ID: 1103646801

View in Genome Browser
Species Human (GRCh38)
Location 12:122400199-122400221
Sequence ATGAATGTGAATGAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 444
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 397}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103646801_1103646804 26 Left 1103646801 12:122400199-122400221 CCTTCCACTTCATTCACATTCAT 0: 1
1: 0
2: 4
3: 42
4: 397
Right 1103646804 12:122400248-122400270 AAAAGATAAATAAGATTGAAGGG 0: 1
1: 0
2: 55
3: 195
4: 1692
1103646801_1103646803 25 Left 1103646801 12:122400199-122400221 CCTTCCACTTCATTCACATTCAT 0: 1
1: 0
2: 4
3: 42
4: 397
Right 1103646803 12:122400247-122400269 AAAAAGATAAATAAGATTGAAGG 0: 2
1: 1
2: 34
3: 214
4: 2139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103646801 Original CRISPR ATGAATGTGAATGAAGTGGA AGG (reversed) Intronic
902153543 1:14464450-14464472 ATGTAAGTGAATGATCTGGAGGG - Intergenic
902616014 1:17624027-17624049 CTGAACGTGAATGCAGTAGAAGG + Intronic
902741838 1:18444252-18444274 TTGAATGGGAAGGAACTGGAAGG - Intergenic
903672974 1:25047287-25047309 ATTCATATGAATGAGGTGGAGGG + Intergenic
905163793 1:36063690-36063712 ATGAATGTGAATAAATTGGAAGG + Exonic
905358367 1:37400828-37400850 ACGAATGCAAATGAATTGGAGGG - Intergenic
906344209 1:45005132-45005154 CTGAATGTGAACCAAGTGGCTGG + Intronic
906506248 1:46382057-46382079 ATGATTATGAATGGAGTGAAAGG - Intergenic
906771966 1:48493465-48493487 GTGAAGGTGACTGAGGTGGAGGG + Intergenic
908384173 1:63625174-63625196 AAGAATGTGGAAGAAGTGGTAGG + Intronic
908422911 1:63977053-63977075 AAGAATGAGAGTGAAGTGGGGGG + Intronic
908492363 1:64658881-64658903 AAGAATGTGAAGGAAGTGTAAGG - Intronic
908959916 1:69684446-69684468 AGGAAGGTGAAAGAAGGGGAGGG + Intronic
909328674 1:74385840-74385862 ATGAAAGTGCATAAATTGGATGG + Intronic
910214034 1:84824212-84824234 AGGAGTATGAATGAAGTGGCAGG + Intronic
910872965 1:91851899-91851921 CTGAATGTGCATATAGTGGAGGG - Intronic
911196823 1:95003207-95003229 TTGAAAGTGAATGAACTGCAGGG + Intronic
911814663 1:102331420-102331442 AACAAAGTGAATGATGTGGAGGG + Intergenic
912951171 1:114121455-114121477 AACAATGTGAATGCAGTGAAGGG - Intronic
913423446 1:118699255-118699277 ATGAATGTCAATGCTTTGGAAGG + Intergenic
914045491 1:144088157-144088179 ATTATTGTGAATGAAGTGAAAGG - Intergenic
914132619 1:144872528-144872550 ATTATTGTGAATGAAGTGAAAGG + Intergenic
915027715 1:152847906-152847928 ATGCATGTGAAAAAAGGGGATGG - Intergenic
915072426 1:153281617-153281639 TTGGATGTGGATGAAGAGGAAGG + Intergenic
915713663 1:157924817-157924839 AAGAATGTGGAGGAAGTGCAGGG + Intergenic
916368192 1:164057778-164057800 ATGAATGAGAAGAAAGAGGAAGG - Intergenic
916592522 1:166206255-166206277 ATGAATATGAGTGAAGTTGGGGG + Intergenic
916987669 1:170208542-170208564 AAGAATGAGAATCAAGTGAAGGG - Intergenic
917067541 1:171113177-171113199 ATGAATGTGAATACAGTTGAAGG - Intronic
917225771 1:172780568-172780590 ATGTCTGCAAATGAAGTGGATGG + Intergenic
918036480 1:180878134-180878156 ATGAAAGAGAAAGAAGTGGGTGG - Intronic
918170780 1:181995366-181995388 AAGGATGTGAATGCAGTGAATGG + Intergenic
918923258 1:190744186-190744208 ATGAATATAAATGAGTTGGAAGG - Intergenic
919360540 1:196588248-196588270 CTGAATGTGAATTAAATAGATGG + Intronic
919730264 1:200909136-200909158 AAGAATGGGGATGCAGTGGAAGG - Intronic
920985283 1:210883181-210883203 ATGAATGTAAATGAAGTCATAGG + Intronic
921324431 1:213977240-213977262 CTGAATGTGAATTATGGGGAGGG - Intergenic
921765336 1:218965792-218965814 ATGAATGAGAATGAAGTTTGGGG - Intergenic
923237364 1:232047174-232047196 AAGAATTTTAATGAAGTGGTGGG - Intergenic
924274146 1:242368254-242368276 ATGAAGGGGAATGAAGGAGAAGG - Intronic
1063714127 10:8510457-8510479 TTGAATGAGAGTGAAGAGGATGG - Intergenic
1063865456 10:10360443-10360465 ATGCATGTGAAAAAAGAGGAAGG + Intergenic
1064797707 10:19032231-19032253 AAGAATGTGCATAAAGTAGACGG - Intergenic
1066631513 10:37463164-37463186 AGGCATTTGAATGAAGAGGAGGG - Intergenic
1066767722 10:38817814-38817836 ATGAATTTGACTCAAATGGAAGG - Intergenic
1067189707 10:44059192-44059214 ATAGATGTGAAGGAAGTGGAAGG + Intergenic
1068046146 10:51889040-51889062 AAGAATGTGTGTTAAGTGGAGGG - Intronic
1068203857 10:53822223-53822245 ATGAAGCTGAAGGAGGTGGAGGG + Exonic
1068761642 10:60717720-60717742 ATGAGTGGTAATGAAGTTGAAGG - Intronic
1069295663 10:66841427-66841449 ATCCATTTGAATGAATTGGAAGG - Intronic
1069851385 10:71407436-71407458 ATGGGAGTGAATGAGGTGGATGG + Intronic
1070477683 10:76846190-76846212 ATCAAAGTGAATAAAGCGGATGG + Intergenic
1071270808 10:84005635-84005657 ATGAATGTGGTTGAAATGTATGG + Intergenic
1073887702 10:108059548-108059570 ATAAATGAGAAGGAAGAGGAAGG - Intergenic
1075201029 10:120404321-120404343 ATGAATGGGTAGCAAGTGGATGG + Intergenic
1075889791 10:125937809-125937831 GTGAGTGGGAATGAGGTGGAAGG + Intronic
1076418116 10:130306940-130306962 ATTAATATGTATGTAGTGGAAGG - Intergenic
1077719776 11:4616272-4616294 ATGAAAGAGAGTAAAGTGGATGG - Intergenic
1078717216 11:13851592-13851614 ATTAATCTGAATCAAGGGGAAGG + Intergenic
1079221940 11:18570830-18570852 GTGAATGTGGATGAAATGGGGGG - Intronic
1079563834 11:21855872-21855894 AACTATGGGAATGAAGTGGAAGG - Intergenic
1080214161 11:29822507-29822529 ATGAATGTGAGCTCAGTGGAAGG + Intergenic
1080254526 11:30274630-30274652 ATTATTGTGTATGAAGTGGCAGG - Intergenic
1080257324 11:30305593-30305615 ATGACTGGAAATGAAGTGGAAGG + Intergenic
1080783825 11:35456266-35456288 ATGAATTTGAATGAGGTGCAGGG + Intronic
1080819933 11:35795923-35795945 ATTAATGTATATGAAGTGGTTGG - Intronic
1081268784 11:41058903-41058925 AGGAATGTGAATGAAGCTGAAGG + Intronic
1083215421 11:61215778-61215800 ATGAGTGTGAATGAAAAGGATGG - Intergenic
1083218305 11:61234607-61234629 ATGAGTGTGAATGAAAAGGATGG - Intergenic
1083229393 11:61306224-61306246 ATGAGTTAGAATGAAGTGAAGGG - Intronic
1084185107 11:67467409-67467431 GTGAATGTGAAGGAGGTGGAGGG + Intronic
1086862491 11:91941377-91941399 TTGCTTGTGAATGAAGGGGAAGG - Intergenic
1087334701 11:96829025-96829047 CTGAATGTGAATAACTTGGATGG + Intergenic
1087501024 11:98953852-98953874 ATTAATGTGAATGATTTAGAAGG + Intergenic
1087509462 11:99072153-99072175 ATGAATGGGAAGGGAGTTGAGGG + Intronic
1087976354 11:104552610-104552632 AGGTATGTGGATGAAGTGAAAGG - Intergenic
1088640030 11:111863507-111863529 TTGACTGTGAGTGGAGTGGAGGG - Intronic
1088725574 11:112631507-112631529 ATGAATGTGAAGGAAGGGCAAGG + Intergenic
1089342245 11:117765990-117766012 ATGGATGAGAATGAAGGGGCAGG - Intronic
1089870914 11:121671992-121672014 ACCAATGGGAATGAAGGGGATGG - Intergenic
1090099364 11:123778007-123778029 AAGTATGTGACTGAATTGGATGG - Intergenic
1090503431 11:127284194-127284216 ATGAATGTGCTTGCAGTTGAGGG - Intergenic
1090573491 11:128073309-128073331 ATGGACGTGAATGAGATGGAAGG - Intergenic
1091141932 11:133242715-133242737 ATGAATGTGAGAAAAGGGGAGGG + Intronic
1091418870 12:317295-317317 ATGAGTAGGATTGAAGTGGAAGG - Intronic
1094128832 12:27052901-27052923 AGGAATGTGAATGGAGCTGAAGG - Intronic
1096071381 12:48777232-48777254 CTGAATGGGAAGGAATTGGAGGG + Intronic
1096372746 12:51082986-51083008 AGGAAAGTGAAGGAAGGGGAGGG - Intronic
1096793163 12:54057827-54057849 ATGTATGTGAGGGAAGAGGAAGG - Intergenic
1097740322 12:63234088-63234110 ATGACTTTGAATAAAATGGAAGG + Intergenic
1098210221 12:68156020-68156042 ATCCAGGTGCATGAAGTGGAAGG + Intronic
1098423652 12:70333577-70333599 TTAAATGTAAAGGAAGTGGAAGG + Intronic
1098738715 12:74142593-74142615 AAGAGTGTGAAGGATGTGGAAGG - Intergenic
1099305374 12:80948139-80948161 TTGAAATTCAATGAAGTGGATGG + Intronic
1099319520 12:81128607-81128629 ATGAATGTGAATTGGGTGAACGG + Intronic
1100875119 12:98953593-98953615 AGGAATGTGCATGAGGTGGAGGG - Intronic
1102035318 12:109767912-109767934 ATGAATGGGAAATGAGTGGAGGG + Intronic
1102227708 12:111240639-111240661 ATGAGGGTGGATGAGGTGGATGG - Intronic
1102837738 12:116081756-116081778 ACTAATGTGATTGAGGTGGAAGG + Intronic
1103097411 12:118143146-118143168 AACAATGTGAATGTAGTGGTCGG - Intronic
1103456200 12:121067918-121067940 ATGAATTTGGATAAAGTGGTTGG - Intergenic
1103646801 12:122400199-122400221 ATGAATGTGAATGAAGTGGAAGG - Intronic
1105354708 13:19649109-19649131 AAGCAGGTGAATGAAGTGGCAGG + Intronic
1106157049 13:27169219-27169241 ATGAAACTGTATGAAGGGGATGG + Intronic
1106394077 13:29363356-29363378 ATGAATGTGATTGTAGATGATGG + Intronic
1106995076 13:35471401-35471423 ATGCATTTGAGAGAAGTGGAAGG + Intronic
1107050138 13:36038228-36038250 ATGGGTGTGAATGAAGAGGCAGG + Intronic
1108807460 13:54176437-54176459 CTCAATGAGAATGCAGTGGAAGG - Intergenic
1109109540 13:58298860-58298882 ATGTATGTGAATGACAAGGAAGG + Intergenic
1109843660 13:67954103-67954125 ATGAATGTGGAAGAAGCTGAAGG - Intergenic
1109898450 13:68728211-68728233 ATGAAATTTAATGAAGAGGAAGG - Intergenic
1110360130 13:74615367-74615389 ATGAATGTGTACCAGGTGGAGGG + Intergenic
1111350439 13:87021675-87021697 ATAAAGGGGAATGAAGTAGATGG + Intergenic
1111359441 13:87155996-87156018 ATGAATGGAAATGCAGTGAATGG + Intergenic
1111710828 13:91812065-91812087 CTGACTGTGAATAAAGTGGCAGG + Intronic
1111921982 13:94421950-94421972 ATGATAGTGTATGAAGGGGAAGG + Intergenic
1112634693 13:101202504-101202526 AAGAGTGTGATTGAATTGGAGGG - Intronic
1112811592 13:103224847-103224869 ATGAATCAGAATGAAGTGAAAGG - Intergenic
1113997578 14:16100904-16100926 ATGAAATTGAATGCAGTGGAGGG - Intergenic
1114682717 14:24499875-24499897 ATGATTGTGAAAGCAGTAGAAGG + Intergenic
1115444468 14:33473333-33473355 TTGCATGTGAATCATGTGGAGGG - Intronic
1115499174 14:34034217-34034239 AGCAATGTGACTGAAGAGGACGG + Intronic
1116479458 14:45381432-45381454 ATGAATGAGAATAAAATGGAGGG + Intergenic
1117539924 14:56737057-56737079 ATGAGTGTGAAAGATGAGGAAGG - Intergenic
1118946707 14:70395220-70395242 AAGAATCTGAATGAAATGAAGGG - Intronic
1119187652 14:72654209-72654231 ATGAGCGTGAATGGAGTGGAAGG - Intronic
1120631914 14:86901941-86901963 ATGACTATGAATACAGTGGAAGG + Intergenic
1120654935 14:87178111-87178133 CTGATTGTGAGTGAAATGGAGGG + Intergenic
1122160228 14:99778527-99778549 AGGAATCTGCAGGAAGTGGATGG - Intronic
1122166445 14:99827955-99827977 TTGCCTGTGAATGAAATGGAGGG + Intronic
1124664413 15:31580204-31580226 TTAAGTGTGGATGAAGTGGAGGG + Intronic
1127548274 15:60010502-60010524 ATGAGAGTGAATGAAGTGGCCGG - Intronic
1128404126 15:67317766-67317788 ATGTAATTGAATGAAGAGGAAGG + Intronic
1128824119 15:70694563-70694585 ATGAATGAGAATAAAATGAATGG + Intronic
1130141127 15:81227404-81227426 AAGGACCTGAATGAAGTGGAGGG + Intronic
1130158575 15:81375584-81375606 AAGCATGGGAACGAAGTGGAAGG + Intergenic
1130294099 15:82631282-82631304 ATGTATGTGAGAGAAGGGGAGGG - Intronic
1131263015 15:90898968-90898990 ATGAATGTCAAAGACGTGGTTGG + Intergenic
1131920017 15:97315944-97315966 ATGCATGTGAATGAAATGCTTGG + Intergenic
1133042669 16:3068801-3068823 ATGGAGGTGAATGCAGAGGAGGG + Intronic
1133582871 16:7163402-7163424 ATCAATGTGTATGAAGCGGCTGG + Intronic
1133718135 16:8468843-8468865 AGAAGTGAGAATGAAGTGGAAGG + Intergenic
1134324388 16:13193715-13193737 AGGAGGGAGAATGAAGTGGAAGG + Intronic
1134617558 16:15663221-15663243 AAGAATATGAAAGAACTGGAAGG - Intronic
1134773956 16:16835814-16835836 AGAAATCTGAACGAAGTGGAAGG - Intergenic
1136746186 16:32594264-32594286 ATGAGTGTGAATTAACTGGCTGG - Intergenic
1138485400 16:57339599-57339621 AGGAATGAGAATGAAGTAAAAGG + Intergenic
1139878395 16:70164516-70164538 ATGAATGGGCAAAAAGTGGAGGG + Intergenic
1140359169 16:74330300-74330322 ATGAATGGGCAAAAAGTGGAGGG - Intergenic
1140568248 16:76070050-76070072 ATGACTTTGAATGGAATGGAAGG - Intergenic
1141609714 16:85174525-85174547 ATGAATGGGAAGGAGGGGGAGGG - Intronic
1142143983 16:88485088-88485110 ATGAGTGTGAGGGAAGTGCACGG + Intronic
1203048315 16_KI270728v1_random:853468-853490 ATGAGTGTGAATTAACTGGCTGG - Intergenic
1143980488 17:10865258-10865280 TTGAATGTGAAGGAAGAGGATGG - Intergenic
1145914491 17:28563597-28563619 CTGAATGTGAGTGAAGGGGTGGG - Intronic
1146146542 17:30423535-30423557 ATGCATGGAAATGAAGTGGTTGG + Exonic
1146671957 17:34744666-34744688 ATAAATGATATTGAAGTGGATGG - Intergenic
1147652852 17:42072051-42072073 ATGACTGTGAATGAGGTGGAGGG + Intergenic
1147878496 17:43638678-43638700 ATGCAGGTGAATGAAGGGGAGGG + Intergenic
1148261859 17:46191809-46191831 AGGATTGTGAATGGAGGGGAGGG + Intronic
1148885704 17:50771179-50771201 ATAGATGGGAATGAAATGGAAGG - Intergenic
1148963600 17:51415070-51415092 ATGAATGGTGATGAAGTTGATGG + Intergenic
1150143169 17:62746848-62746870 GTGAAGGTGAATGCAGTGGCGGG - Intronic
1150454501 17:65295867-65295889 ATGAATGTAAATGATTTGGCTGG - Intergenic
1150573620 17:66410538-66410560 AACAATGTCAATGAATTGGAAGG - Intronic
1150602171 17:66660521-66660543 ATGCATGAAAATGAAGGGGATGG - Intronic
1203178855 17_KI270729v1_random:40441-40463 ATGGATTTGAATGGAGTAGAAGG + Intergenic
1153301202 18:3593602-3593624 GGGGATGTGAATGAAATGGAGGG + Intronic
1153437268 18:5080949-5080971 ATGAATGAGAATGAAGGACATGG + Intergenic
1155289440 18:24325778-24325800 ATGAATGTGATTAAACTGGGAGG + Intronic
1155376318 18:25161896-25161918 ATCATTGTTAATGAAGTGGTTGG - Intronic
1156278612 18:35610167-35610189 TTGGATGTGAATGAAGAGCAGGG + Intronic
1156914765 18:42452739-42452761 TTGAATGTAGATAAAGTGGATGG + Intergenic
1157158370 18:45289342-45289364 ATGGAGGTGACTGAAGTTGAGGG - Intronic
1157333604 18:46721180-46721202 TTGAAGGTGAATGAATTTGAAGG - Intronic
1157492394 18:48133264-48133286 ATGGGTGCGGATGAAGTGGAAGG + Intronic
1158733926 18:60057859-60057881 ATGAATGGAAGTGCAGTGGATGG - Intergenic
1159201022 18:65184185-65184207 ATGAATGTAAATGAAGGTTAAGG + Intergenic
1160872043 19:1282118-1282140 AAGGATGTGAATGGAGAGGAAGG + Intergenic
1164081136 19:21862346-21862368 ATGGAGGTGAAGGATGTGGAAGG - Intergenic
1164891260 19:31825690-31825712 ATGAATGAGAAGGAGGTGTAGGG - Intergenic
1166241690 19:41499119-41499141 AAGAATGAGGATGAAGAGGAGGG + Intergenic
1166764823 19:45246464-45246486 ATGAATTTAAATGAAGCTGAGGG + Intronic
1167168988 19:47818430-47818452 ATAAATGTGAAAGAAATGGATGG - Intronic
1202685049 1_KI270712v1_random:41565-41587 ATTATTGTGAATGAAGTGAAAGG - Intergenic
924961558 2:39473-39495 ATGAATCTGAATGGAAGGGAAGG + Exonic
925539628 2:4952637-4952659 AAGAATGAGAACCAAGTGGAAGG - Intergenic
927070465 2:19523608-19523630 ATGAAATTGAATGAAGGGAAGGG - Intergenic
927452427 2:23220503-23220525 AACAATGGGAATGAAGTAGAGGG - Intergenic
927479797 2:23443484-23443506 ATGAAAGGGAAAAAAGTGGAGGG - Intronic
927761200 2:25756325-25756347 ATGGATGTGAATGGAGAGAAAGG - Intronic
928960544 2:36921445-36921467 ATTATTGTGAGTGAAGTGAAAGG - Intronic
929352366 2:40973088-40973110 CTGAAAGTGATTGAAGGGGAGGG - Intergenic
930489909 2:52056324-52056346 ATGATTGTGAATAAAGAGGCAGG - Intergenic
931048951 2:58388442-58388464 ATGGATGGGAATGAAGTCTAAGG + Intergenic
932981630 2:76675854-76675876 ATGCATGTTACTGAAGTAGAAGG - Intergenic
933069726 2:77842194-77842216 ATGAATGAGAATCAACTGGAGGG + Intergenic
934246669 2:90313292-90313314 ATTATTGTGAATGAAGTGAAAGG + Intergenic
939501085 2:142985444-142985466 ATCAATTTGAATTAAGTGTAGGG - Intronic
939860982 2:147420174-147420196 AAGAATGAGAATCAAGTGAAAGG + Intergenic
940117808 2:150228487-150228509 ATAAATGGGAATGAAGTAGTTGG - Intergenic
941352318 2:164451897-164451919 ATGAATGTGTACAAAGTGTAGGG - Intergenic
941637728 2:167953718-167953740 ATTAAAATGAATGAAGTGGTTGG + Intergenic
942363897 2:175201706-175201728 ATCAATTTGAAAGAAGAGGAAGG - Intergenic
942476762 2:176334641-176334663 ATGAATGTCAAAAGAGTGGAAGG + Intronic
943022368 2:182590530-182590552 ATGAAATTGAAGCAAGTGGAGGG + Intergenic
943123115 2:183762218-183762240 ATGAATTGAAATGAAGTGAAAGG - Intergenic
943892466 2:193307733-193307755 AAGAATGTGATTGAAATGAATGG + Intergenic
944329281 2:198446023-198446045 ATGAATGAAAATGAAGAGAATGG + Intronic
945697063 2:213120057-213120079 ATGAACTTTCATGAAGTGGATGG - Intronic
947428653 2:230006659-230006681 ATGGCTGGGAATGAAGTGGGAGG + Intronic
948043028 2:234919463-234919485 ATGACTGGGAATGAAGTGTGTGG - Intergenic
948043135 2:234920197-234920219 AAGAATGAGAATCAAGTGAAAGG + Intergenic
948781852 2:240326416-240326438 AGGAATGTGGCTGAAGGGGAAGG + Intergenic
1169090903 20:2860873-2860895 CTGAGTGGGAATGAAGTGGACGG + Intronic
1169525040 20:6415311-6415333 ATGAAAGTGAATTAAGAGGTTGG + Intergenic
1169990371 20:11496657-11496679 ATGTATGTGAGTGGAGGGGAAGG - Intergenic
1170336079 20:15271662-15271684 ATGAATGAATATGAAGTGAAAGG + Intronic
1170786119 20:19469145-19469167 ATGATTGTGACAGAAGCGGACGG + Intronic
1170987187 20:21269214-21269236 ATGAAATGGAATGAAATGGAAGG - Intergenic
1171850833 20:30306845-30306867 ATGAATGGGGAGGAAGAGGATGG - Intergenic
1171923593 20:31170790-31170812 ATGAACTTGAATGGAATGGAAGG + Intergenic
1174058615 20:47816755-47816777 AGGAGTGTGACTGAAGTGAAGGG - Intergenic
1174508549 20:51033137-51033159 ATGAATGTGAATTGAATGAATGG + Intergenic
1174843460 20:53921055-53921077 ATGCTTTTGAATGGAGTGGAGGG + Intergenic
1175561103 20:59932333-59932355 TTAAAGGTGAATGAAGGGGAGGG + Intronic
1176749255 21:10677881-10677903 ATGTACCTGAATGAAATGGAAGG - Intergenic
1176754344 21:10714655-10714677 ATGGAGTGGAATGAAGTGGAAGG - Intergenic
1176756053 21:10726550-10726572 ATGGAATGGAATGAAGTGGAGGG - Intergenic
1176756059 21:10726580-10726602 ATGGAATTGAATGGAGTGGAGGG - Intergenic
1177086187 21:16708055-16708077 TTAAATGTGAATGAAGGGTAAGG - Intergenic
1177422359 21:20876649-20876671 AAGAATGTCAATGAAGCAGAAGG - Intergenic
1183811379 22:40260641-40260663 AAGAATGTGGATGAAGGGAAGGG + Intronic
1203304760 22_KI270736v1_random:101438-101460 ATAAATTTGAGTGCAGTGGAAGG + Intergenic
1203307367 22_KI270736v1_random:118700-118722 ATGAAATGGAATGAAATGGAAGG + Intergenic
1203307374 22_KI270736v1_random:118740-118762 ATGAAATGGAATGAAATGGAAGG + Intergenic
1203311120 22_KI270736v1_random:143503-143525 ATGGAATTGAATGAAATGGAAGG + Intergenic
949792319 3:7806615-7806637 CTGTATGTAAATGAATTGGAAGG - Intergenic
950284735 3:11735768-11735790 AGGAACGTGAAGGAAGTTGAGGG + Intergenic
951495463 3:23320408-23320430 TTCAATTTGAATGAAGTGTATGG - Intronic
951665700 3:25121076-25121098 ATGCATGTGTATAAAGTGGTGGG + Intergenic
951824420 3:26852437-26852459 ATAGATGTGTATGAAGTAGAAGG + Intergenic
952604625 3:35130128-35130150 AAGAATGAGAGTGAAGTGGAGGG + Intergenic
953095635 3:39772488-39772510 ATGAATGGGAATGGGGTAGAAGG + Intergenic
953286263 3:41612736-41612758 ATGCAGGCAAATGAAGTGGAGGG - Intronic
953435267 3:42872790-42872812 ATGAAGGTGAAAGAGGAGGAGGG + Exonic
955552938 3:60103538-60103560 ATGAATGTAAAACAAGTAGAAGG + Intronic
955765420 3:62339468-62339490 AAGAATGAGAATCAAGTGAAGGG - Intergenic
956453657 3:69399338-69399360 ATAAGAGTGAATGAAATGGAAGG - Intronic
956643200 3:71433795-71433817 ATGAATGTGAATGCCCTGGTCGG + Intronic
957150061 3:76475334-76475356 TTGAATGAGGATGAAGTGGAAGG + Intronic
957169787 3:76723567-76723589 TTGTATGAGAATGAAGTGGGCGG - Intronic
957796613 3:85017208-85017230 ATGAATGACTATTAAGTGGATGG + Intronic
957897964 3:86448062-86448084 ATGACTGTGACTGAATTTGAGGG + Intergenic
958752348 3:98206720-98206742 ATGCATTTGAATCAACTGGAGGG + Intergenic
959401915 3:105913391-105913413 ATTAATGTTAATGAAGGGGAAGG - Intergenic
959575764 3:107931586-107931608 ATGAATCTGAAGGAAGTGCAAGG + Intergenic
960232875 3:115248877-115248899 ATGACTTTCACTGAAGTGGATGG + Intergenic
960427846 3:117531061-117531083 ATAAATATAAATGAAGAGGAGGG - Intergenic
961781190 3:129321026-129321048 ATGAATGTGAACTATGTGAATGG - Intergenic
962508655 3:136076133-136076155 ATGAGTTTGTATGAAGTGGCTGG - Intronic
963001722 3:140687934-140687956 ATGAAAGTGAACGAGATGGATGG + Exonic
963296201 3:143549447-143549469 AGGGATGAAAATGAAGTGGAAGG + Intronic
963359893 3:144257986-144258008 GTGAATGGGAAAGAAGGGGAAGG + Intergenic
963470986 3:145741385-145741407 AAGATTTTAAATGAAGTGGAGGG + Intergenic
963633763 3:147767653-147767675 ATGAATGTGGACCATGTGGAAGG - Intergenic
964185291 3:153934968-153934990 AAGAATAGGAATGAAGTGAAAGG - Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965189321 3:165507670-165507692 AAGAATGAGAGTGAAGTGAAAGG + Intergenic
965851077 3:173025284-173025306 AGGAATTTGAATGAAGTAAAAGG - Intronic
966728090 3:183126345-183126367 AGGACTGGGAAGGAAGTGGAGGG + Intronic
967275360 3:187768800-187768822 ATCAATTTGGATGAGGTGGAAGG + Intergenic
969697618 4:8744014-8744036 AGAAAGGTAAATGAAGTGGAGGG + Intergenic
970060347 4:12026408-12026430 GTGAATTTGAATTAAATGGAAGG - Intergenic
970117756 4:12718457-12718479 ATGAATGAAAACGAAGTGGTTGG - Intergenic
971126807 4:23763292-23763314 AAGAATGTAAAGGAAGAGGATGG + Intronic
971509324 4:27404703-27404725 AGGAGTGTGAATGAAGATGATGG - Intergenic
971751625 4:30656900-30656922 ATCAATGTGAATGGAGAAGAGGG + Intergenic
972107657 4:35510974-35510996 AGCAATGTGAATGCAGTTGAAGG - Intergenic
972388895 4:38593921-38593943 ATGAATCAGAATCATGTGGAGGG - Intergenic
973621182 4:52727694-52727716 CTGAATGTGAATGTGGTGGCTGG + Intronic
974310399 4:60200902-60200924 CTGAATCAGAATGAAGTGGAGGG - Intergenic
974631457 4:64494786-64494808 GAGAATGAGAATGAAGTGAAAGG + Intergenic
975921698 4:79398371-79398393 AAAAGTGTGAATGAAGGGGAAGG + Intergenic
977065449 4:92307286-92307308 ATGAATGTGATGAAACTGGAGGG + Intronic
977378730 4:96242257-96242279 ATCAATTTGAATGAAGAGAAAGG + Intergenic
978196039 4:105973172-105973194 GTGAATGTTAATGAAGATGAAGG - Intronic
978407879 4:108398982-108399004 TTAGATGTGAATGAAGTGGGTGG + Intergenic
980109579 4:128622360-128622382 AGGTATGTGAATGAAGGGAAAGG + Intergenic
981704916 4:147648811-147648833 ATGTATGTGAATGAGATGAATGG + Intronic
981797026 4:148606972-148606994 ATGAATATTAATGCAGAGGAAGG + Intergenic
983646773 4:169999568-169999590 ATTAATGTGAACTAAGTGTAGGG - Intronic
984115057 4:175669885-175669907 ATGAATGTGAAGGCAGTGATGGG + Intronic
984487477 4:180389102-180389124 ATGAATGTGAATTCATTGTAGGG + Intergenic
985469144 5:27033-27055 ATTAGTATGAATGAAGCGGAAGG - Intergenic
986974802 5:13382201-13382223 TTGAATGGGAAGGAAGTGCAAGG + Intergenic
987176287 5:15313942-15313964 ATGTCTGAGAATTAAGTGGAAGG - Intergenic
988130847 5:27104053-27104075 TTAAATGTGAATGATGTGAATGG - Intronic
988437508 5:31193683-31193705 TTGCAAGTGAATGAAGTGGGAGG - Intergenic
988680721 5:33481260-33481282 AGGAAGGAGAATGAAGGGGAGGG - Intergenic
989224358 5:39009084-39009106 ATGAATGTTAATAAAATGAAAGG + Intronic
990615831 5:57507408-57507430 ATGATTGTGAATGGAGATGAAGG + Intergenic
992087082 5:73287568-73287590 AAGAATGAGAATGAAGGGTAGGG - Intergenic
992556894 5:77912843-77912865 AGGAATGTGAAGGAGGAGGAGGG - Intergenic
993007610 5:82445153-82445175 ACGAATGTGTATGACTTGGAGGG + Intergenic
993121563 5:83780703-83780725 ATGAAGATGAATAAAGTGGGAGG + Intergenic
993959850 5:94284290-94284312 ATGAATGTATATGAAGTGGGTGG + Intronic
996620134 5:125490660-125490682 ATGAATGAAAATTAACTGGAAGG - Intergenic
997294215 5:132759812-132759834 ATGGCTGTGAATGAGGTGGGTGG + Intronic
998388622 5:141772838-141772860 GTGAATGTGGATGAAGTGGATGG + Intergenic
998551684 5:143084029-143084051 ATAAAAGTCAATGACGTGGACGG - Intronic
999215865 5:149934594-149934616 ATGGCTGTGAATAAAGTGGATGG - Exonic
1000457317 5:161466777-161466799 ATGAAGATAAATGAAGGGGAAGG - Intronic
1000476852 5:161719576-161719598 ACAAATGTTAATGAATTGGAAGG - Intergenic
1000506571 5:162127574-162127596 ATGAATGACAATGAATTTGAGGG + Intronic
1001044666 5:168362751-168362773 ATGGAGGTGAAGGAAGGGGATGG + Intronic
1001854044 5:174995388-174995410 GTGAAGAAGAATGAAGTGGAGGG + Intergenic
1001865687 5:175103188-175103210 AAGAAAGTGAATCAGGTGGAGGG + Intergenic
1002005518 5:176230662-176230684 ATGAATTTTAACTAAGTGGAGGG - Intergenic
1002059577 5:176618629-176618651 ATGAAAATGAGTGAAGTGGATGG + Intergenic
1002220859 5:177679957-177679979 ATGAATTTTAACTAAGTGGAGGG + Intergenic
1002357785 5:178644839-178644861 GTGATGGTGAATGAAGGGGAAGG + Intergenic
1002931269 6:1636819-1636841 AGGAATGGGAATGGCGTGGAAGG + Intronic
1003557771 6:7156240-7156262 ATGAAGGGAAAGGAAGTGGACGG - Intronic
1006514240 6:34537225-34537247 ATAAATGTGAGGGAAGTGGGAGG + Intergenic
1007023785 6:38549141-38549163 ATGAATGTCTCTGAAGTGCAAGG - Intronic
1007235615 6:40389716-40389738 ATGAATGAGAAAGATGAGGAGGG + Intergenic
1007538919 6:42622798-42622820 ATGAATGTGGAAAAAGTGGCTGG - Intronic
1007713229 6:43838123-43838145 ATGAATGTGAGTGCATTTGAGGG - Intergenic
1007916661 6:45567792-45567814 ACTAATGTGATTTAAGTGGATGG - Intronic
1008067595 6:47066566-47066588 GTGAATGTGAATGAATGTGAAGG - Intergenic
1008107818 6:47459442-47459464 AAGAATGTTAATGAAATAGAGGG - Intergenic
1008398715 6:51038857-51038879 ATATATATGAATGAAGTGGTAGG + Intergenic
1008413642 6:51213989-51214011 ATGAATGTGCCCGGAGTGGATGG + Intergenic
1010408091 6:75528465-75528487 ATGCATGAGGATTAAGTGGAAGG - Intergenic
1011560065 6:88605151-88605173 TTTATTGTGAATGATGTGGAAGG + Intergenic
1012977980 6:105800350-105800372 GTGAATGTGAATGAAGGTGGTGG - Intergenic
1014260149 6:119207188-119207210 ATGAATGTGTACAAAGAGGAAGG - Intronic
1015279736 6:131420206-131420228 ATGATTGTAAATCAAGTGGGTGG + Intergenic
1015788835 6:136945849-136945871 ATGAGTGTGTATGAACTGGGTGG + Intergenic
1015812856 6:137178703-137178725 ATGAATATAAGTGAAATGGAGGG + Intergenic
1015838343 6:137447255-137447277 TTGAACGAGAATGAAGTGCAAGG - Intergenic
1015926651 6:138316915-138316937 ATGAAGGTGATAGAACTGGATGG + Intronic
1016154562 6:140788263-140788285 ATGGATGGGAATGAGGTTGAAGG + Intergenic
1018103311 6:160460394-160460416 ATGAATCTGAAATATGTGGAAGG + Intergenic
1018111622 6:160541827-160541849 ATGAATCTGAAATATGTGGAAGG + Intronic
1018116112 6:160587087-160587109 ATGAATGTAGATCATGTGGATGG - Intronic
1018131671 6:160737859-160737881 ATGAATCTGAAATATGTGGAAGG - Intronic
1018291180 6:162293693-162293715 AGGAATGTGAATACAGTGGGTGG + Intronic
1018448737 6:163884869-163884891 AAGAAAGTGAATAAGGTGGATGG + Intergenic
1021095870 7:16535389-16535411 ATGAATGAGATAGAAGAGGAGGG + Intronic
1021162114 7:17287103-17287125 ATTAGTGTGATTGAAGTGGAAGG - Intergenic
1021836891 7:24685877-24685899 ATGAATGTAAATGATGTTGATGG - Intronic
1022298046 7:29075395-29075417 AGGCATGTGAATGAAATGCACGG - Intronic
1023115205 7:36855542-36855564 ATGACTGTAACTGAAGTGGCCGG - Exonic
1024246147 7:47471853-47471875 ATCAATATGAAAGAAGTGAAGGG + Intronic
1025021969 7:55487322-55487344 TTTAATGTGACTGAAGTGGATGG - Intronic
1027460586 7:78448062-78448084 AGCAATGTGGATGAACTGGAGGG - Intronic
1027836256 7:83247886-83247908 ATGAATCTGAATGATGTGGAAGG - Intergenic
1028686782 7:93599009-93599031 ATGATGGTGAATGAAGAGAATGG + Intronic
1030170361 7:106595795-106595817 CTGACTGTGAATGAAGTGATTGG - Intergenic
1030739676 7:113093389-113093411 GTGCATGTGAATGTATTGGAAGG + Intergenic
1030866926 7:114711381-114711403 ATAAATGTAAATAAAGTGCATGG + Intergenic
1031092111 7:117370407-117370429 ATGAATGGCAATGAAAGGGATGG + Intronic
1033050606 7:138001143-138001165 ATAAATATGAAAGAAGAGGAAGG + Intronic
1033254023 7:139783970-139783992 ATGCATGTGAAGGATGTGAAGGG - Intronic
1034633241 7:152547183-152547205 ATGAATGAGGCAGAAGTGGATGG + Intergenic
1036105365 8:5832311-5832333 ATGAATATGAATGAACAAGAAGG + Intergenic
1037260806 8:17005803-17005825 ATGGATATGAATGGAGTGGAAGG + Intergenic
1037586515 8:20280454-20280476 ATGAATGTCAATGAATGGGCAGG - Intronic
1038434211 8:27523317-27523339 ATGATTATGAATGAAATGGTGGG - Intronic
1039258105 8:35741013-35741035 ATGAATGAGAGTGAGGAGGATGG - Intronic
1039406791 8:37319756-37319778 ATAAATGTGTGTGAAGTGGATGG + Intergenic
1041174486 8:55180287-55180309 ATGAATGAGCATAAATTGGATGG + Intronic
1043155553 8:76774344-76774366 TTAAATCTGAATGAAATGGATGG - Intronic
1043826432 8:84934703-84934725 GTGAAGGTGAATGAAGTGAGTGG - Intergenic
1044472055 8:92581948-92581970 ATGAATGTTAATGCCGTGGGGGG - Intergenic
1044656319 8:94552589-94552611 ATGAACTTGAATGAAGTCTACGG - Intronic
1044970174 8:97611983-97612005 AAGAATATTAATGAAGTGGCCGG + Intergenic
1046078383 8:109339081-109339103 GTGAAATTAAATGAAGTGGAGGG - Intronic
1046538012 8:115541342-115541364 ATTAATGTGTATTGAGTGGAGGG - Intronic
1046740786 8:117826747-117826769 ATAAATTCGAATGAAGTGTATGG + Intronic
1047039205 8:120974186-120974208 ATGTATGTGTATGAAGGGAAGGG + Intergenic
1048296705 8:133220147-133220169 ATGAATGTGTATGGAATGAATGG + Intronic
1050621076 9:7452593-7452615 ATGACTGTGTATGCAGTGGGAGG - Intergenic
1050839643 9:10132268-10132290 ATAAATCAGAATGAAGTGGTGGG - Intronic
1050870416 9:10560955-10560977 ATGAATGTGGGTGAATTGGGTGG + Intronic
1052659994 9:31416493-31416515 ATGAAAGAGAATGAAAGGGAAGG - Intergenic
1054907774 9:70425638-70425660 GAAAAGGTGAATGAAGTGGATGG - Intergenic
1054937792 9:70707379-70707401 TTGAATGTGAATGCTGTGCATGG - Intronic
1054939483 9:70725372-70725394 TTGAATGTGAATGCTGTGCATGG - Intronic
1054941998 9:70753703-70753725 TTCAATATGAATGAAGTGGTGGG + Intronic
1055455440 9:76467414-76467436 ATGAACCTGCATGATGTGGAAGG - Intronic
1055962158 9:81830937-81830959 ATTAACGTGAATAATGTGGAAGG + Intergenic
1057847976 9:98540027-98540049 ATGAGAGTGAAACAAGTGGATGG - Intronic
1058856080 9:109063717-109063739 ATGATCTTGACTGAAGTGGAGGG - Intronic
1059580340 9:115540002-115540024 AGGAATGTGAATTATATGGATGG + Intergenic
1059661228 9:116403438-116403460 ATCAATGTGAATTATGTGTAAGG + Intergenic
1060066384 9:120504764-120504786 AAGTATGTTAATGAAGTGGTTGG - Intronic
1061627515 9:131849767-131849789 ATGAGTGTGTATAAAGTGCATGG + Intergenic
1061699825 9:132407428-132407450 ATGCATGTGAATGCAGGGGAGGG + Intergenic
1203720596 Un_GL000216v2:10698-10720 ATGGAATTGAATGGAGTGGAAGG - Intergenic
1203720902 Un_GL000216v2:12646-12668 ATGAAATTGAATGGAATGGAAGG - Intergenic
1203728678 Un_GL000216v2:71677-71699 ATGGATATGAATGGAATGGATGG - Intergenic
1203347495 Un_KI270442v1:45420-45442 ATGGATTGGAATGGAGTGGAGGG + Intergenic
1203350041 Un_KI270442v1:72055-72077 ATGGAACGGAATGAAGTGGAGGG + Intergenic
1186616346 X:11192092-11192114 ATGAAGGTGGAAGAAGTGGTTGG - Intronic
1186948105 X:14591870-14591892 ATGAATGTTAATGAAATGTAAGG - Intronic
1187301860 X:18058746-18058768 TAGAATGTGGGTGAAGTGGACGG + Intergenic
1188299885 X:28495582-28495604 ATGAAGCTGAATGAGGTGGTAGG - Intergenic
1188520504 X:31033099-31033121 GAGAATGAGAATGAAGTGAAAGG + Intergenic
1189553792 X:42120639-42120661 ATGAATGAGAATCACCTGGAAGG - Intergenic
1189686486 X:43569317-43569339 ATAAAAGAGAATGAACTGGATGG + Intergenic
1190997625 X:55625580-55625602 AACAATGTGAACAAAGTGGATGG + Intergenic
1191939366 X:66461725-66461747 CTGGATGTGGCTGAAGTGGAGGG + Intergenic
1192933082 X:75828580-75828602 ATGAATGTAAAGCAAGTAGAAGG - Intergenic
1193332291 X:80248534-80248556 AGGAAACTGAAGGAAGTGGAAGG - Intergenic
1193435382 X:81469011-81469033 GTGAATGAGCATTAAGTGGAAGG - Intergenic
1193631490 X:83893809-83893831 ATGAATGGAAAAAAAGTGGAAGG - Intergenic
1193996678 X:88374290-88374312 ATGAATTTGAATGGTATGGATGG - Intergenic
1194550758 X:95295930-95295952 ATGAATGTAAATGATGTAAATGG + Intergenic
1194583398 X:95704395-95704417 AACAATGTGCTTGAAGTGGAGGG + Intergenic
1195566945 X:106350650-106350672 TTGAATGTGAGTGAATTTGAGGG + Intergenic
1196069728 X:111507483-111507505 ATCAATGTGAATGATGAAGATGG + Intergenic
1196763887 X:119225588-119225610 AAGAAAGTCAAGGAAGTGGAAGG + Intergenic
1197789366 X:130236513-130236535 ATTAAAGGCAATGAAGTGGAGGG + Exonic
1198339400 X:135699484-135699506 AGGAATCTGAATGAGGAGGAAGG + Intergenic
1198473033 X:136966931-136966953 AAGACTGTGAAAGAAATGGAAGG - Intergenic
1199717875 X:150519190-150519212 AAAGATGTGAATAAAGTGGAAGG + Intergenic
1201098479 Y:10653342-10653364 ATGGATTGGAATGAAGTGGAAGG - Intergenic
1201110695 Y:10797213-10797235 ATGGATGGGAGTGGAGTGGAGGG - Intergenic
1201113892 Y:10820995-10821017 ATGAAGTAGAATGAAATGGAAGG - Intergenic
1201130824 Y:10950721-10950743 ATGAAATGGAATGGAGTGGAGGG - Intergenic
1201131679 Y:10956479-10956501 ATGAAATGGAATGGAGTGGAGGG - Intergenic
1201138106 Y:11006112-11006134 GTGAAGTTGAATGGAGTGGAAGG - Intergenic
1201139269 Y:11014823-11014845 ATGGAATGGAATGAAGTGGAGGG - Intergenic
1201197865 Y:11511874-11511896 ACGAATGTGAAGGAAGGGAATGG + Intergenic
1201199900 Y:11530120-11530142 ATGTATCTGAATGGAATGGAAGG + Intergenic
1201213699 Y:11703633-11703655 ATGAATCGGAATGGAATGGAAGG + Intergenic
1201544213 Y:15142892-15142914 CAGAATGTGAATGAAGAGCAAGG + Intergenic
1201958734 Y:19654425-19654447 ATGAACATGAATGAAGCCGAAGG - Intergenic
1202588548 Y:26457884-26457906 ATTATTGTGAATGAAGTGAAAGG + Intergenic
1202605766 Y:26638545-26638567 ATGGAATTGAATGGAGTGGAGGG + Intergenic
1202608789 Y:26661504-26661526 ATGGAATTGAACGAAGTGGAGGG + Intergenic