ID: 1103648076

View in Genome Browser
Species Human (GRCh38)
Location 12:122410972-122410994
Sequence AGCTGAACCTCATTCATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103648076 Original CRISPR AGCTGAACCTCATTCATTGC TGG Intronic
904268416 1:29331730-29331752 ACCTGAACCACATTAACTGCTGG + Intergenic
906226913 1:44129943-44129965 AGCTGAGTCCCAGTCATTGCTGG + Exonic
909102598 1:71368162-71368184 AACAGAAACTCATTAATTGCTGG - Intergenic
915417649 1:155754426-155754448 ATCTGGACCTCCTTCATGGCAGG + Exonic
919168570 1:193926388-193926410 TGCTGACCCTCATTTCTTGCTGG - Intergenic
919643558 1:200068729-200068751 AGCTGAAGCTCATTAGTTTCAGG + Intronic
922556600 1:226537245-226537267 AGCTCAACCGCAGTCAGTGCTGG - Intergenic
1062888479 10:1037703-1037725 AGCTTAACCTCATTAATCACAGG - Intergenic
1064063777 10:12163117-12163139 AGTGGAACCTCATACACTGCTGG - Intronic
1064135170 10:12744441-12744463 AGTGGAACCTCACCCATTGCTGG - Intronic
1064385195 10:14884288-14884310 AACTGAAACTCATACACTGCTGG - Intronic
1065109247 10:22423920-22423942 TGCTGACCTTCATTCATAGCTGG + Intronic
1065270177 10:24022486-24022508 AAGAGAAACTCATTCATTGCTGG + Intronic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1067808787 10:49411017-49411039 ACCAGAACCTCATTCATGCCAGG + Intergenic
1068494493 10:57769587-57769609 AGCAGAAACTCATTCACTGCTGG + Intergenic
1071192392 10:83116589-83116611 AGATGACCCTCAGTCCTTGCAGG - Intergenic
1073505894 10:103989393-103989415 AACAGGAACTCATTCATTGCTGG + Intronic
1076111055 10:127860122-127860144 ATCAGAACCTTATTCATTGCTGG - Intergenic
1076461400 10:130649847-130649869 AGAAGAACCTCATCCATGGCTGG + Intergenic
1077150981 11:1073082-1073104 AGCTGAACCCCATTCCTAACGGG - Intergenic
1080367781 11:31597020-31597042 AGCTGATACTCATACTTTGCTGG + Intronic
1081657298 11:44865936-44865958 AGCCGAACCACATTCAGTCCAGG + Intronic
1083887536 11:65580211-65580233 AGCTGAGCCTCACTCTTTCCGGG + Exonic
1086224931 11:84496249-84496271 TTCTGAACCTCATTCAAAGCAGG - Intronic
1087828978 11:102798582-102798604 AGCTGAACTTCAGTCAGTACAGG - Intergenic
1089119488 11:116123815-116123837 AGATGCTCATCATTCATTGCTGG + Intergenic
1089915529 11:122152064-122152086 TGAAGAACCTCATTCATTTCAGG + Intergenic
1094733202 12:33201525-33201547 AACTGAAACTCATATATTGCTGG + Intergenic
1095648733 12:44581521-44581543 AGCTAAAACTCATTCCTTTCAGG - Intronic
1097645879 12:62234851-62234873 AGCTGAGTCCCAGTCATTGCTGG - Intronic
1098728448 12:73999977-73999999 AGCTGAACCCCTTTCCTTGAGGG - Intergenic
1100834922 12:98557445-98557467 AGCTGGAACTCATACATTGCTGG + Intergenic
1100982196 12:100170667-100170689 ATCTGAACCTCTCTCATTCCAGG - Intergenic
1101293087 12:103391384-103391406 AATTGAAACTCATGCATTGCTGG - Intronic
1101345518 12:103882641-103882663 GGCTGCACCTCATTCACTTCTGG - Intergenic
1101667897 12:106836768-106836790 AGTGGAAAATCATTCATTGCAGG - Intronic
1102479965 12:113215891-113215913 AGCAGAAACTCTGTCATTGCTGG + Intronic
1103648076 12:122410972-122410994 AGCTGAACCTCATTCATTGCTGG + Intronic
1104748027 12:131221971-131221993 TGCTGAACCTCATTAATCCCAGG - Intergenic
1105952964 13:25249028-25249050 AACTGAATGTCATTCCTTGCTGG + Exonic
1106099527 13:26682477-26682499 ACCTGAACTTCAATCATGGCAGG - Intronic
1107255134 13:38417054-38417076 AGCTGGAACTCCTTCATGGCCGG + Intergenic
1108464999 13:50706564-50706586 AGCTGAATGTCATTGATTGAAGG - Intronic
1109519574 13:63491090-63491112 AGTTGATCCTCATTATTTGCGGG - Intergenic
1109753398 13:66725708-66725730 ATTTGAACCCCATTCATTACTGG - Intronic
1111326277 13:86700624-86700646 AACAGGAACTCATTCATTGCTGG + Intergenic
1114221316 14:20699992-20700014 AGCCCAGCCTCATTCATTACAGG - Exonic
1118373402 14:65156764-65156786 AGCTGCAACCCAGTCATTGCAGG - Intergenic
1119273246 14:73328540-73328562 AACTGGAACTCATACATTGCAGG - Intronic
1120580563 14:86242847-86242869 ACAGGTACCTCATTCATTGCTGG + Intergenic
1121655191 14:95589887-95589909 AGATGTACCTAATTAATTGCTGG + Intergenic
1123893171 15:24801992-24802014 CTGTGTACCTCATTCATTGCAGG - Intergenic
1124599704 15:31123725-31123747 AGCAGAAACTGATTCATTGCTGG + Intronic
1125936424 15:43640166-43640188 AACTAAACATCAATCATTGCAGG - Intronic
1125949190 15:43736678-43736700 AACTAAACATCAATCATTGCAGG - Intergenic
1126525864 15:49653401-49653423 AGCTGAACTGCATTCCTTTCTGG - Exonic
1126863331 15:52908757-52908779 AACTGGAACTCATACATTGCTGG - Intergenic
1126949252 15:53862188-53862210 AGCTGGACCTCATTCTGTGCAGG - Intergenic
1132983226 16:2749926-2749948 AGGTAAACCACATTCACTGCAGG - Intergenic
1137574637 16:49590754-49590776 AGCTGGACCTCATCAAGTGCGGG - Intronic
1137636330 16:49989934-49989956 AACTGGAACTCATGCATTGCCGG + Intergenic
1137660385 16:50200499-50200521 AACAGACTCTCATTCATTGCTGG - Intronic
1141123111 16:81377674-81377696 AGCTGAAACTCACTCTGTGCTGG + Exonic
1146106886 17:30047167-30047189 ATCTCAACCTCATTGAATGCAGG - Intronic
1146147300 17:30431080-30431102 ACTGGAACCTCATACATTGCTGG - Intronic
1146671863 17:34743570-34743592 AACTGAAACTCATACTTTGCTGG - Intergenic
1149701055 17:58655675-58655697 AGCTGGACCTCATTCTGTCCTGG + Intronic
1150565527 17:66335964-66335986 AGCTGACCCTCATACACTGCTGG - Intronic
1155921044 18:31603162-31603184 AGCTGTACCTTAGTCATTCCTGG + Intergenic
1156595356 18:38542319-38542341 AGGGGGACCTGATTCATTGCAGG - Intergenic
1163647341 19:18496929-18496951 ACAGGAACCTCATTCACTGCCGG + Intronic
1164705758 19:30318190-30318212 AACTGAACCTCATGCAGTGTTGG - Intronic
925001249 2:404364-404386 AGCAGCACCCCATCCATTGCAGG - Intergenic
925725706 2:6868978-6869000 ATGTGCACCTCATTCATTGTCGG + Intronic
927789178 2:25996813-25996835 AACTGGACCTCATGCACTGCTGG - Intergenic
928719820 2:34107091-34107113 AACAGAAACTCATTCATTGCTGG - Intergenic
931165161 2:59739140-59739162 AGCACAACCTCATTCATTAGGGG + Intergenic
931266348 2:60663844-60663866 ATCAGAACCGCATACATTGCTGG - Intergenic
931993764 2:67820278-67820300 AACTGAAACTCATACATTGCTGG + Intergenic
932536406 2:72601542-72601564 ACAGGAACCTCATTCATTGCTGG + Intronic
934747647 2:96770055-96770077 AGCTGCACCTCCTTCCTGGCTGG + Intronic
938391368 2:130909054-130909076 AGCAGGACCTCATACATTGTGGG + Intronic
938691588 2:133795061-133795083 AACAGAGACTCATTCATTGCTGG - Intergenic
944772792 2:202931477-202931499 AGCTGACCCTCAAACAATGCAGG - Intronic
944969958 2:204981126-204981148 AACTAAACCTCATACATTGTTGG + Intronic
945897029 2:215495038-215495060 ACAGGAATCTCATTCATTGCTGG + Intergenic
948106218 2:235416004-235416026 ATTGGAGCCTCATTCATTGCTGG - Intergenic
948473411 2:238201677-238201699 AGCAGAACCTAATTAATTGCAGG + Intronic
1170484455 20:16802438-16802460 AGCTTGACCTCATTTATAGCTGG - Intergenic
1171137005 20:22703894-22703916 AACAGGAGCTCATTCATTGCTGG - Intergenic
1171178040 20:23069297-23069319 AGCAGGAACTCATTCATTGCTGG + Intergenic
1174908208 20:54574938-54574960 AGCTGAGCCTCATTCATGGAGGG + Intronic
1176149882 20:63585132-63585154 ACAGGAACCTCAGTCATTGCAGG + Intergenic
1176149907 20:63585310-63585332 ACAGGAACCTCAGTCATTGCAGG + Intergenic
1176149912 20:63585348-63585370 ACAGGAACCTCAGTCATTGCAGG + Intergenic
1180259272 21:46657186-46657208 AGCTGAAAGTCATGCATTGCTGG + Intronic
1184016862 22:41792727-41792749 AGCTGGCACTCATACATTGCTGG - Intronic
1184072984 22:42157787-42157809 ATCAGGAACTCATTCATTGCTGG + Intergenic
1185265078 22:49897441-49897463 AACAGGAACTCATTCATTGCTGG - Intergenic
949643431 3:6066333-6066355 AGCTGAGCTTTATTAATTGCAGG - Intergenic
954489167 3:50885518-50885540 GACTCAACCTCATTCATTGCTGG - Intronic
956705907 3:71998778-71998800 AGCTGAACCTGATTTTGTGCAGG - Intergenic
957358867 3:79128235-79128257 AGCTGAACCTGTTTCAATTCAGG - Intronic
958824489 3:99014190-99014212 AACTGAAATTCATACATTGCTGG - Intergenic
959011395 3:101080933-101080955 ACCAGGAACTCATTCATTGCTGG + Intergenic
960438104 3:117652422-117652444 ACAGGAAACTCATTCATTGCTGG + Intergenic
962133049 3:132702944-132702966 AGTTGAACCTCGTTCTTTTCTGG - Intronic
962498286 3:135965030-135965052 AACAGAACCTCATTAATAGCTGG - Intergenic
962558619 3:136582269-136582291 ACCTGAACTTCTCTCATTGCAGG - Intronic
966178608 3:177166873-177166895 AGAGGACTCTCATTCATTGCTGG + Intronic
968952279 4:3701371-3701393 AGCTGAACCACAGCCAGTGCAGG - Intergenic
969846256 4:9922640-9922662 AGGAGAAACTCATGCATTGCAGG - Intronic
970918313 4:21362535-21362557 ATCTGAACCTCAGTTATAGCTGG + Intronic
973181131 4:47269588-47269610 AGATGCACCTCATTCTTTCCTGG + Intronic
974454397 4:62107699-62107721 AGCAGAAACTCATACACTGCAGG - Intergenic
974951498 4:68588577-68588599 GGCTGAAATTCATTGATTGCTGG - Intronic
977424077 4:96843690-96843712 AGCTTAACCTCATTCAGAGCAGG + Intergenic
978309856 4:107374831-107374853 AGATGACTCTCATTCATTGCTGG + Intergenic
978931581 4:114320252-114320274 AGCTGTACATCAGGCATTGCTGG - Intergenic
979946864 4:126843430-126843452 AGCTGAAACACATTCCTGGCTGG + Intergenic
980165755 4:129225080-129225102 AGCTCTACCTCCTTCCTTGCTGG - Intergenic
981911279 4:149984234-149984256 AGGAGAACCTCAGGCATTGCAGG - Intergenic
982147070 4:152406447-152406469 AACTGTATCTCATTCACTGCAGG - Intronic
986596019 5:9423050-9423072 AGCTCAACATCATTCATTAAAGG + Intronic
988371195 5:30369759-30369781 AACTGAAACTCATACATTGCTGG + Intergenic
991205783 5:64048922-64048944 AGCTGGACCTCATTCTGTCCAGG + Intergenic
991630251 5:68649459-68649481 AGTAGAAAGTCATTCATTGCTGG - Intergenic
995115130 5:108470889-108470911 AGATCAACCTTATTCATTTCTGG - Intergenic
996634255 5:125671001-125671023 AACTGAACTTCATACATTCCAGG - Intergenic
997888482 5:137653628-137653650 AACTGAAACTCATATATTGCTGG + Intronic
998308205 5:141100590-141100612 AGCTGAACCTCAGACAGAGCTGG - Exonic
999906649 5:156148587-156148609 AGCTGGACCTCATTCTGTTCAGG - Intronic
1003621663 6:7706098-7706120 AGATGAACCCCATACACTGCAGG - Intergenic
1003845948 6:10173288-10173310 GGGTGAGCCTCATTCATTGATGG + Intronic
1003952781 6:11132295-11132317 ATTGGAACCTCATACATTGCAGG + Intronic
1007331961 6:41118785-41118807 AGAAGAATCTCATTCATTGATGG - Intergenic
1007638508 6:43316314-43316336 AGCTGAACTTCCTTCACTCCAGG - Intronic
1007764919 6:44154635-44154657 AGCTGCCCCTCATGGATTGCGGG - Intronic
1008640657 6:53459002-53459024 AGCTGAAACTTATTGATTACTGG + Intergenic
1010380606 6:75219971-75219993 AGCTGAAGCACCTTCATTTCGGG - Intergenic
1012776487 6:103500330-103500352 AGCTGATACTCATTAATTGGAGG - Intergenic
1014095845 6:117460211-117460233 AACTGATGCTCATTCATTCCTGG - Intronic
1015127944 6:129775112-129775134 TGCTGTATCTCATTCATTACTGG + Intergenic
1016588190 6:145713603-145713625 AACTGAAACTCATACACTGCTGG + Intronic
1016810324 6:148254733-148254755 ATTGCAACCTCATTCATTGCTGG + Intergenic
1019968563 7:4521793-4521815 ATCTCCACCTCTTTCATTGCAGG - Intergenic
1025919367 7:65896498-65896520 AGCGGAACCTATTACATTGCTGG - Intronic
1028503252 7:91542474-91542496 AGTTGAACCACATTCAATTCTGG + Intergenic
1033046703 7:137968704-137968726 AGCTGAACCTCCTCCAATGGGGG + Intronic
1034745613 7:153521245-153521267 AAAGGAACCTCATACATTGCTGG + Intergenic
1036557644 8:9874136-9874158 TGCTGAATGTCATTCATTCCTGG - Intergenic
1039360251 8:36868902-36868924 AAATGAATCTCATTCATTTCTGG + Intronic
1040002136 8:42586230-42586252 AACAGAAACTCATTCATTGCTGG - Intergenic
1040621420 8:49096533-49096555 AGCTGAACCTGATTCCTTAGAGG - Intergenic
1043855135 8:85256179-85256201 AGTTAAACATTATTCATTGCTGG + Intronic
1045139262 8:99261679-99261701 AACAGAACCTCATTCACTGTTGG - Intronic
1045174074 8:99701318-99701340 AGTTGTACCTCAATCATAGCAGG + Intronic
1047093464 8:121598398-121598420 AGCTGAAGCTCATTCACTGTAGG + Intergenic
1049067325 8:140327283-140327305 ATCTGACCCTCATGCACTGCTGG + Intronic
1050877965 9:10664272-10664294 AGCTGAAGTTCTTCCATTGCAGG - Intergenic
1051451734 9:17205002-17205024 AGGAAAGCCTCATTCATTGCAGG + Intronic
1051725515 9:20084620-20084642 AACAAGACCTCATTCATTGCTGG + Intergenic
1054992256 9:71342593-71342615 AACAAAAACTCATTCATTGCTGG + Intronic
1056874126 9:90311651-90311673 AGCTGAAACACATGCAGTGCAGG + Intergenic
1057088242 9:92230731-92230753 TGCTGTATCTCATACATTGCTGG - Intronic
1057224019 9:93277244-93277266 AGCTGGAACTCATACATTTCTGG + Intronic
1057468951 9:95340693-95340715 ATCAGAACCTCATACATTGCTGG + Intergenic
1057926626 9:99157975-99157997 AGATGAATCTCACACATTGCTGG + Intergenic
1058224542 9:102343527-102343549 AAAAGAATCTCATTCATTGCTGG - Intergenic
1186040281 X:5469291-5469313 AGATGTACCACTTTCATTGCTGG - Intergenic
1187627569 X:21132993-21133015 AACTTGACCTCATTCAATGCAGG + Intergenic
1189574179 X:42332939-42332961 AACTGAAACTCATATATTGCTGG - Intergenic
1191702356 X:64056396-64056418 AACAGGAACTCATTCATTGCTGG - Intergenic
1193413199 X:81189844-81189866 ACAGGAACATCATTCATTGCTGG - Intronic
1193704686 X:84807111-84807133 AGCTGAACATCACTGATTGTTGG + Intergenic
1194335049 X:92635297-92635319 ATGTGAACCTTATGCATTGCTGG - Intergenic
1194470363 X:94286545-94286567 AGCTGAAACTTATTCAAGGCAGG + Intergenic
1196904545 X:120418827-120418849 AGTTCAATCTCATTCATTACTGG + Intergenic
1200158621 X:153992463-153992485 AGCTGCTCCTCACTCATTCCAGG + Intergenic
1200643522 Y:5752346-5752368 ATGTGAACCTTATGCATTGCTGG - Intergenic