ID: 1103657988

View in Genome Browser
Species Human (GRCh38)
Location 12:122489194-122489216
Sequence AATGATTGCGTTGTGACCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103657988_1103657991 -4 Left 1103657988 12:122489194-122489216 CCCCAGGTCACAACGCAATCATT 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1103657991 12:122489213-122489235 CATTATTAAACAGCAAACTGAGG 0: 1
1: 0
2: 1
3: 24
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103657988 Original CRISPR AATGATTGCGTTGTGACCTG GGG (reversed) Intronic