933528 5:106221013-106221035 TTGGCAACGCTAAAATCTGCAGG - Intergenic
996336029 5:122385067-122385089 CTGGCAAAGCTGAAAGCCGAAGG - Intronic
998262942 5:140644999-140645021 CTTGCAGCCCTGACTGCTGCAGG - Exonic
1000374584 5:160567591-160567613 CTTTTAAAGCTGAAAACTGCAGG + Intronic
1004523940 6:16388214-16388236 CATGCAATGCTGTCAGCTGCAGG + Intronic
1007700015 6:43761010-43761032 CTTTCCAGGCTGAAGGCTGCAGG - Intergenic
1010241221 6:73617541-73617563 GTTGCAATGCTAAAAACTGCCGG + Intronic
1014226811 6:118857870-118857892 CTTCCAACACAGAAATCTGCAGG + Intronic
1014284847 6:119485691-119485713 CTGGCAAATCTGAAATCTGCAGG + Intergenic
1017989119 6:159470961-159470983 CTTGCACCTGTAAAAGCTGCAGG - Intergenic
1018731060 6:166650814-166650836 CTTGGAACCCTGAAGACTGCAGG + Intronic
1019781737 7:2944436-2944458 CCTGCAACGCTGCGAGCTGCTGG - Exonic
1021954403 7:25810022-25810044 CTTGTAAGACTGACAGCTGCTGG - Intergenic
1023553624 7:41396647-41396669 CTTCCAAAACTGAAAGCAGCAGG - Intergenic
1024417931 7:49129798-49129820 CTTGAAAGGTTGAAAGGTGCAGG + Intergenic
1026292272 7:69018457-69018479 CTTGCAACTGGAAAAGCTGCAGG - Intergenic
1034385319 7:150736267-150736289 TTTGCAACTCAGAAAGGTGCTGG - Intronic
1035302176 7:157904693-157904715 CAGGCATCGCTGAAAGCGGCCGG - Intronic
1038427114 8:27470878-27470900 GTTGCAACCGTCAAAGCTGCAGG - Intronic
1042404715 8:68390829-68390851 CTGGCAAGTCTGAAATCTGCAGG + Intronic
1045089396 8:98725062-98725084 ATTGCTACACTCAAAGCTGCAGG - Intronic
1047004169 8:120602571-120602593 CTGGCAAATCTGAAATCTGCAGG - Intronic
1056471411 9:86907720-86907742 CTTGCAGTCCTGAGAGCTGCAGG + Intergenic
1058180066 9:101786780-101786802 CTTGCAATTCTGAAATCTGCAGG + Intergenic
1061566489 9:131444229-131444251 TTTCCGACGCTGAAAGCAGCTGG + Exonic
1061758703 9:132834667-132834689 CTTACAACGCCGAAATATGCAGG + Intronic
1061778207 9:132980198-132980220 CCTGCCCCGCTGAAAGCTTCGGG - Intronic
1185586425 X:1244834-1244856 CTTTCATCGCCGACAGCTGCTGG + Intergenic
1185619488 X:1444721-1444743 CTTGCAACCCAGGAAGCTGTGGG + Intronic
1190526881 X:51337095-51337117 CTTGCAAGGATGAAAGATGGAGG + Exonic
1199062540 X:143376152-143376174 CTTGCACCTGTAAAAGCTGCAGG - Intergenic