ID: 1103656891

View in Genome Browser
Species Human (GRCh38)
Location 12:122478044-122478066
Sequence AACAATCTGGAGTTAAGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103656888_1103656891 2 Left 1103656888 12:122478019-122478041 CCCTTCACTTAAAATGATGTAGA 0: 1
1: 0
2: 0
3: 17
4: 212
Right 1103656891 12:122478044-122478066 AACAATCTGGAGTTAAGTCTAGG 0: 1
1: 0
2: 0
3: 13
4: 134
1103656889_1103656891 1 Left 1103656889 12:122478020-122478042 CCTTCACTTAAAATGATGTAGAA 0: 1
1: 0
2: 2
3: 21
4: 369
Right 1103656891 12:122478044-122478066 AACAATCTGGAGTTAAGTCTAGG 0: 1
1: 0
2: 0
3: 13
4: 134
1103656887_1103656891 6 Left 1103656887 12:122478015-122478037 CCATCCCTTCACTTAAAATGATG 0: 1
1: 0
2: 1
3: 18
4: 215
Right 1103656891 12:122478044-122478066 AACAATCTGGAGTTAAGTCTAGG 0: 1
1: 0
2: 0
3: 13
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103656891 Original CRISPR AACAATCTGGAGTTAAGTCT AGG Intronic