ID: 1103657988 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:122489194-122489216 |
| Sequence | AATGATTGCGTTGTGACCTG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 97 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 5, 4: 91} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1103657988_1103657991 | -4 | Left | 1103657988 | 12:122489194-122489216 | CCCCAGGTCACAACGCAATCATT | 0: 1 1: 0 2: 0 3: 5 4: 91 |
||
| Right | 1103657991 | 12:122489213-122489235 | CATTATTAAACAGCAAACTGAGG | 0: 1 1: 0 2: 1 3: 24 4: 301 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1103657988 | Original CRISPR | AATGATTGCGTTGTGACCTG GGG (reversed) | Intronic | ||