ID: 1103643280

View in Genome Browser
Species Human (GRCh38)
Location 12:122370216-122370238
Sequence TAGCTGAAGCAGAGTGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 787
Summary {0: 1, 1: 2, 2: 9, 3: 110, 4: 665}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103643280 Original CRISPR TAGCTGAAGCAGAGTGAGAA AGG Intronic
900411087 1:2513020-2513042 CAGGTGAAGCAGCGGGAGAATGG - Exonic
900831222 1:4967131-4967153 CAGCTGGAGCAGAGGGAGCAGGG - Intergenic
902098994 1:13969558-13969580 TGGCTGAAGCAGAGTGACTAGGG - Intergenic
902185856 1:14724846-14724868 TTGATGAACCAGAGTGAGGAAGG - Intronic
902185899 1:14725240-14725262 TAGATGAAGGTGAGTGAGGAGGG - Intronic
902540209 1:17149210-17149232 TAGCGTGAGCAGGGTGAGAAAGG + Intergenic
903024163 1:20415413-20415435 TGGCTGCAGCAGAGTGACCAAGG + Intergenic
903296045 1:22343675-22343697 TGGCTGCAGCAGAGTGGGCAAGG + Intergenic
903320561 1:22540663-22540685 TGGCTGGAGCAGAGTGGGCATGG + Intergenic
904713446 1:32448891-32448913 TAGCTGAGGCGGAGAGAGAGAGG - Intergenic
904876901 1:33662347-33662369 TGGCTGAAGCACAGGGAGCAAGG - Intronic
905078441 1:35295399-35295421 TAGCTGAACATGAGTGAGCAAGG + Intronic
905649781 1:39648427-39648449 TCTGTGAAGGAGAGTGAGAAGGG + Intergenic
905938713 1:41845470-41845492 TAGGTGAAGAAGAGAGAAAAGGG - Intronic
905945819 1:41900800-41900822 AGGCTGAAGGAGAGGGAGAAAGG + Intronic
906052827 1:42888604-42888626 GAGCTGTAGCAGAGGGAGAGGGG - Intergenic
906283253 1:44568277-44568299 TGGCTGGAGCAGAGTGAGGTGGG - Intronic
906514799 1:46432561-46432583 AAGCTTAAGAAGAGTGAGAGAGG + Intergenic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906883332 1:49617159-49617181 TAGCTGAAACAGAGTGAGTGAGG - Intronic
906889064 1:49687290-49687312 TGGCTGTAGCAGAGATAGAAAGG + Intronic
907078244 1:51597145-51597167 TGGCTTAAGCACAGTGAGGAAGG + Intronic
907184311 1:52598120-52598142 TGGCTGGAGCAGAGTGAGCAAGG - Intergenic
907241090 1:53081494-53081516 TAGCTGAAGCACAGAGAGTGAGG + Intronic
907282600 1:53360830-53360852 TAGCCGAGGCAGAGAGAGAGAGG + Intergenic
907347624 1:53795964-53795986 TGGCTGGAGCAGAGTGAGTGAGG - Intronic
907475948 1:54705597-54705619 GAGGTGAAGAAGAGTGGGAAGGG + Intronic
907477470 1:54715272-54715294 GGGCTGAAGCAGAGTGAGGAAGG - Intronic
907867417 1:58411688-58411710 TAGCTGGAGTAGAGAGGGAAAGG + Intronic
908342197 1:63193085-63193107 TAGCTGGAGCACAGTGAACAAGG + Intergenic
908701802 1:66910388-66910410 TGGCTGAAGCAGAGTAAACAAGG - Intronic
909049629 1:70752719-70752741 TAGCTGCAGCAGAGTGCTAGTGG + Intergenic
910300817 1:85705555-85705577 TAACTGAAGCATAGTGAGTGAGG - Intronic
910672092 1:89783771-89783793 TAGCTGAAGTGGAGTGAACAAGG + Intronic
910742369 1:90533948-90533970 TGGCTGAAGAAGGGTTAGAATGG - Intergenic
911140180 1:94492785-94492807 TGACTGAAGCACAATGAGAAAGG + Intronic
912203417 1:107483971-107483993 AAGCTGGAGGAGAGTCAGAATGG - Intergenic
912738664 1:112173683-112173705 CTGCTGAAGCAGAGTGGGAAAGG - Intergenic
914667763 1:149845598-149845620 TGGCTGAAGCACAGTGACCAAGG + Intronic
915098259 1:153479396-153479418 TGGTGGAAGCAAAGTGAGAATGG - Intergenic
915349045 1:155213217-155213239 GGGCTGGAGCAGAGAGAGAAGGG - Exonic
915352232 1:155233844-155233866 GGGCTGGAGCAGAGAGAGAAGGG - Intergenic
915479500 1:156175287-156175309 TAGCAGAAGCTGGCTGAGAAGGG - Intronic
915951431 1:160192166-160192188 AGGCTGAAGTAGAGTGCGAAAGG + Intronic
917180391 1:172290466-172290488 TGGCTGGAGCAGAATGAGGATGG + Intronic
918547012 1:185696517-185696539 TAGCTGCAGCAGAAGGAGGACGG - Intergenic
919673860 1:200362165-200362187 TGGCTGAAACAGAGTGAGTGAGG - Intergenic
919860037 1:201733794-201733816 TGGCTGAAGCAGAGTTAGCAAGG + Intronic
920076203 1:203338778-203338800 TGGCTGCAGCACAGAGAGAAAGG - Intergenic
921004001 1:211075077-211075099 TAGCCGAATAAGAGTGAGCAAGG + Intronic
921164857 1:212499648-212499670 TGGCTGGAGCAGAGTGAGCAGGG + Intergenic
921670147 1:217916073-217916095 TGGCCAGAGCAGAGTGAGAAAGG - Intergenic
921740608 1:218680575-218680597 TGGCAGAAGCACAGTGAGCATGG + Intergenic
921819750 1:219603956-219603978 TGACTGTAGCAGAATGAGAAGGG + Intergenic
923333498 1:232947137-232947159 TGACTGAAGCAGAGGGACAAGGG - Intergenic
1063613827 10:7585451-7585473 GAGCTGCAGCAGAGTGAAACAGG - Intronic
1063985220 10:11494718-11494740 CAGCTGAGGCAGAGAGAGAGAGG + Intronic
1065068695 10:22000486-22000508 TGGCTGGAGCAGAGTGATCAAGG - Intronic
1066461984 10:35620303-35620325 TGTCTGAAGCAGAGGGAGACTGG - Intergenic
1067271649 10:44796756-44796778 TGGCTGAAGCAAAGTGTGCAAGG - Intergenic
1067666483 10:48283852-48283874 TGGCTGAGGTAGAGTGAGGAAGG - Intergenic
1068492633 10:57743162-57743184 TGGCTGGAACAGAGTGAGCAAGG - Intergenic
1069160202 10:65083755-65083777 GGGCTGTAGCAGAGTGAGCAGGG + Intergenic
1069333258 10:67318588-67318610 TAGCTGGAGCAGAGTGAACATGG - Intronic
1070311172 10:75275278-75275300 ATGCTGCAGCAGAGTGACAAAGG - Intergenic
1070873964 10:79783946-79783968 TGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1071237059 10:83661469-83661491 TGGAGGAAGCAGGGTGAGAAAGG - Intergenic
1071321261 10:84461073-84461095 CAACTAAAGCAGAGTGATAAGGG - Intronic
1071466014 10:85940352-85940374 GAGCTGAAGCTAAGTGAGATGGG - Intronic
1071587021 10:86833497-86833519 TAGATGAAGCAGAGGGAGGTGGG + Intronic
1071640896 10:87306085-87306107 TGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1071654340 10:87431851-87431873 TGGCTGGAGCAGAGTGAGTGAGG + Intergenic
1072202760 10:93175983-93176005 TAACTGTAGGACAGTGAGAAGGG + Intergenic
1072220251 10:93321012-93321034 TAGCAGGGGCAGAGTGGGAATGG + Intronic
1072512377 10:96140376-96140398 TTTCTGAAGCTGAGTAAGAATGG + Intronic
1072873465 10:99146286-99146308 TAGATGAAGCCAAGGGAGAAGGG - Intronic
1073172025 10:101518663-101518685 TGGCTGGAACAGAGTGAGCAAGG - Intronic
1073241006 10:102058179-102058201 TAGCCGAAGCAGAGAGAGAGGGG - Intergenic
1073451148 10:103610132-103610154 GAGCTGAGGCAGAGTGAGTGAGG + Intronic
1073575424 10:104618789-104618811 TTTCTGAAGCACAATGAGAATGG - Intergenic
1073709698 10:106022448-106022470 TGGTTGAAGGATAGTGAGAAAGG + Intergenic
1073713300 10:106071154-106071176 TAGCTGAAGCAGACTAAGACAGG - Intergenic
1074056216 10:109924485-109924507 CAGCTGAAGAAGAGTGAGGAAGG - Intergenic
1075575461 10:123574182-123574204 TACCTGCAGCAGAGAGAGAGAGG - Intergenic
1075876761 10:125813928-125813950 TACCTGGAGCAGAGTGGGCATGG - Intronic
1076628753 10:131839899-131839921 CAGCTGAGGCAGAGAGAGACAGG + Intergenic
1078141506 11:8696567-8696589 TTTCTGACACAGAGTGAGAAGGG - Exonic
1078277494 11:9864060-9864082 TAGCAGGAGCAGAAAGAGAATGG + Intronic
1078357948 11:10646881-10646903 TAGCTGAAGGAGAATGAGGAAGG - Intronic
1079478206 11:20853888-20853910 TAACTGAGGCAGAGTGGGGAAGG + Intronic
1079586747 11:22135109-22135131 TCTCTGTAGCAGAGTGAAAATGG - Intergenic
1080214976 11:29830033-29830055 TAGCTAAAGCAGTGTGAAGAGGG + Intergenic
1080305242 11:30828131-30828153 TGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1080549724 11:33362215-33362237 TAGATGAAGCAGACTGAGTGGGG + Intergenic
1080635646 11:34121030-34121052 GGGCTGAAGCAGGGTGAGTAGGG + Intronic
1081028343 11:38044815-38044837 GAGCTCAAGCAGAGTGAGCAGGG - Intergenic
1081468328 11:43345898-43345920 TGGCTGCAGCAGAGTGATCAAGG - Intergenic
1081528084 11:43940721-43940743 TGGCTAAAGCAGAGTGAGAGAGG - Intronic
1082193800 11:49277905-49277927 TCTTTGTAGCAGAGTGAGAATGG - Intergenic
1083001641 11:59297720-59297742 TGCCTGCAGCAGAGTGGGAAAGG + Intergenic
1083172288 11:60930194-60930216 TAGCTGAAGCAGAGAGTGCATGG + Intronic
1083703831 11:64499618-64499640 TCGCTGAAGAAGAATGTGAAGGG + Intergenic
1083751461 11:64763173-64763195 TGGCAGAATCAGAGAGAGAAAGG - Intergenic
1084179237 11:67438315-67438337 TGGCAGAAGCTGAGTGGGAAGGG + Exonic
1085446815 11:76606298-76606320 TTGCAGCAGAAGAGTGAGAAGGG - Intergenic
1085586181 11:77708808-77708830 TAGCTGAAGCAGAATGAGTGGGG - Intronic
1086592548 11:88533238-88533260 TAGATGAAGCAATGTGAGCAAGG - Intronic
1086770594 11:90760242-90760264 AAGATGAAGCAGAGAGAGATAGG + Intergenic
1086980743 11:93195699-93195721 TGGCTGAAGCAGAGTGATGGAGG - Intronic
1086989700 11:93289419-93289441 TAGCAGAAGCTGAGTAAGTAAGG - Intergenic
1087311913 11:96554519-96554541 TGGCTGAAGAATAGTGAGCATGG + Intergenic
1088279854 11:108124742-108124764 TGGCAAAAGCAGAGTGAGCACGG - Intronic
1088953610 11:114595842-114595864 TAGCTCAAGCAGAGGTAGGAAGG + Intergenic
1089535165 11:119156544-119156566 GAGCTGCAGCAGAAAGAGAAGGG - Exonic
1089611656 11:119672720-119672742 TGGCTGGAGCAGAGTGGGCAGGG - Intronic
1090297194 11:125599125-125599147 TAGGAGAGGCAGAGTGAGAGAGG - Intronic
1090432692 11:126659667-126659689 GATCAGAAGCAGAGTCAGAATGG + Intronic
1090467474 11:126947691-126947713 TAGCTGTTGCAGACTGAGATGGG + Intronic
1090599429 11:128355032-128355054 CAGCTGGAGCAGACTGGGAAGGG - Intergenic
1090968644 11:131620531-131620553 TAGCTGGGGCTGAGTGAGCAAGG - Intronic
1090999163 11:131893976-131893998 TAGCTGCAAAAGAGAGAGAAAGG + Intronic
1091206789 11:133827036-133827058 TGGCTGCAGCAGAGGGAGCAAGG - Intergenic
1091642836 12:2250558-2250580 TAGCTGAAGTGGAGAGAGACTGG + Intronic
1091688748 12:2581778-2581800 TACCTGAAACACAGTGAGGAGGG - Exonic
1092090557 12:5800240-5800262 TGGCTGGGGCAGAGTGAGCACGG + Intronic
1092395377 12:8121508-8121530 GAGCTTTAGCAGGGTGAGAAGGG + Intergenic
1092519236 12:9250314-9250336 CAGCTGAAGCAGTGTGAAGAGGG + Intergenic
1092564879 12:9654192-9654214 TAGGTGAAGCAAAGTGAAGATGG + Intergenic
1092836456 12:12493610-12493632 TGGCTGGAGCAGAGTGAGCATGG - Intronic
1092974319 12:13729669-13729691 TAGCTGAAAGAGATGGAGAATGG + Intronic
1093312632 12:17609178-17609200 TAGCTTAAGCAGACTGAGGAGGG + Intergenic
1094059535 12:26299114-26299136 TAGCTAAAGTAGAGTAAGATTGG + Intronic
1094398958 12:30040362-30040384 TGGCTGAAGCAGAGTGTCAGGGG - Intergenic
1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG + Intronic
1095881282 12:47139533-47139555 TAGCTCAAGTACAGTGAAAAGGG + Intronic
1095991706 12:48039238-48039260 TGGCTGAGGCAGAGTGGGCAGGG + Intergenic
1096525483 12:52207657-52207679 GAGCTGAAACAGAGAGAGAGAGG + Intergenic
1096748646 12:53744893-53744915 CAGGGGAAGCAGAGAGAGAATGG - Intergenic
1097591681 12:61582467-61582489 CAGCTGAGGCAGAGAGAGAGAGG + Intergenic
1098032220 12:66266656-66266678 AAGCTCAGGCAGAGAGAGAAGGG - Intergenic
1098158938 12:67629295-67629317 TGGCTGAAGCGAAGTGAGCAAGG + Intergenic
1098249158 12:68550842-68550864 TGGCTGGAGCACAGTGAGGAAGG - Intergenic
1098601175 12:72333146-72333168 AAGCTGAAGAAGAGATAGAAAGG - Intronic
1098935347 12:76472655-76472677 CAGCTGAGGCAGAGAGAGACAGG + Intronic
1099048800 12:77757991-77758013 TAGTTGAAGCAAAGTAAGCAAGG - Intergenic
1099159765 12:79226282-79226304 TAGCTGGCTCTGAGTGAGAAAGG - Intronic
1099541034 12:83907907-83907929 TGGCTGGAGCAGAGTGAGGTGGG + Intergenic
1100029665 12:90170705-90170727 TAGCAAATGCAGAATGAGAAAGG + Intergenic
1100255144 12:92875787-92875809 TAGCTGTAGCATAGTGAGCAAGG - Intronic
1100501977 12:95183160-95183182 CAGCAGAAGCATAGTGGGAAGGG - Intronic
1100642357 12:96494165-96494187 TAGCAGAAGCAGAGTGAAAGAGG + Intronic
1100702306 12:97161470-97161492 GGGCTGAAGCAGGGTGAGGAGGG + Intergenic
1101168560 12:102063905-102063927 TAGCTGAAGCAGAGTGAGCAAGG + Intergenic
1101484069 12:105133183-105133205 TACCTGAAGCACTGTGAGCAGGG - Intronic
1101752229 12:107591427-107591449 TAGCTGAAGCAGGCGGAAAAGGG + Intronic
1101845292 12:108358654-108358676 TAGCTCAAGAAGAAAGAGAAGGG + Intergenic
1101878001 12:108608145-108608167 TAGCTGGAACAGAGTGAGTTAGG + Intergenic
1102015135 12:109643223-109643245 AAGCTGAGGGAGAGTGAGTAAGG - Intergenic
1102119327 12:110428761-110428783 ATGCTGCAGCAGAGTGAGCAAGG - Intergenic
1102330041 12:112021196-112021218 TGGCTGGAGCTGGGTGAGAAAGG - Intronic
1103158842 12:118710563-118710585 TGGGTGCAGCAGAGAGAGAAAGG - Intergenic
1103217935 12:119217722-119217744 TAGAAGAAGCAGAGTGCTAAAGG - Intronic
1103389107 12:120557598-120557620 CAGCTGATGAAGAGGGAGAAAGG + Exonic
1103643280 12:122370216-122370238 TAGCTGAAGCAGAGTGAGAAAGG + Intronic
1103865424 12:124047989-124048011 TGGCTGGAGCATAGTGAGAGAGG - Intronic
1103995851 12:124829547-124829569 TGGCTGGAGCAGAGTGAGCGAGG - Intronic
1104002423 12:124868716-124868738 TGGCTGGAGCAGAGTGGGCAAGG - Intronic
1104343762 12:127977280-127977302 TACAGGAAGCATAGTGAGAAGGG - Intergenic
1104385790 12:128350583-128350605 TGGCTGGAGCAGAGTGAGTGTGG + Intronic
1104595678 12:130118593-130118615 AAGCTGAAGCAGGGGCAGAAAGG - Intergenic
1104642045 12:130473572-130473594 TAGATGGAGCAGAGTGAGGGAGG + Intronic
1105390315 13:19971038-19971060 TAGCTGAAGCTTAATGAGCAAGG + Intronic
1105438200 13:20395035-20395057 TGGATGAACCACAGTGAGAACGG - Intergenic
1105665583 13:22552344-22552366 TGGCTGGAGCAGAGTGGGACAGG + Intergenic
1105925709 13:25005915-25005937 TAGGTGAAGAAGAGGGAGAGGGG - Intergenic
1106038990 13:26071700-26071722 TAGGTGAAGAAGAGGGAGAGGGG + Intergenic
1106370744 13:29130336-29130358 TGGCTTGAGCAGAGTGAGGAGGG - Intronic
1106657264 13:31759547-31759569 TGGCTCAAGCAGAGTGAACAGGG + Intronic
1107798454 13:44079690-44079712 TGGCTGAAGCAGAGCGAGCAAGG + Intergenic
1107799200 13:44088298-44088320 TGGCTGAAGCAGAGCGAGCAAGG - Intergenic
1108224055 13:48269551-48269573 TGGCTGTAGAGGAGTGAGAAAGG - Exonic
1110097315 13:71544190-71544212 TAGGTGTGGCAGAGAGAGAATGG + Intronic
1111162751 13:84417366-84417388 TAACTGGAGCTGAGTGAGGAAGG + Intergenic
1111500318 13:89110488-89110510 TAGCTGAAGCATATTCATAAAGG + Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1112138507 13:96611784-96611806 TGGCTCAGGCAGAGTGAGCATGG + Intronic
1112337498 13:98527321-98527343 TAGATGAAGTGGAGGGAGAAGGG - Intronic
1112722852 13:102264833-102264855 TAGCAGGAGAAGAGTGAGATTGG - Intronic
1112973584 13:105289846-105289868 TAACTGAAGGGGAGTGAGACAGG + Intergenic
1113281742 13:108796059-108796081 TGGCTGAAGCAGTGTCAGCAGGG + Intronic
1113702822 13:112399731-112399753 TCGTTGTAGCAGTGTGAGAATGG - Intronic
1114007573 14:18331681-18331703 CAGCTGCAGGAGAGTGGGAATGG - Intergenic
1114165763 14:20216766-20216788 TAGCCGAGGCAGAGAGAGAGAGG + Intergenic
1114846887 14:26333188-26333210 TGGCTGGAGCAGAGTGTGCAAGG - Intergenic
1114860725 14:26517228-26517250 TAGCAGCAGCAGAATGAGCAAGG - Intronic
1114862666 14:26544437-26544459 TAGGTGATGCACAGTGAGGAGGG + Intronic
1115321647 14:32086216-32086238 TGATTGAAGCAGAATGAGAAAGG + Intronic
1115427529 14:33277744-33277766 TTGCTGGAGCAGAATGAGAAAGG + Intronic
1115695832 14:35897920-35897942 CAGCTGCAGCAGTGTGACAAAGG + Intronic
1116986734 14:51227854-51227876 TGGATGGAGCAGAGTGAGGAAGG + Intergenic
1117440562 14:55755278-55755300 TAGCTGAGGCAGAGATAGTAGGG - Intergenic
1117632564 14:57708892-57708914 CAGCTGAGGCAGAGAGAGAGAGG + Intronic
1118608916 14:67524443-67524465 TGGCTGAGGAGGAGTGAGAAGGG + Intronic
1118966853 14:70595124-70595146 TAGCTGAAGCCGAGTGACACTGG - Intronic
1119617985 14:76111463-76111485 TAGCTGCTGCTGAGTCAGAATGG + Intergenic
1119625175 14:76168062-76168084 AAGCTGAAGCAGAGAAAGAGAGG - Intronic
1119734644 14:76974109-76974131 TGCCTGAAGCAGAATGAGAGTGG + Intergenic
1119929086 14:78527157-78527179 TATTTGTAGCAGTGTGAGAATGG - Intronic
1119939924 14:78629418-78629440 TGGTTGAAGCAGAGTTAGGAGGG + Intronic
1120571564 14:86124163-86124185 TTGTAGAAGCTGAGTGAGAAAGG + Intergenic
1120689605 14:87577874-87577896 TTGCAGAAGCAGAGAGAAAATGG + Intergenic
1120962626 14:90139400-90139422 TAGCTAAGGCACAGTGAGCAAGG + Intronic
1121143184 14:91559574-91559596 TAGCTAAAGCAGTGTTAGGAGGG + Intergenic
1121960917 14:98258643-98258665 TGGTTGAAGCAGAATGAGAAAGG - Intergenic
1122492852 14:102131510-102131532 TGGCTGGAGCAGAGTGAGCAGGG - Intronic
1122735740 14:103839744-103839766 TGGCTGGAGCAGAGTGAGTAAGG - Intronic
1123115279 14:105891637-105891659 CAGCGGAAGCAGAGAGAGCAGGG - Intergenic
1123117449 14:105901080-105901102 CAGCGGAAGCAGAGAGAGCAGGG - Intergenic
1123193230 14:106591521-106591543 CAGCTGAGGCAGAGAGAGAGAGG + Intergenic
1123401720 15:19993967-19993989 TAGCAGAAGCAGAGACACAAAGG - Intergenic
1123511063 15:21000628-21000650 TAGCAGAAGCAGAGACACAAAGG - Intergenic
1123737184 15:23196650-23196672 TAGCTGGAGTAGAATGAGAAGGG + Intergenic
1124288400 15:28425312-28425334 TAGCTGGAGTAGAATGAGAAGGG + Intergenic
1124294824 15:28492002-28492024 TAGCTGGAGTAGAATGAGAAGGG - Intergenic
1125760286 15:42091845-42091867 TAGCCGAGGCAGAGAGAGAGAGG - Intronic
1126453985 15:48841497-48841519 CAGCTGAGGCAGAGCCAGAAGGG - Intronic
1126885336 15:53142803-53142825 GAGCAGAAGCAGTGTAAGAAGGG - Intergenic
1127012953 15:54649952-54649974 TAGCTGAAACAATGTGAAAAAGG - Intergenic
1127102943 15:55586597-55586619 TAACTGCAGCAAAGTGAGCAAGG - Intronic
1127745817 15:61971084-61971106 TGGCTGAAGCAGAGTGAGCAAGG + Intronic
1128105763 15:65043569-65043591 TAGCTGAATCATAGTGATGAGGG - Intergenic
1128439201 15:67688184-67688206 GAGCTGAAGCAGAGTGGGCATGG + Intronic
1129449460 15:75642343-75642365 TGGCTGGAGCAGAGTGGGCAAGG + Intronic
1129574903 15:76732876-76732898 CAGCTGAGGCAGAGAGAGAGAGG - Intronic
1130368412 15:83261977-83261999 TATTTGAATAAGAGTGAGAAGGG - Intronic
1130982734 15:88823858-88823880 TAGCAGAAAAGGAGTGAGAATGG + Intronic
1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG + Intergenic
1131439282 15:92446859-92446881 TGGTTGAAACAGAGTGAGCAAGG + Intronic
1131670384 15:94613653-94613675 AGGCAGAACCAGAGTGAGAAAGG - Intergenic
1131934611 15:97489685-97489707 TAGCTGGAGTGGAGTGAGCAAGG - Intergenic
1134362794 16:13547541-13547563 TAGCTCAAGAAGAGAGAGAGAGG + Intergenic
1134586892 16:15419342-15419364 TAGATGATGGAGATTGAGAAGGG - Intronic
1134692724 16:16201499-16201521 TGGCTGGAGGAGAGTGAGCATGG + Intronic
1134902891 16:17954544-17954566 TAGCTGAGCCAGAGTGAGTTGGG + Intergenic
1134979121 16:18593182-18593204 TGGCTGGAGGAGAGTGAGCATGG - Intergenic
1135197647 16:20407993-20408015 TGGCTGGAGCAGACTGAGACAGG + Intergenic
1135812234 16:25598754-25598776 TGGCCGAAGCAGAGTGAGTGAGG + Intergenic
1136080411 16:27848882-27848904 ATGCTGTAGCAGAGTGAGCAAGG + Intronic
1136921915 16:34339518-34339540 TAGCTGAACAAGACTGTGAATGG + Intergenic
1136982658 16:35072288-35072310 TAGCTGAACAAGACTGTGAATGG - Intergenic
1138274987 16:55727905-55727927 AAGACCAAGCAGAGTGAGAAGGG - Intergenic
1138280174 16:55767153-55767175 AAGACCAAGCAGAGTGAGAAGGG - Intergenic
1138288316 16:55826485-55826507 AAGACCAAGCAGAGTGAGAAGGG + Intronic
1138525464 16:57603575-57603597 AAGCTGAAGAAGTGTGAGAAGGG + Intergenic
1138591956 16:58005030-58005052 CAGCTGAGGCAGAGAGAGAGAGG + Intronic
1138653276 16:58473975-58473997 TGGCTGGAGCAGAGTGAGCCAGG - Intronic
1139800936 16:69522161-69522183 TAGGTGAAGAAGAGGGAGGAGGG + Intergenic
1140051289 16:71483785-71483807 CAGATGAAGTAGAGAGAGAAGGG + Intronic
1140735636 16:77895517-77895539 TGGCAGAAGCAGAGGAAGAAGGG + Intronic
1141339270 16:83188028-83188050 TGGCTGAAGCAGAGGGAGCAAGG + Intronic
1141888411 16:86909759-86909781 AGGCTGAAGCAGAGAGGGAAGGG - Intergenic
1143363205 17:6388047-6388069 AGGGTGGAGCAGAGTGAGAAGGG + Intergenic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1145827590 17:27888834-27888856 TAGCTTGAGCAGAGCGAAAATGG - Intronic
1146118713 17:30169148-30169170 TAGAATAAGCAGACTGAGAAAGG - Intronic
1146634513 17:34494233-34494255 TAGTGGAAGCAGAGTGAACATGG + Intergenic
1148262202 17:46193409-46193431 AATCTGAAGCGGAGGGAGAATGG + Intronic
1148638662 17:49168723-49168745 TTGCTGGAACAGAGTGAGAATGG + Exonic
1148672665 17:49422693-49422715 TACCTGAATGAGAATGAGAAAGG - Intronic
1149681087 17:58507645-58507667 TAGCTAAAATAGAGTGAGACAGG - Intronic
1149936342 17:60810740-60810762 CAGCTGAAGCTGAGTGACATTGG - Intronic
1151097450 17:71514814-71514836 TAGAGGAAGCAGTGTGAGAAAGG + Intergenic
1151229793 17:72676039-72676061 GAGTTGAAGGAGAGTGACAAGGG - Intronic
1151284543 17:73100508-73100530 TGGATGAAGCAGAGTGAGGAAGG - Intergenic
1152450158 17:80373434-80373456 CAGCTGAAGCACAGAGACAAAGG - Intronic
1153080219 18:1214535-1214557 TGGCTGAAGGGGAGTTAGAAGGG - Intergenic
1153174334 18:2353823-2353845 TAACTGAAAAAGAGTGAGAATGG + Intergenic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1155616794 18:27730516-27730538 TAGCTTAAGTAGAGGGAGTAAGG - Intergenic
1155827673 18:30468547-30468569 TAGCTGGAGTGGAGTGAGGAAGG + Intergenic
1156537737 18:37880151-37880173 TGGCTGAAGAAGTGTGGGAATGG + Intergenic
1156683192 18:39616141-39616163 AAGCAGAAGAAGAGAGAGAAGGG + Intergenic
1156687305 18:39665987-39666009 TATCTATAGCAGTGTGAGAATGG - Intergenic
1157054977 18:44216766-44216788 TATCTCAAGAAGAGAGAGAAAGG + Intergenic
1157191474 18:45585775-45585797 TGGCTCATGCAGAGGGAGAAGGG - Intronic
1157319991 18:46626813-46626835 TAGATGAAGGAGACTGAGGAAGG - Intronic
1157474404 18:48012123-48012145 CAGATGGAGCAGAGTGGGAAGGG + Intergenic
1157543162 18:48526747-48526769 CAGCAGAAGGAGAGGGAGAAGGG - Intergenic
1157702247 18:49769187-49769209 CAGCTGGAGCAGAGTGAGTGGGG - Intergenic
1158548930 18:58418399-58418421 TATGTGAAGCAAAGGGAGAAGGG + Intergenic
1158907329 18:62026689-62026711 TAGCAGAGGCAGAGTCAGGAAGG - Intergenic
1159133268 18:64306025-64306047 TAGCTGGAGCTGAGTGAGAGGGG + Intergenic
1159718184 18:71851118-71851140 TGGGTGAAGCTGACTGAGAAAGG - Intergenic
1160676319 19:393277-393299 TGGCTGCAGCAGACTGAGTAAGG + Intergenic
1160695135 19:480220-480242 CAGCTGGAGCAGCGTGAGCAAGG + Intergenic
1160699545 19:499146-499168 TGGCTGCAGCAGAATGAGGAGGG - Intronic
1160751762 19:737766-737788 TGGCTGGAGCAGCGTGAGGAGGG + Intronic
1161226158 19:3146918-3146940 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161239336 19:3213344-3213366 TGGCTGGAGCAGAGTGAGCTGGG + Intergenic
1161243053 19:3233655-3233677 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161253090 19:3291727-3291749 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161257297 19:3316485-3316507 TGGCTGGACCAGAGTGAGGAGGG + Intergenic
1161257915 19:3320138-3320160 TGGCTGGAGCAGAGTGAGGAGGG + Intergenic
1161267901 19:3373442-3373464 TGGCTGGAGCAGAATGAGCAAGG - Intronic
1161273395 19:3402857-3402879 TGGCTGGAGCAGAGTGAGTGAGG + Intronic
1161274291 19:3406976-3406998 TGGCTGGAGCAGAGTGAGCGAGG + Intronic
1161274904 19:3410509-3410531 TGGCTAGAGCAGAGTGAGGAAGG + Intronic
1161289397 19:3484998-3485020 TGGCTGGAGCAGAGTGAGCCGGG + Intergenic
1161302981 19:3551839-3551861 TGGCTGGAGCAGAGAGAGAAGGG - Intronic
1161345446 19:3766859-3766881 TGGCTGGAGCACAGTGAGGAGGG + Intronic
1161345959 19:3768823-3768845 CGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161414742 19:4139698-4139720 TAGCTATAGCAGAGTGAGCAAGG + Intergenic
1161422021 19:4181171-4181193 TGGCTGGAGCAGAGTGAGGCAGG - Intronic
1161451750 19:4350237-4350259 TGGCTGGAGCCGAGTGAGTAAGG + Intronic
1161488310 19:4547815-4547837 TGGCTGGAGCACAGTGAGCAAGG - Intronic
1161493730 19:4576337-4576359 TGGCTGCAGCAGAGTGTGGAGGG - Intergenic
1161533854 19:4806651-4806673 TGGCTGGAGCAGAGTGACAAAGG + Intergenic
1161599168 19:5170422-5170444 TGGCTGCAGCAGAGTGAGCCAGG + Intronic
1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG + Intronic
1161623205 19:5310064-5310086 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161625400 19:5323636-5323658 TGGCTGGAACAGAGTGAGGACGG + Intronic
1161633273 19:5370219-5370241 TGGCTGGAGCACAGTGAGCAAGG - Intergenic
1161634217 19:5377170-5377192 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161642950 19:5435715-5435737 TGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161644512 19:5444743-5444765 TGGCTGCAGCAGAGGGAGCAAGG - Intergenic
1161649338 19:5474753-5474775 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161649887 19:5477958-5477980 TGGCTGCAGCAGAGTGAGGAGGG - Intergenic
1161650361 19:5480546-5480568 TGGCTGGAGCAGAGTGAGTGAGG + Intergenic
1161663815 19:5563082-5563104 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161717700 19:5886252-5886274 TCGCTGAACCAGAGTAGGAAAGG - Intronic
1161719745 19:5896218-5896240 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG + Intronic
1161765033 19:6202799-6202821 TGGCTGGAGCAGAGTGAGGGAGG + Intergenic
1161815691 19:6498543-6498565 CGGCTGAAGCAGAGTGAGGGAGG - Intronic
1161854624 19:6756804-6756826 TAGCTGAAGCAGAGGGAATGAGG - Intronic
1162110352 19:8396690-8396712 TGGCTGGAGCAGAGTGAGCCGGG + Intronic
1162304437 19:9863223-9863245 TGGCTGGAGCAGATTGAGTAAGG + Intronic
1162370201 19:10274099-10274121 TGGCTGGAGCTGAGTGAGCAAGG - Intronic
1162589807 19:11584115-11584137 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
1162833655 19:13302606-13302628 TAGCAGAAGGGGAGGGAGAAAGG - Intronic
1162844470 19:13381799-13381821 TGGCTGAAGCAGAGCGAGCAAGG + Intronic
1162875282 19:13616830-13616852 TGGCTGGAGCAGAGTGAGTGAGG + Intronic
1163025596 19:14509643-14509665 TAGCTCCAGAAGAGTGAGAAAGG + Intergenic
1163166393 19:15500917-15500939 AAGCTGCAGCAGAGTGAGTGAGG - Intergenic
1163479360 19:17545639-17545661 CAGCTGAGGCAGAGAGAGAGAGG + Intronic
1164060594 19:21670174-21670196 TAGCTGAACAAGACTGTGAAGGG - Intergenic
1164860668 19:31559859-31559881 TGGCTGAAACCGAGTGAGAAAGG - Intergenic
1165618941 19:37227797-37227819 TAGCCGAGGCAGAGAGAGAGAGG + Intronic
1165746229 19:38231238-38231260 TGACTGGAGCAGAGTGAGCAGGG + Intergenic
1165794092 19:38508698-38508720 TAGCTGAAGCAGAGTCATCGAGG + Intronic
1165945869 19:39441786-39441808 TATCTAAAGGAGGGTGAGAATGG - Intronic
1166099909 19:40565733-40565755 TGGCTGCAGCAGAGTGAGTGGGG + Exonic
1166433962 19:42751458-42751480 CAGCTGAGGCAGAGAGAGAGAGG + Intronic
1166483282 19:43191487-43191509 CAGCTGAGGCAGAGAGAGAGAGG + Intronic
1166492910 19:43274518-43274540 AAGCTGAGGCAGAGAGAGAGAGG + Intergenic
1166891550 19:45997066-45997088 TGGCTGCAGCAGAGTGAGCCAGG - Intronic
1166948605 19:46412176-46412198 AAGCTGAAGCGGAGGGTGAAGGG - Exonic
1167451738 19:49574528-49574550 CAGCTGGAGCAGACTGAGACAGG - Intronic
1167702061 19:51054648-51054670 TGGCTGGAGCTGAGTGAGCAAGG - Intergenic
1167880816 19:52455962-52455984 TAGCTACAGCAGAGGGAGCAAGG - Intronic
1167917306 19:52752334-52752356 TAGCTGAACAAGACTGTGAATGG - Intergenic
1167970098 19:53183843-53183865 TGGCTGGAGCAGAGGGAGCAAGG + Intronic
1168311352 19:55462438-55462460 TGGCTGGAGCGGAGTGAGCAGGG - Intergenic
1168468975 19:56625645-56625667 TGGCTGAAGCAGAGTGAGCAGGG - Exonic
1168472923 19:56654334-56654356 TGGCTGGAACAGAGTGAGAAAGG + Intronic
925274763 2:2640986-2641008 GAGCAGAAGCAGAGGCAGAAGGG + Intergenic
925897739 2:8486365-8486387 TCACAGAAGCAGAGTGTGAATGG - Intergenic
926862894 2:17327504-17327526 TGGCTGGAGCAGAGTGTGCATGG - Intergenic
926945089 2:18178703-18178725 TCCCAGAAGCTGAGTGAGAAAGG + Intronic
926987179 2:18637860-18637882 TACCTGAAAGAGAGGGAGAAGGG - Intergenic
927238317 2:20898456-20898478 TAGCCGCAGCAGAGTTAAAAAGG - Intergenic
927405733 2:22764264-22764286 TCACAGAAGCAGAGAGAGAATGG - Intergenic
927553723 2:24018550-24018572 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
927834483 2:26382330-26382352 TAGCGGAAACATAGGGAGAATGG + Intronic
928074454 2:28250277-28250299 TGGCTGGAGCACAGTGAGTAAGG + Intronic
928576056 2:32656495-32656517 TGCCTGGAGCAGAGTGTGAAGGG + Intronic
928673661 2:33628524-33628546 TTGTTGTAGCAGAGGGAGAATGG - Intergenic
928815108 2:35284524-35284546 TACCTCAAGCCTAGTGAGAATGG + Intergenic
929264349 2:39901690-39901712 TAGCTGCAAGAGAGAGAGAAGGG - Intergenic
930897926 2:56467111-56467133 CAGCTAAAGCAGGGTGAGAAGGG + Intergenic
930949639 2:57124393-57124415 TAGCTGAGGCAGCCAGAGAAGGG - Intergenic
930997293 2:57735580-57735602 GAGTTGAAGTAGAGTGAAAATGG - Intergenic
931146717 2:59527262-59527284 TGGCTTGAGCAGAGTGAGCAGGG - Intergenic
931560719 2:63557986-63558008 CAGCTGAAGCAGTGTCATAAGGG + Intronic
931631716 2:64307960-64307982 TGGCTGAGGCAGAGAGAGACAGG - Intergenic
931743072 2:65266426-65266448 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
931842411 2:66168330-66168352 TAGCTAGAGCAGAATGAGCAGGG + Intergenic
931883509 2:66591112-66591134 GAGGTGAAGGAGAGTAAGAAAGG - Intergenic
932254288 2:70270496-70270518 CAGCTGAAGCAGAGTGATATGGG - Intronic
932311313 2:70744600-70744622 TGGCTGAAGCTGAGTGGCAAAGG + Intronic
932438489 2:71717096-71717118 CAGCTGGAGCAGGGTGAGCAAGG - Intergenic
932527683 2:72488969-72488991 TAGCTGGAGTGGAGTGAGCAAGG - Intronic
932741425 2:74293736-74293758 TTGGGGAAGCAGAGAGAGAAGGG - Intronic
933377072 2:81493435-81493457 TATCTATAGCAGTGTGAGAATGG - Intergenic
933436280 2:82254335-82254357 CAGCTAAAGCAGTGTTAGAAGGG - Intergenic
933699455 2:85244153-85244175 TGGCTGGAGCAGAGTGGGCAAGG + Intronic
934161657 2:89255241-89255263 CAGCTGAAGCAGGATGAGCAGGG + Intergenic
934205627 2:89927174-89927196 CAGCTGAAGCAGGATGAGCAGGG - Intergenic
935608030 2:104990360-104990382 TGGCTGGAGCAGTGTGAGTAAGG + Intergenic
936003769 2:108863454-108863476 TAGCTGAAGCAGAGTTAGTGAGG + Intronic
936629375 2:114184929-114184951 TGGGGGAAGCTGAGTGAGAAGGG + Intergenic
937026118 2:118699159-118699181 TAGCTGGAGCTTAGTCAGAAAGG + Intergenic
937053400 2:118910612-118910634 TAACTGAAGAAGAGAGGGAAGGG + Intergenic
937085720 2:119170457-119170479 TCTCTGGTGCAGAGTGAGAAGGG - Intergenic
937246390 2:120496807-120496829 GGGCTGAAGCAGAAGGAGAAGGG - Intergenic
937420321 2:121748955-121748977 TTTCTGAAGAAGAGAGAGAAGGG + Intronic
937684055 2:124676776-124676798 TAGCTGAATCTCAGTAAGAATGG - Intronic
938980548 2:136522233-136522255 AAGGAGAAGCACAGTGAGAAGGG - Intergenic
940007373 2:149020363-149020385 CACCTCAAGGAGAGTGAGAAAGG - Intronic
940452568 2:153858283-153858305 TGATTGAAGCAGAGTAAGAAAGG + Intergenic
941196628 2:162460279-162460301 TGGCTGCAGCAGAGTGAGTTTGG - Intronic
941422529 2:165300676-165300698 TGGCTGGAGCAGAGTGGGAAAGG + Intronic
941616002 2:167720361-167720383 TAGGTGAAGCAGACAGATAATGG - Intergenic
941913745 2:170793616-170793638 TAACTGGAGCAGAATGAGCATGG + Intronic
941942869 2:171061948-171061970 TAGCTGCAACAGAGTTGGAATGG + Intronic
942736439 2:179119634-179119656 TAGGTATAGCAGCGTGAGAATGG + Intronic
942954559 2:181759119-181759141 TTGCAGAAGGTGAGTGAGAATGG + Intergenic
943233776 2:185291628-185291650 TAGCTGAGGCAGAGAGAGAGAGG - Intergenic
943636447 2:190312410-190312432 TAGCTGCAGCAGCCTGATAAGGG + Intronic
944053309 2:195496011-195496033 TGGCTGGAGCAGAGTGAGTGGGG - Intergenic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
944855725 2:203764990-203765012 TAGCTGCAGCTGAGTGACACTGG + Intergenic
945009168 2:205443525-205443547 TAGCTTAGGCAGAGTTAGAAAGG - Intronic
945196487 2:207241992-207242014 TGCCTAAAGCACAGTGAGAAAGG + Intergenic
945935706 2:215900899-215900921 TGGATGAAGGAGATTGAGAATGG - Intergenic
946364681 2:219241623-219241645 TGGCTGGAGCAGAGTGAACATGG + Intronic
947132227 2:226940643-226940665 TAGATGATGGAGAGTGAGATAGG + Intronic
947787273 2:232834639-232834661 TGCCTGAAGGAGAGAGAGAAAGG - Intronic
947806261 2:232970430-232970452 TGGAGGAAGCAGAGTGGGAAGGG + Intronic
947943432 2:234078474-234078496 TAGAAGAATCAGAGTGAGATAGG - Intergenic
948558767 2:238836344-238836366 GAGCTAAAGCATAGAGAGAAAGG + Intergenic
948738960 2:240030494-240030516 CAGCTGAGGCAGAGAGAGAGTGG + Intergenic
1169234962 20:3923387-3923409 TACCTGAAACAAAGTGAGAAAGG + Exonic
1169410929 20:5369755-5369777 GAGCTGAGTGAGAGTGAGAATGG - Intergenic
1169432094 20:5545603-5545625 TGGCTGAAGCAGGGTGTAAAAGG + Exonic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1170073327 20:12392230-12392252 TAGCAGAGGCAGAGTGAAAGTGG + Intergenic
1170075189 20:12411146-12411168 TACCTGCAAAAGAGTGAGAAAGG - Intergenic
1170175200 20:13461038-13461060 TGGCTGGAGCAGTGTGAGCAAGG - Intronic
1170220360 20:13935609-13935631 TAACTGGAGCAGAGTGAGTGGGG + Intronic
1170370462 20:15642374-15642396 AAGTTAAAGAAGAGTGAGAATGG - Intronic
1171298868 20:24041998-24042020 TGGCTGAAACAGAGTGAGCAAGG - Intergenic
1172027961 20:31962362-31962384 TGGCTGGAACAGAGTGAGCAAGG + Intergenic
1172115144 20:32569253-32569275 TGGCTGAAGGAAAGTGAGCAGGG + Intronic
1173164606 20:40678169-40678191 TGGCTGGAACAGAGTGAGCAAGG + Intergenic
1173320726 20:41984726-41984748 CATCTGAAGAAGATTGAGAAGGG - Intergenic
1173694986 20:45002682-45002704 TTGCTGAAGCTGAGTGATATAGG - Intronic
1174293004 20:49522136-49522158 CAGCTGAAGCAGAGTGAGGGAGG - Intronic
1176904731 21:14485854-14485876 TAGCTCAAGAAGAGTTAAAATGG + Exonic
1177079390 21:16619824-16619846 TGGCTGAAGGAGAATGAGCAAGG + Intergenic
1177897498 21:26871979-26872001 TAGCCGAGGCAGAGAGAGACAGG + Intergenic
1178431978 21:32525383-32525405 TGGCTGAAGCAGAGCCAGGAGGG + Intergenic
1178601567 21:33999203-33999225 TGGCTGGAGCAGGGTGACAAGGG - Intergenic
1179224536 21:39442268-39442290 TGGCTGAAGCCCAGTGAGAAGGG + Intronic
1180186743 21:46144055-46144077 TAGCTGAGGCAGAGAGAGAGAGG - Intronic
1180432080 22:15262491-15262513 CAGCTGCAGGAGAGTGGGAATGG - Intergenic
1180933475 22:19608971-19608993 TGGCTGCAGCACAGTGAGAATGG - Intergenic
1180987471 22:19913299-19913321 CAGCTGAAGCTGAGTGAGAATGG + Intronic
1181729876 22:24837289-24837311 CAGCTGAGGCAGAGAGAGAGAGG + Intronic
1182759750 22:32712725-32712747 GGTCTGAAGCTGAGTGAGAAAGG - Intronic
1183149258 22:36025186-36025208 TAGCTGGAGCAGAGAGAGCAAGG - Intronic
1184096735 22:42320145-42320167 TGACTGGAGCAGAGTGAGCAGGG - Intronic
1184320872 22:43741334-43741356 TAACTGAGGCAGAGTGAAAAGGG - Intronic
1184351619 22:43947782-43947804 CAGCTGAGGCAGAGAGAGAGAGG + Intronic
1184714454 22:46273033-46273055 AGGCTGCAGCAGGGTGAGAAGGG - Intronic
949252600 3:2005281-2005303 TGGCTGAAGCAGAGAAAGTAAGG + Intergenic
949870335 3:8582730-8582752 TGGCTGGAGCACAGTGAGCAAGG - Intergenic
950455939 3:13092814-13092836 TGCCTGGAGCAGAGTGAGGAGGG - Intergenic
950523958 3:13512851-13512873 TACCTAAGTCAGAGTGAGAAAGG + Intergenic
950582545 3:13871940-13871962 TGGCTGGAGTAGAGTGAGGAAGG - Intronic
950627744 3:14260529-14260551 GAGCAGGAGCAGAGAGAGAAGGG + Intergenic
950649890 3:14400874-14400896 TAGCTGAAGCAGAGGGATGTGGG + Intergenic
950863877 3:16173782-16173804 TGGCTGAAGCAAAGAGAGCAGGG - Intergenic
952086605 3:29829572-29829594 TAGCTGAAGCAGAATGGGGGAGG + Intronic
952235230 3:31472499-31472521 TGGCTGAAGCTGAGTGAGCAAGG - Intergenic
953067650 3:39489054-39489076 TGGCTGAAGCACAGTGAGGGAGG - Intronic
953551487 3:43907024-43907046 CAGCTGAAGCAGAGAGGCAAAGG + Intergenic
953605628 3:44411441-44411463 TGGCTGGAGCAGAGGGAGAATGG - Intergenic
953955006 3:47225032-47225054 TGGCTGGAGTAGAGTGAGCAAGG + Intergenic
955006195 3:54970824-54970846 TCACTGATGCAGAGAGAGAAAGG - Intronic
955018566 3:55096310-55096332 TGGCTGCAGCAGAGTGAGCAAGG - Intergenic
955376242 3:58399716-58399738 TTGCTGATGCAGGGTCAGAAAGG - Intronic
955735362 3:62033133-62033155 AAGCTGGAGCAGAGAGAAAAGGG - Intronic
956576692 3:70760047-70760069 TGGCTGGAGCAGAGTGAACAAGG + Intergenic
956946797 3:74232493-74232515 TGGCTGGAACAGAGTGAGTAAGG + Intergenic
957854827 3:85860953-85860975 TGTCTGAAGCAGAGTGAGCTAGG + Intronic
957980316 3:87501220-87501242 TTTCTGAATCAGACTGAGAAGGG - Intergenic
960147330 3:114217288-114217310 TACCTGGTGCAGAGTGAGTATGG + Intergenic
960294591 3:115927635-115927657 TGGCCGAAGCAGAGTGAGCAAGG - Intronic
962698686 3:137975824-137975846 TGGCTGCAGCAGAGTGAGGTGGG - Intergenic
964081407 3:152763078-152763100 TGGCTGGAGCAGAGTGATTAAGG - Intergenic
964248085 3:154677517-154677539 TAGCTGAGGTTGAGTGAGCAAGG + Intergenic
964419696 3:156488516-156488538 TGGCTGCAGCAGAGTAAGGAAGG + Intronic
964682829 3:159361419-159361441 TGGCTGAAGCAGAGAGAGCAAGG + Intronic
964907562 3:161736516-161736538 TAGCTGAAGAACTGAGAGAAGGG - Intergenic
964948605 3:162258858-162258880 TGTCTAGAGCAGAGTGAGAAAGG + Intergenic
965430585 3:168582825-168582847 CAACTGAAGAAGAGAGAGAAAGG - Intergenic
965537320 3:169836836-169836858 TGGCTGGAGCAGAGTGAGCCAGG + Intronic
965643998 3:170860775-170860797 CAGCTGAGGCAGAGAGAGAGAGG - Intergenic
965649054 3:170914266-170914288 TATATAAAGCAGAGTGTGAAAGG - Intergenic
966238367 3:177727954-177727976 TTGTTAAAGCACAGTGAGAAAGG + Intergenic
966313413 3:178619182-178619204 TAGGGGAAGGAGAGTGAGACTGG + Intronic
966565499 3:181376263-181376285 TAGCAAAAGCAGACTGAGAAAGG + Intergenic
966605853 3:181820929-181820951 TGGCTGGAGCAGAGTGAGCAGGG - Intergenic
968289498 3:197527632-197527654 TGGCTGAAGCAGAATGAGGGGGG - Intronic
968356204 3:198109448-198109470 TGACTGAGGCAGGGTGAGAAAGG + Intergenic
968378387 4:65097-65119 TAGCTGAAGGAGTTTGAGAGAGG + Intronic
968404710 4:329862-329884 TAGCCGAAGCGGAGAGAGAGAGG + Intergenic
968471548 4:784835-784857 TGGATGGAGCTGAGTGAGAATGG + Intergenic
968675675 4:1877672-1877694 TGGCTGGAACAGAATGAGAATGG - Intronic
968680222 4:1913599-1913621 TAGCCGAGGCAGAGAGAGAGAGG - Intronic
969587372 4:8102163-8102185 TGGCTGAAGCAGAATGACCAAGG - Intronic
969715376 4:8865796-8865818 CAGATGAAACCGAGTGAGAACGG + Intronic
970224521 4:13843866-13843888 TAGTTGGAGAAGAGAGAGAAGGG - Intergenic
970295540 4:14625442-14625464 TATCTGGAGCAGACTCAGAATGG + Intergenic
971040978 4:22751664-22751686 AAGCTTAGGCACAGTGAGAAGGG + Intergenic
971091951 4:23355958-23355980 TGGCTGGAGTAGAGTGAGAAAGG + Intergenic
971507879 4:27386257-27386279 TAGCTGAAGCAGAGTGAATAGGG - Intergenic
972202729 4:36734661-36734683 TAGTTGAAACAGAGTGCGGAGGG - Intergenic
972418306 4:38863973-38863995 TGGCTGGAGCAGAGGGAGGATGG - Intergenic
972425269 4:38927023-38927045 TGGCTGCAGCAGAGTGAGGCAGG - Intronic
972878779 4:43397654-43397676 TAGATGAAGCACAGAGAGAGAGG - Intergenic
972952503 4:44344925-44344947 AAGCTGAAGAACAGTGAGGAGGG - Intronic
973167658 4:47097243-47097265 TGGCTGGAGCAGAGTGAGAAAGG - Intronic
973245241 4:48004156-48004178 CAGCTGAGGCAGAGAGAGAGAGG - Intronic
973604269 4:52571053-52571075 TAGCTGAATCAGGGAGAAAATGG + Intergenic
974681367 4:65167920-65167942 TAGATGGAACAAAGTGAGAACGG + Intergenic
975329850 4:73100310-73100332 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
975473785 4:74798569-74798591 TAGTTGAAGTAGAGAAAGAAAGG + Intergenic
975632293 4:76416147-76416169 CAGCTGAGGCAGAGAGAGAGAGG - Intronic
976229401 4:82825596-82825618 TAGCTGGAGCAGAGAGAACAAGG + Intronic
976254449 4:83085398-83085420 TAGCTGAAGCAGAGAGAAGGTGG - Intergenic
976458991 4:85285439-85285461 TTGCTGAAGCAGAGTGTTAGAGG - Intergenic
976718765 4:88150416-88150438 AGGCTGAAGCAGAGTGAGGGAGG + Intronic
977086177 4:92601522-92601544 TAGCTGAAGCAGTGTCAAGAGGG + Intronic
977163171 4:93662024-93662046 TAGCTGGAACAGAATGAGCAAGG - Intronic
977336111 4:95701591-95701613 TGACTGAAGCAGAATAAGAAAGG - Intergenic
977370708 4:96131292-96131314 TGGCTGAAACAAAGTGAGTAAGG - Intergenic
978050131 4:104188876-104188898 TATCTAAAGCAGAGTGACAGAGG + Intergenic
978270154 4:106878967-106878989 GTGCTCAAGCAGGGTGAGAAGGG - Intergenic
979218597 4:118194717-118194739 GAGATGAAGGAGACTGAGAATGG - Intronic
979527766 4:121735547-121735569 TTGCTGATGCAGAATGTGAAAGG - Intergenic
979840615 4:125435676-125435698 TGTCTGGACCAGAGTGAGAAAGG + Intronic
980091431 4:128447242-128447264 TGGCTGAAGCAGAGTGAATGAGG + Intergenic
980610282 4:135151534-135151556 CATCTGGAGCAGAGTGAGCAAGG - Intergenic
981195382 4:141913890-141913912 TTACTGAAGTAGAGTGAGACTGG + Intergenic
982048593 4:151475622-151475644 TGGCTGAAGTAGAGTGAGGGAGG + Intronic
982812544 4:159844226-159844248 TACCTGGAGCAGAGTGAGCAGGG - Intergenic
983555466 4:169055560-169055582 GAGGTGAAGGAGAGGGAGAAGGG - Intergenic
983671313 4:170241043-170241065 TGGCTGAAGTAGAGTGAGCAGGG - Intergenic
984097431 4:175449624-175449646 CAGCTGGACCAGAGGGAGAAAGG + Intergenic
984412569 4:179413506-179413528 TATCTGAAGCTGATTGAAAATGG + Intergenic
984624949 4:181996486-181996508 CAGCTGAAGCAGAGAGTGAAAGG + Intergenic
986039685 5:3980332-3980354 TAGCTGCAGCAGTGTGACAGCGG - Intergenic
987140386 5:14939813-14939835 TCACTGAAACAGAGTGGGAAGGG - Intergenic
987359701 5:17095661-17095683 CAGCTGAGGCAGAGAGAGAGAGG + Intronic
988714051 5:33807111-33807133 TTGCTGAAACAGACAGAGAAAGG - Intronic
988967504 5:36434001-36434023 TAGCTTGAGCAGAGTAAGCATGG - Intergenic
989503068 5:42192053-42192075 TAGTTACAGCAGTGTGAGAATGG - Intergenic
989711942 5:44409105-44409127 TAGCTGGAACAGAATGAGCAAGG + Intergenic
990029983 5:51246678-51246700 CAGCTGAAGCAGAGAAAGCATGG + Intergenic
990231650 5:53718965-53718987 TAGCTAAAGCAGAGTTAAGAGGG + Intergenic
990282341 5:54264609-54264631 TGGCTGAAGCAGAAAGAGTAGGG - Intronic
990306797 5:54501938-54501960 TAGCTGAGCCAGACTGTGAACGG - Intergenic
990711078 5:58581667-58581689 TAACGGAGGCAGAGTGAAAAAGG - Intergenic
991187710 5:63829583-63829605 TAGTTAAAGCCGAGAGAGAAAGG - Intergenic
991350534 5:65716253-65716275 TGGCTGAAGCCAAATGAGAAAGG + Intronic
992222534 5:74586984-74587006 TAGCTGATGAAGATTGAGGAGGG + Intergenic
992339083 5:75803983-75804005 TATCTGGAGAAGAGTGAGAGAGG - Intergenic
992992356 5:82297261-82297283 TAGCGGAAGCAGAGAGAGAAGGG + Intronic
993156695 5:84233782-84233804 CATCTAAAGGAGAGTGAGAAGGG - Intronic
993668524 5:90731072-90731094 TTTCTAAAGCAGTGTGAGAATGG - Intronic
994285626 5:97962196-97962218 AAGCTGAAGCAGAGTAAGGCAGG - Intergenic
994844576 5:104970933-104970955 AAGGTGAAGCATAGTGAAAATGG + Intergenic
995221205 5:109650391-109650413 TACCTGAAGCAGAGTTACATTGG + Intergenic
995502673 5:112824886-112824908 TAACAGAAGCATAGAGAGAAAGG - Intronic
995590594 5:113695807-113695829 AAGCTGAAGAAAAGTGATAATGG + Intergenic
996485323 5:124026884-124026906 TGATTGAAGCAGAGTGAGCAAGG + Intergenic
997631262 5:135370362-135370384 GAACTGAAGCTGAGGGAGAAGGG + Intronic
997879853 5:137579852-137579874 TAGCTGAAACAGAACAAGAACGG + Intronic
998672659 5:144371174-144371196 TTGTTGAAGCAGAGTGAGGCAGG - Intronic
999632037 5:153581411-153581433 TGGCTCAAGCACAGTGAGCAAGG - Intronic
1000548714 5:162633252-162633274 GAGCAGAGGAAGAGTGAGAAAGG + Intergenic
1000963829 5:167631464-167631486 TGGCTGAAGCATAGGGAGTAAGG + Intronic
1001016869 5:168149806-168149828 TGGCTGTAGCAGAGTGAGTGAGG - Intronic
1001164242 5:169349114-169349136 TGGCTGGAGCAAAGTGAGAGAGG - Intergenic
1001584466 5:172824017-172824039 CAGCTGGAGCCGAGTGAGCAAGG + Intergenic
1001763965 5:174230387-174230409 TAGCTGCAGCAGAGTGAGTTTGG - Intronic
1001956054 5:175848908-175848930 TGGCTGAAGCAGAGTGAGCCGGG + Intronic
1002199836 5:177521509-177521531 CAGCTGAAGCAGTATAAGAAGGG - Intronic
1002408680 5:179056007-179056029 TTGCTGAAGCAGAAAGAAAAGGG - Intergenic
1003096990 6:3149957-3149979 TAGAAGAAGCAGAATGAAAAAGG + Intronic
1004077922 6:12362257-12362279 TAGCTGAAGCAGAGGGAGCTGGG + Intergenic
1004774391 6:18826593-18826615 TAGCTGAAGCTGATTGAGTAAGG - Intergenic
1005236985 6:23775627-23775649 GACCTGGAGCAGAGTGAAAATGG + Intergenic
1005423037 6:25672597-25672619 TGGCTGGAGCAGAGCAAGAAAGG + Intronic
1006127096 6:31846035-31846057 TGGCTGAAGCAGAGTGGAAATGG - Intergenic
1006133351 6:31881625-31881647 CAGCTTCAGCAGAGTGGGAAGGG + Intronic
1006474599 6:34246062-34246084 ATGCTGCAGCAGAGTGAGCAAGG + Exonic
1007244881 6:40453925-40453947 TACCTGAAGCAGGGAGAGACAGG - Intronic
1007728415 6:43930982-43931004 TGGCTGGAGCACAGTGAGGAAGG + Intergenic
1008029744 6:46680951-46680973 TAGGGGAAGCAGTGGGAGAAAGG - Intergenic
1008095578 6:47336300-47336322 TAGCTGGAGCAGAGGGAGCATGG - Intergenic
1008291935 6:49726109-49726131 TAGCTGGAGTAGAGGGAGCATGG - Intergenic
1008302494 6:49858601-49858623 TAGATGAAAAAGAGTGATAAAGG - Intronic
1008305160 6:49891307-49891329 ACCCTGAAGCAGAGTGCGAAGGG - Intergenic
1008609750 6:53174798-53174820 TGGCTGGAGCAGAGTGAGCCAGG - Intergenic
1008815170 6:55556491-55556513 TAGATGGAGAAGAGTGAGCAAGG + Intronic
1009279092 6:61723853-61723875 TACCTGAAGGAGAGGGAGAATGG + Intronic
1009488766 6:64260210-64260232 TATCTTAAACACAGTGAGAATGG + Intronic
1009565888 6:65310635-65310657 TGACTGTAGCAGAATGAGAAGGG - Intronic
1009822803 6:68826433-68826455 TGGCTGGAGCAGAGTGATCATGG + Intronic
1010351197 6:74876618-74876640 CAGCTGGAGTAGAGTGAGCAAGG + Intergenic
1010649266 6:78432235-78432257 CAGCTTCAGCATAGTGAGAAAGG + Intergenic
1011388922 6:86829397-86829419 TACCTGAAGCAGAGTGAATGAGG + Intergenic
1011423829 6:87203925-87203947 AAGCCTAAGCAGAGTGAGGAGGG + Intronic
1011625015 6:89275629-89275651 TAGGTGAAGCAGAGTCCCAAGGG + Intronic
1012285751 6:97385719-97385741 TAGCTGAAGTATAAGGAGAAGGG - Intergenic
1012384025 6:98656248-98656270 TGCCTGAAGCACTGTGAGAAAGG - Intergenic
1012415142 6:99005013-99005035 TGGCTGGAGCAGAGTGAGCCAGG - Intergenic
1012417734 6:99027779-99027801 TGGCTGCAGCTGAGTGAGCAAGG + Intergenic
1012566139 6:100655090-100655112 TATATGAAGCAGAGTTATAAAGG + Intronic
1013548448 6:111183178-111183200 TGGCAGAAGCAGAGTGGGCAAGG - Intronic
1013635404 6:112024607-112024629 TGGCTGAAATGGAGTGAGAAAGG - Intergenic
1013774183 6:113660849-113660871 AAGCTGGAGCAGATTGAGTATGG + Intergenic
1014002939 6:116385150-116385172 TGGCTGGAGCAGAGAGAGACTGG + Intronic
1014472068 6:121828183-121828205 TAACTGGAGCACAGTGAGAGAGG + Intergenic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1016546509 6:145229909-145229931 TAAGTAAAGAAGAGTGAGAAAGG - Intergenic
1016550841 6:145278283-145278305 CAGCTGAAGCAAAAAGAGAAAGG + Intergenic
1016580426 6:145623502-145623524 TGGCTAGAGCAGAGTGAGAGAGG + Intronic
1016788141 6:148036145-148036167 TGTCGGAGGCAGAGTGAGAAGGG + Intergenic
1016989080 6:149917072-149917094 TAGCTGAGGCGGAGAGAGAGAGG + Exonic
1017113920 6:150959301-150959323 AAGCTTACGCAGAGAGAGAATGG - Intronic
1018896105 6:168018712-168018734 TAGCTGAAGGAGGATGAGCAGGG - Intronic
1019960229 7:4452918-4452940 AAGCTCAAGCAGAGAGAGAGAGG - Intergenic
1020963249 7:14832771-14832793 TAGTGGAAGCAGATTGAGCAAGG - Intronic
1021052734 7:16009003-16009025 TGGCTGAACCATAGTGAGCAGGG + Intergenic
1021374712 7:19891641-19891663 TATTTATAGCAGAGTGAGAATGG + Intergenic
1021979939 7:26044468-26044490 TGGCTGGAGCAGAGTCAGCAAGG - Intergenic
1022218778 7:28291484-28291506 TAGCAGAAGCAGATTGACAGAGG - Intergenic
1023119984 7:36899407-36899429 CAGGTGAAGAAGAGGGAGAAGGG + Intronic
1023934188 7:44727498-44727520 TGGCTGGAGCATAGTGAGCAAGG + Intergenic
1024340953 7:48258763-48258785 TAGCTAAAGCAGTGTGAAGAGGG - Intronic
1024683924 7:51724384-51724406 TAGGTGACACAGAGTGCGAAAGG - Intergenic
1025756645 7:64350944-64350966 TAGCTGGAGCAGAGTGCTAGTGG + Exonic
1026363537 7:69625177-69625199 TAGCAGAAGCGGACTCAGAAAGG + Intronic
1026477157 7:70746702-70746724 TGGCTGAAGGAGAGGGAGAGGGG + Intronic
1028021804 7:85785874-85785896 TAGATGAGGCAGGGTGGGAAAGG + Intergenic
1028276389 7:88863104-88863126 TTGCTGTAGCATAGTGAGCACGG - Intronic
1028850339 7:95530616-95530638 TGGCTGAAGTGGAGTGAGCAAGG + Intronic
1029400870 7:100345046-100345068 TAGCTGAGGCGGAGAGAGAGAGG + Intronic
1030278731 7:107747193-107747215 TCTGTGAAGCAGAGTGGGAAGGG + Intronic
1031067491 7:117120968-117120990 TAGATCAAGTAGAGAGAGAAGGG + Intronic
1031528845 7:122852685-122852707 TAGCTGGAGCAGAGAGAGCAAGG + Intronic
1032088576 7:128896995-128897017 TGCCTGAGGCAGAGTGGGAAAGG - Intronic
1033623791 7:143088442-143088464 GAGCTGAAGCAGGGTGAGGCAGG + Intergenic
1033652113 7:143351574-143351596 TAGCTGAAGAGCAGTGGGAAAGG - Exonic
1033801587 7:144908388-144908410 AAGGTGAAGCAGAGAGAGAAAGG + Intergenic
1033871432 7:145758735-145758757 TGGCTGAAGCTGAGTGAGTAGGG - Intergenic
1034431102 7:151041560-151041582 CACCTCAAGCAGAGGGAGAACGG - Intronic
1034889501 7:154827613-154827635 AAGCCCAAGCAGAGTGAGGAGGG + Intronic
1034889519 7:154827677-154827699 CAGCCCAAGCAGAGTGAGGAGGG + Intronic
1035077273 7:156189004-156189026 TCGCTGCAGCAGAGTGACAGAGG - Intergenic
1036606321 8:10308684-10308706 TAACTGAAGCACAGTGAGCATGG - Intronic
1037624959 8:20598580-20598602 AACCTTAAGCAGAGTGAGGAGGG - Intergenic
1037716977 8:21409026-21409048 CAGCTGAAGAAAACTGAGAATGG + Intergenic
1038142133 8:24857336-24857358 TAACTCAAGCAGAGTAAAAAGGG - Intergenic
1038379552 8:27079860-27079882 TACTTGAAGCAGAGAGAGGATGG - Intergenic
1038576892 8:28712267-28712289 TGGCTGAAGCTGAGAGAGCAAGG + Intronic
1038694595 8:29795123-29795145 TATTTGGAGCAGAGTAAGAAGGG - Intergenic
1039458856 8:37726972-37726994 TAGCTGAAGGAGGGAGAGAAGGG + Intergenic
1039580002 8:38657727-38657749 CAGCTCAAGCAGAGTGAGAATGG - Intergenic
1039866770 8:41511811-41511833 CAGCTGCAGCAGAGTGACATTGG - Intergenic
1039907042 8:41794281-41794303 TGGTTGAAGCAGAGTGAGGCAGG - Intronic
1040105002 8:43536521-43536543 CAGCTGAGGCAGAGAGAGAGAGG + Intergenic
1041383935 8:57279422-57279444 CAGCTTCAGGAGAGTGAGAAAGG + Intergenic
1041507006 8:58610303-58610325 CAGTTAAAGCAGAATGAGAAGGG - Intronic
1042089253 8:65140822-65140844 CCGCTGGAACAGAGTGAGAACGG + Intergenic
1043162081 8:76858187-76858209 TAGGTGAAAGAAAGTGAGAAAGG + Intronic
1043242361 8:77951399-77951421 TGGCTGAAGTAGAGTCAGAGAGG + Intergenic
1044159834 8:88899365-88899387 TAGCTGAGGCAGAGAGAGAGAGG - Intergenic
1044186253 8:89255263-89255285 TCGCTGTAGCAGTGTGAAAATGG - Intergenic
1044287677 8:90428048-90428070 TAGCTGGAACAGAGTCAGCAAGG + Intergenic
1044576287 8:93773268-93773290 TGGCTGGAGCAGAGTGAGCAGGG + Intronic
1045152969 8:99429956-99429978 TGGCTTCAGCAGAGTGAGCAAGG - Intronic
1046287164 8:112109154-112109176 TGGCTAATGCAGAGTGAGGAAGG + Intergenic
1046882925 8:119330436-119330458 TACTTGCAGCAGTGTGAGAACGG - Intergenic
1047171062 8:122492626-122492648 TGGCTGCAGCAGAGTTAGCAAGG + Intergenic
1047236817 8:123048900-123048922 AGGCTGGAGCAGAGTGACAAGGG - Intronic
1047343378 8:124003945-124003967 TAACTGAAGCAAAGTAAGATAGG + Intronic
1047367884 8:124228983-124229005 TGGCTGGAGCAGAGTGAGCTTGG + Intergenic
1047648666 8:126896426-126896448 TAGCTAAAACAGAGTAGGAAAGG - Intergenic
1048047404 8:130785850-130785872 CAGCTGGAGCAGAGTGAGAGAGG - Intronic
1048182891 8:132212749-132212771 GAGGTGAAGCAGAGTGAGGCGGG - Intronic
1048317697 8:133374527-133374549 GAGCAGAAGGAGAGTGAGAGCGG - Intergenic
1048317703 8:133374578-133374600 GAGCAGAAGGAGAGTGAGAGCGG - Intergenic
1048384650 8:133900901-133900923 GAGCCTAAGCAGAGTGAGGAGGG - Intergenic
1049251963 8:141594015-141594037 TAGCTGGAGCAGAGTGAGCCAGG + Intergenic
1049516222 8:143058422-143058444 CAGCTGAGGCAGAGAGAGAGAGG + Intronic
1049662750 8:143827534-143827556 GAGCTGAAGCAGCATGAGACAGG + Intronic
1049986221 9:954292-954314 AAAGTGAAGCAGAGAGAGAAGGG + Intronic
1050136080 9:2466142-2466164 TAGCTGAAACAGAGACAGACAGG - Intergenic
1050694845 9:8267147-8267169 TGGCTGAAACAGAATGTGAAAGG + Intergenic
1051046277 9:12878379-12878401 TAGGTTAACCATAGTGAGAAAGG - Intergenic
1051100541 9:13515881-13515903 TAGCTGGAGCAGAGAGAATAAGG + Intergenic
1051603936 9:18901659-18901681 TAGCCAAAGAAGAATGAGAAAGG + Intronic
1051729920 9:20130545-20130567 TAGCTGAAGCAGAATTAGGAAGG + Intergenic
1051767958 9:20544985-20545007 TAGCTGAGGCTGAGGTAGAAGGG + Intronic
1052030109 9:23618936-23618958 TTGCTGGAGCAGAGTGAGCAGGG - Intergenic
1052088755 9:24300216-24300238 TAGCTGAAATATAGTGAGAAAGG + Intergenic
1053221260 9:36315279-36315301 GAACTGAAGCAGGGTGACAAGGG + Intergenic
1053350407 9:37410312-37410334 TAGATGAGGCAGAGTGAGGGAGG + Intergenic
1053621891 9:39828046-39828068 TAACTGGAACAGAGAGAGAAGGG - Intergenic
1053707593 9:40770034-40770056 CAGCTGCAGGAGAGTGGGAATGG + Intergenic
1053837824 9:42159904-42159926 TAACTGGAACAGAGAGAGAAGGG - Intergenic
1053883194 9:42616226-42616248 TAACTGGAACAGAGAGAGAAGGG + Intergenic
1053889475 9:42678073-42678095 TAACTGGAACAGAGAGAGAAGGG - Intergenic
1054222218 9:62423699-62423721 TAACTGGAACAGAGAGAGAAGGG + Intergenic
1054228495 9:62485473-62485495 TAACTGGAACAGAGAGAGAAGGG - Intergenic
1054417506 9:64890820-64890842 CAGCTGCAGGAGAGTGGGAATGG + Intergenic
1055529631 9:77171098-77171120 TAGGTGAGGCAGAGTGACAGTGG + Intergenic
1058201667 9:102050012-102050034 TGCCTGAAGCACAGTGAGAAAGG - Intergenic
1058353040 9:104049416-104049438 TAGATGGAGCACAGTGAAAATGG + Intergenic
1058862245 9:109127723-109127745 GAGGTGAGGCAGAGTGAGCAGGG - Intergenic
1059750207 9:117240493-117240515 TGACTGGAGCAGAGTAAGAAAGG + Intronic
1060008690 9:120024291-120024313 TGCCTGAAGAAAAGTGAGAAGGG - Intergenic
1060745497 9:126128219-126128241 TAGCAGCAAGAGAGTGAGAAGGG - Intergenic
1060952028 9:127610067-127610089 GTGCTGAAGCAGATGGAGAAGGG - Intergenic
1060960978 9:127680455-127680477 TGGCTGATGCAGAGTGAGCGAGG - Intronic
1060970883 9:127737192-127737214 CAGCAGCAGCAGAGTGGGAAAGG - Intergenic
1061287208 9:129630906-129630928 TAAAGGAGGCAGAGTGAGAATGG - Intronic
1062557614 9:137122021-137122043 TAGCCGAGGCGGAGAGAGAATGG - Intergenic
1062642310 9:137525527-137525549 TAGCCGAGGCGGAGAGAGAATGG + Intronic
1203570851 Un_KI270744v1:129153-129175 TAGCTGAAGGAGTTTGAGAGAGG - Intergenic
1187055006 X:15734652-15734674 TAGGTGGATCAGAGTGAGAAAGG + Intronic
1187549522 X:20287952-20287974 TGGCTGAAGCAGAGACAGCAAGG - Intergenic
1187692254 X:21881156-21881178 AAGATTAATCAGAGTGAGAAAGG + Intronic
1187731379 X:22258642-22258664 TGGCTGGAGCAGAGCGAGCAAGG + Intergenic
1187765462 X:22636920-22636942 TAGCTGGAGCTGAGTGAGAAAGG + Intergenic
1187776526 X:22765793-22765815 AAGCTGAAGCAGAGAGCCAATGG - Intergenic
1188020688 X:25153897-25153919 TAGCTGAATCAGAGTGAATTAGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188666702 X:32831581-32831603 GAGCAGAAGGAGAGAGAGAAGGG + Intronic
1188955663 X:36432961-36432983 TAGCCGAGGCAGAGAGAGAGAGG + Intergenic
1189482738 X:41405727-41405749 CAGCTGGAGCAGAGTGAGCCGGG - Intergenic
1189952790 X:46249490-46249512 TAGATCAAGTAGAGTGAGCAAGG + Intergenic
1190286771 X:48966683-48966705 TAGATGGAGCAGAGCGATAAGGG + Intronic
1190393838 X:49959873-49959895 TTGCTGAAGCAGAGTGAAAATGG - Intronic
1190458558 X:50647894-50647916 GAGCTGGAGCACAGTGAGCAAGG + Intronic
1191099369 X:56708902-56708924 TAGCTGAAGTAGTGTTAGGAGGG - Intergenic
1191135997 X:57066327-57066349 TGGCTGGAGCTGAGTGAGCAAGG - Intergenic
1191613022 X:63136870-63136892 TGCCTGAAGCAGAGTGGGGAAGG - Intergenic
1191623275 X:63242056-63242078 TGCCTGAAGCAGAGTGGGGAAGG + Intergenic
1191713879 X:64180569-64180591 TGGCTGAAGTAGAGTGAGTGAGG - Intergenic
1191833069 X:65435954-65435976 TATTTGAAGCAATGTGAGAATGG - Intronic
1192055171 X:67766477-67766499 TCCCTGAGGCAGAGTGAGCAAGG - Intergenic
1192322081 X:70098119-70098141 TGGCTGGAGCAGAGTGAACAAGG + Intergenic
1192733409 X:73824572-73824594 TAGTTAAACCACAGTGAGAAGGG - Intergenic
1193300443 X:79882086-79882108 TAGCTGAGGCAGGGTGTTAATGG - Intergenic
1193436330 X:81478636-81478658 TAGCCCAAGCAGAGTGCTAAGGG + Intergenic
1193611354 X:83635046-83635068 TAGCTGAGGCTGAGAGAGAGAGG + Intergenic
1194979868 X:100429178-100429200 TACCTGAAGCAGCCTGAGATTGG - Intergenic
1195005013 X:100677277-100677299 TGGTTGAAGCATAGTGAGCAAGG + Intronic
1195013041 X:100752098-100752120 GAGCCCAAGCAGAGTGAGGAAGG + Intergenic
1195665728 X:107428773-107428795 TAGCTGCAGCTGAGTGACATTGG - Intergenic
1196704522 X:118705411-118705433 TAGCTGCAGCAGAGAGTGTATGG - Intergenic
1196764645 X:119231877-119231899 TAGCTGTAGTAGAGTGACCAGGG + Intergenic
1196830611 X:119772786-119772808 TGGCTGGAGCAGAGTGAGGGAGG - Intergenic
1197235742 X:124060515-124060537 TAACTGAAGGGGAGTGATAATGG - Intronic
1197662179 X:129186250-129186272 TAGTTGAATCAGAATCAGAATGG + Intergenic
1197881736 X:131173772-131173794 TGGCTAAAGCAGAGTGATTAAGG + Intergenic
1198317114 X:135479055-135479077 TAGCTGATGAAGAGACAGAATGG - Intergenic
1198344691 X:135747862-135747884 CAGCTGAGGCAGAGAGAGAGAGG + Intergenic
1198886750 X:141347220-141347242 TAGCTGAAACAGTGTGAAAGAGG + Intergenic
1199177060 X:144801633-144801655 TGGCTGAAGCATAATGAGAAAGG - Intergenic
1199222569 X:145334337-145334359 TAGCTGCAGCAGACTAAGTAAGG + Intergenic
1199538707 X:148933249-148933271 CAGCTGAAGCAGAGTAAGCAAGG + Intronic
1200250103 X:154548217-154548239 TAGCTGGAGCAGAGTGAGGGAGG + Intronic
1200405338 Y:2804921-2804943 CAGCTAAAGCAGAGTTAAAAGGG - Intergenic
1201543803 Y:15138498-15138520 CAGCTGAGGCAGAGAGAGAGAGG - Intergenic
1201730081 Y:17193246-17193268 AAGAAGAAGCAGAGTGTGAAGGG + Intergenic
1202166159 Y:21990990-21991012 TGGCTGAAGCATAGTGTGGAAGG + Intergenic
1202225199 Y:22595383-22595405 TGGCTGAAGCATAGTGTGGAAGG - Intergenic
1202317915 Y:23600278-23600300 TGGCTGAAGCATAGTGTGGAAGG + Intergenic
1202552851 Y:26069780-26069802 TGGCTGAAGCATAGTGTGGAAGG - Intergenic