ID: 1103659275

View in Genome Browser
Species Human (GRCh38)
Location 12:122500707-122500729
Sequence GAGGAGGACGAAAATGGGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 443}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103659275_1103659285 19 Left 1103659275 12:122500707-122500729 CCGACCCCATTTTCGTCCTCCTC 0: 1
1: 0
2: 4
3: 45
4: 443
Right 1103659285 12:122500749-122500771 AAGCGAGTGTGAACGGGCTTCGG 0: 1
1: 0
2: 0
3: 2
4: 50
1103659275_1103659283 13 Left 1103659275 12:122500707-122500729 CCGACCCCATTTTCGTCCTCCTC 0: 1
1: 0
2: 4
3: 45
4: 443
Right 1103659283 12:122500743-122500765 TCCTTGAAGCGAGTGTGAACGGG 0: 1
1: 0
2: 2
3: 160
4: 9710
1103659275_1103659282 12 Left 1103659275 12:122500707-122500729 CCGACCCCATTTTCGTCCTCCTC 0: 1
1: 0
2: 4
3: 45
4: 443
Right 1103659282 12:122500742-122500764 GTCCTTGAAGCGAGTGTGAACGG 0: 1
1: 1
2: 1
3: 219
4: 9811

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103659275 Original CRISPR GAGGAGGACGAAAATGGGGT CGG (reversed) Intergenic
900125773 1:1068440-1068462 GAGGAGGAAGGAAATGGGGAGGG - Intergenic
900867745 1:5280501-5280523 GAGGAGGACAAACATGAGGATGG + Intergenic
901141793 1:7039234-7039256 GAGGAGGAAGAAAAGTGGGAAGG - Intronic
901305879 1:8232361-8232383 GAGGAGGACGAAAAGGAGGAGGG + Intergenic
901511612 1:9720653-9720675 GAGGAGGAGGTGAGTGGGGTGGG + Exonic
901755981 1:11441860-11441882 GAGGAGGAGGAAGATGAGGGAGG + Intergenic
901755986 1:11441879-11441901 GAGGAGGAGGAAAATGAGGGAGG + Intergenic
901873329 1:12151479-12151501 GAGGAGGAGAAAGATGAGGTTGG - Intergenic
903760310 1:25693282-25693304 GAGGAGGAGGAAGTGGGGGTTGG + Intronic
903772170 1:25770805-25770827 GAGAAGAAAGAAAATGGGGGTGG - Intronic
903822348 1:26112053-26112075 GAGGAGGCCGCGACTGGGGTCGG - Intronic
904224562 1:29005228-29005250 GAGCAGGAGGAAGAGGGGGTGGG + Intronic
904808789 1:33150107-33150129 GAGAAGGAGGAAACTGGGATTGG + Intronic
905295461 1:36951728-36951750 GAGGAGGAATAAAAGGGGGAGGG + Intronic
906191726 1:43903423-43903445 GAGGAGGCAGCAAACGGGGTTGG - Intronic
906208329 1:43998735-43998757 GAGGAGGATGGAAAGAGGGTAGG + Intronic
906636843 1:47415917-47415939 GGGGAGGAGCAAAATGGGGAGGG + Intergenic
906777514 1:48543246-48543268 GAGGAGGAGGAACCTGAGGTTGG + Intronic
906918872 1:50041847-50041869 GATGAGAACGAAAACTGGGTTGG + Intergenic
907578845 1:55553780-55553802 GAGGGGGAGAAAAAAGGGGTTGG - Intergenic
907856806 1:58311664-58311686 GAAGAGGAAGAAAGGGGGGTTGG - Intronic
907950679 1:59180355-59180377 GAGGAGGCCAAGAAAGGGGTAGG - Intergenic
908261316 1:62341377-62341399 GAGGAGTATGGAAGTGGGGTGGG - Intergenic
909230839 1:73087739-73087761 GAGGGGGTGGAAAATGGGGATGG - Intergenic
909617826 1:77632390-77632412 GAGGAGGAAGTAGATGTGGTGGG - Exonic
910287253 1:85569587-85569609 GTGGAGGACGAAGATGGGGTTGG - Intronic
910636011 1:89408737-89408759 GAGGAGGAGGAGAAGGGGCTGGG - Intergenic
912255886 1:108057768-108057790 GAGGAGGCAGGAAATGGGGTTGG - Intergenic
912469300 1:109895626-109895648 GAGGAGGTCGAAGAGGAGGTTGG + Intergenic
912928103 1:113930381-113930403 GGAGAGGACGACAGTGGGGTGGG + Intronic
913308579 1:117460491-117460513 GAGTAGGGCGAAACTGGGGCTGG + Exonic
913484030 1:119317126-119317148 GAGGAGGACGCCAAGGGAGTGGG + Intergenic
915105284 1:153531441-153531463 GAGAGGGAAGAAAATGGGATGGG + Intergenic
917294313 1:173503033-173503055 GAGGGGGGTAAAAATGGGGTGGG + Intronic
917464756 1:175266324-175266346 CAGGAGGACTAAAGTGGGGTGGG + Intergenic
920388849 1:205586349-205586371 GAGGATGACGAGGAAGGGGTGGG + Intronic
921220242 1:212968591-212968613 GAGGAGGATGACAAGAGGGTTGG - Intronic
921397084 1:214679859-214679881 GAGGAGGAGGAGAAGGGGGGAGG - Intergenic
921734505 1:218612007-218612029 GAGGAGAAGGAGAAGGGGGTAGG - Intergenic
921818368 1:219589380-219589402 GAGGAGGATGAAAAAGGGAGAGG + Intergenic
921958369 1:221008085-221008107 GAGGAGGGGAAAAATGGGGATGG - Intergenic
922453082 1:225752277-225752299 CAGGGGGAAGAAAATGGGGAGGG - Intergenic
922564703 1:226594088-226594110 GAGGAGGAGGAAAACGAGGCAGG + Intronic
922717752 1:227886084-227886106 CAGGAAGAGCAAAATGGGGTGGG + Intergenic
923470942 1:234290606-234290628 GTGGGGGACGGAAATGGAGTAGG - Intronic
923482440 1:234397441-234397463 GAGGAGGGGGAAGATGGGGGAGG + Intronic
924721721 1:246629237-246629259 GAGCAGAAAGAACATGGGGTTGG - Intronic
1064272702 10:13879767-13879789 GAGGAGGAGGAAGAAGGGGAAGG - Intronic
1064308439 10:14189276-14189298 GAGGAGGAAGAGAATGGGCCCGG + Intronic
1064412070 10:15114267-15114289 GCAGATGATGAAAATGGGGTGGG - Intronic
1065550431 10:26863864-26863886 GAGGAGGAAGAAAAAGGAGAAGG + Intergenic
1067559994 10:47298490-47298512 GAGAAGGAGGGAAATGGGGGTGG + Intergenic
1068019346 10:51561624-51561646 AAGGAGGAGGAAGAAGGGGTGGG + Intronic
1068932956 10:62610422-62610444 GAGGAGGAGGAGAAGGGGCTGGG - Intronic
1070530734 10:77335142-77335164 GAGGAGGAGGAAGATGGGGAAGG - Intronic
1073139401 10:101237425-101237447 GAGGAAGAAGAAGATGGGGGAGG - Intergenic
1073243541 10:102073851-102073873 GATGAGGAAGAAGATGGGGCTGG + Intergenic
1073654571 10:105399260-105399282 GAGGAGGATACAAATGGGGGTGG + Intergenic
1074412716 10:113242257-113242279 GAGCAGGATGGAAATGTGGTAGG + Intergenic
1076578517 10:131490463-131490485 CAGGAGGTGCAAAATGGGGTAGG + Intergenic
1076749113 10:132533385-132533407 TAGGAGGAGGAAAATCGGGCAGG + Intergenic
1076906133 10:133362184-133362206 AAGTAGGAAGAAAATAGGGTGGG + Intergenic
1077392508 11:2306732-2306754 GAGGAGGACGAAGAAGGAGGAGG + Intronic
1077985357 11:7346221-7346243 GAGGAGGACTGAAATTGGGAAGG + Intronic
1078516698 11:12028649-12028671 GAAGAGGAGGAAACTGGGGTGGG - Intergenic
1079656899 11:22995904-22995926 GAGGGGGAAGAAAAGGGGTTAGG + Intergenic
1080176166 11:29365399-29365421 GAGATGGAGGATAATGGGGTGGG - Intergenic
1080616956 11:33952942-33952964 TAGGAGGAAGGAAAGGGGGTGGG - Intergenic
1081184566 11:40026234-40026256 GAAGAGGAAGAAAATGAGGATGG + Intergenic
1081270500 11:41077282-41077304 GAGGAGGAGAAATGTGGGGTTGG - Intronic
1081820634 11:45990553-45990575 GAAGAAGATGAAAATGGGCTAGG - Intronic
1083320075 11:61840398-61840420 GAGGAGGAAGAACACGTGGTTGG - Exonic
1083799562 11:65038670-65038692 GAGGAGGAAGAGGATGGGGAAGG + Exonic
1084069724 11:66726639-66726661 GAGGAAGATGAAGATGGAGTAGG + Intronic
1084596151 11:70118184-70118206 GAGGAGGGGGAAGAGGGGGTAGG - Intronic
1084608506 11:70186330-70186352 GAGGAGGACGAGGAGGGGGAGGG + Intronic
1085282314 11:75339319-75339341 CTGGAGAAAGAAAATGGGGTGGG - Intronic
1086880337 11:92146386-92146408 TAGGAGCAGGGAAATGGGGTGGG - Intergenic
1087140780 11:94763765-94763787 GAGGAGGAGGAAGAAGGGGGTGG + Intronic
1087570240 11:99918117-99918139 GAGTAGAATGAAAATAGGGTAGG - Intronic
1087959241 11:104327046-104327068 GAGGAGGAGCAAAGTGGAGTAGG + Intergenic
1088120547 11:106363919-106363941 GAGGAGGAGAAAAGTTGGGTTGG - Intergenic
1088319495 11:108540824-108540846 GGGGAGGAAGAAAAAGGGGAGGG - Intronic
1088592124 11:111412902-111412924 GGGGAGAAGGAAAATGGGTTGGG + Intronic
1088969034 11:114755137-114755159 GAGGAGCAGAAAAATGGGGTTGG + Intergenic
1089066704 11:115667424-115667446 GTGGAGGAGAAAAATGGGATGGG + Intergenic
1089111118 11:116057491-116057513 GGGGAGGAGGAGAATGAGGTTGG + Intergenic
1089513795 11:119018689-119018711 GAGGAGGAGGAGGCTGGGGTGGG + Exonic
1089894977 11:121921041-121921063 GAGGAGGAGGCAGATGGGGTAGG + Intergenic
1090072020 11:123552000-123552022 GGGGAGGAAAAAAATGGGATTGG - Intronic
1090442407 11:126735413-126735435 GAGGAGGTGGGAAATGGGGCCGG - Intronic
1091336608 11:134773583-134773605 GAGGAGGAAGAAGAAGGAGTAGG + Intergenic
1091603161 12:1930013-1930035 GAGGAGGAAGAAGAGGGGGAGGG + Intergenic
1092847423 12:12596646-12596668 GAGAAGGAAGGAAAGGGGGTGGG + Intergenic
1093371925 12:18376070-18376092 GTGGAGGATAAATATGGGGTTGG + Intronic
1094246566 12:28303219-28303241 GAGGAAGAAGAAAATGGAGACGG + Intronic
1095255304 12:40028306-40028328 GAAGAGGAGGAAAAAGAGGTTGG - Exonic
1095271702 12:40225893-40225915 AAGGAGGATAAAAATGGGTTCGG + Intronic
1096712107 12:53465100-53465122 AAGGAAGGTGAAAATGGGGTGGG - Intronic
1097278822 12:57831816-57831838 GAGGAGGAAGACAATGTGGTAGG + Intronic
1097495903 12:60333810-60333832 GAGGAGGACAAAAAATGGTTGGG - Intergenic
1097716892 12:62976572-62976594 GGGTAGGACAAAAATGAGGTGGG + Intergenic
1097717078 12:62978387-62978409 GAGGTGGAGGAGAATGTGGTGGG + Intergenic
1098754170 12:74337142-74337164 GTGGAGAAGGAAAATGTGGTAGG + Intergenic
1099579639 12:84427982-84428004 GAGGAGGACATAAATTTGGTGGG + Intergenic
1099959182 12:89380414-89380436 GAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1102822962 12:115923841-115923863 GAGGAGAAGGAGAAGGGGGTGGG - Intergenic
1103050606 12:117776163-117776185 GAGGGGAAGGAATATGGGGTTGG - Intronic
1103659275 12:122500707-122500729 GAGGAGGACGAAAATGGGGTCGG - Intergenic
1104524282 12:129503850-129503872 GAGGAGGAGGAAAATCTGGAAGG - Intronic
1105654266 13:22418484-22418506 GAGGAGGTTGATAATGGGGAGGG + Intergenic
1105675417 13:22666309-22666331 GAGGAGGAGGAAGAGGAGGTTGG - Intergenic
1106643873 13:31612643-31612665 GAGCAGGAAGTAAATGGGGAAGG - Intergenic
1106774719 13:32997799-32997821 GATGAGGAGGAAAAGGAGGTTGG - Intergenic
1106841100 13:33685672-33685694 AAGCAGGACCAAAATGGGATAGG - Intergenic
1107907393 13:45073936-45073958 GAGCAGGAGGAAAAGGGGGCGGG + Intergenic
1108696837 13:52909608-52909630 GGGCAGGAGGAAGATGGGGTGGG + Intergenic
1113258653 13:108535107-108535129 GAGGAGGAAGAAAAAGGAGGAGG - Intergenic
1113736888 13:112685507-112685529 GAGGGGGCCAAACATGGGGTGGG + Intergenic
1113909758 13:113836422-113836444 GAGGGGGAGGAGAATGGGGAAGG + Intronic
1114557268 14:23569193-23569215 GAGGAGGAAGAAAATGAAGAAGG - Exonic
1115123457 14:29965410-29965432 GAGGAGGAAGACAACGGGGTTGG - Intronic
1115314310 14:32010079-32010101 GTGGAGGAGGAAAATGTGGGTGG + Intronic
1115641400 14:35337720-35337742 GAGGAGAACGCAAGTGGGCTAGG + Intergenic
1115761714 14:36582842-36582864 GAGGAGGAGGAAGCTGGGGCTGG - Intergenic
1115924922 14:38421982-38422004 GAGGAGGAGGGAAGTGGGGATGG - Intergenic
1116695417 14:48169227-48169249 GAGGAGGATGTGAGTGGGGTGGG + Intergenic
1117710293 14:58521499-58521521 GAGGAGGAGGAACATGTGCTGGG - Intronic
1119898771 14:78242823-78242845 GAAGAGGAGGAAAATCAGGTGGG - Intronic
1120262834 14:82209261-82209283 GAGGAGGAGGAGAAAGAGGTGGG + Intergenic
1120294527 14:82622985-82623007 GAGGAGGAGGAGAATGGAGGAGG + Intergenic
1120370946 14:83634736-83634758 GAGGAGGATGAAGAAGGGGAGGG + Intergenic
1120613594 14:86674106-86674128 GAGGAGGAGCCAAATGTGGTTGG - Intergenic
1121004177 14:90477649-90477671 GAGGAGGAGGAAGAAGGGGCAGG + Intergenic
1121006379 14:90493207-90493229 GAGGAGGAGGAAAAAGAGGAGGG - Intergenic
1121448916 14:93995675-93995697 GAGGATGATGAAAAGGGGTTGGG + Intergenic
1122347066 14:101067341-101067363 GAGGAGGAGGACAAGGGGGAGGG - Intergenic
1122603189 14:102931123-102931145 GGGGCGGACGGAAAAGGGGTGGG + Exonic
1122782668 14:104150200-104150222 GAGGAGGAGGAGGAGGGGGTGGG - Intronic
1122799116 14:104221057-104221079 GAGGAGGAAGGAAAGGGCGTTGG + Intergenic
1123935389 15:25191610-25191632 GAGGAGCACGGAGAAGGGGTTGG - Intergenic
1125442578 15:39718815-39718837 GAGCAGGACAAAAATGGCTTTGG - Intronic
1125978687 15:43979366-43979388 GAGGTGGACGAACATGCTGTGGG - Intronic
1128304157 15:66587034-66587056 GAGGAGGGGGAGAATGGGGAGGG - Intronic
1128305824 15:66598400-66598422 GTGGAGGAAGAAAAGAGGGTAGG - Intronic
1128865423 15:71111430-71111452 GAGGAGGAAGAAAAAGGACTGGG + Intronic
1128894775 15:71362757-71362779 GGGGAGGATGAAATTAGGGTGGG - Intronic
1129314438 15:74732688-74732710 GAGGAGGAAGAGAATGAGGCAGG - Intergenic
1129391714 15:75224075-75224097 GAGGAAGACTGAAAAGGGGTCGG - Intergenic
1129515321 15:76153693-76153715 GTGAAGGATGAAAATGGGGCTGG + Intronic
1129992030 15:79973787-79973809 CAGAAGGAGGAAGATGGGGTAGG - Intergenic
1131215582 15:90532788-90532810 GAGAGGGAGGAAAGTGGGGTCGG + Intronic
1131284770 15:91048020-91048042 GAGGAGGAGGAAAAAGGAGGGGG - Intergenic
1131646256 15:94348421-94348443 GAGGGGGAGGAAGATGGGGAGGG - Intronic
1131834094 15:96373047-96373069 GAGGAGGTGGAAATGGGGGTGGG + Intergenic
1131896315 15:97034623-97034645 GAGCAGGACGAAAAGGGGTATGG + Intergenic
1132868289 16:2104387-2104409 GAGGGGGACGAAGATGGGATGGG + Intronic
1133490626 16:6264584-6264606 GAAGAGGAAGAGAATGTGGTGGG - Intronic
1133491540 16:6274537-6274559 GAGGAGGAAGGAAATGGGTGTGG + Intronic
1134068390 16:11245051-11245073 GACAAGGATGTAAATGGGGTGGG - Intergenic
1134111026 16:11515735-11515757 GAGGAGGAGGAAAAGGGAGGAGG + Intronic
1134111037 16:11515773-11515795 GAGGAGGAGGAAAAGGGAGGAGG + Intronic
1134523446 16:14928632-14928654 GAGGGGGACGAAGATGGGATGGG - Intronic
1134711040 16:16327116-16327138 GAGGGGGACGAAGATGGGATGGG - Intergenic
1134948543 16:18341493-18341515 GAGGGGGACGAAGATGGGATGGG + Intergenic
1136111542 16:28066580-28066602 GAGGAGGAAAAAAAGGGGGCGGG + Intergenic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1139002431 16:62528973-62528995 GGGGAGTACCAAAATGGAGTTGG - Intergenic
1139596538 16:67961597-67961619 GAGGAGGCCGAGAGTGGGGAGGG - Exonic
1139917874 16:70439218-70439240 GGGGAGGATGTGAATGGGGTGGG - Intronic
1141703606 16:85653255-85653277 GAGGAGGAGGAGGAGGGGGTAGG - Intronic
1141703625 16:85653302-85653324 GAGGAGGAGGAGGAGGGGGTAGG - Intronic
1142281217 16:89148687-89148709 GAAGAGGAGAAAGATGGGGTTGG - Intronic
1142903263 17:3026447-3026469 GAGGAGGGCGACAGTGGGGTAGG + Exonic
1143138539 17:4726585-4726607 GAGGAGGAGGAAATTAGAGTGGG - Intergenic
1143511588 17:7398582-7398604 GAGGCAGAAGAAAATGTGGTGGG + Intronic
1144373634 17:14617485-14617507 GAAGAGGATTAAAATGGGGATGG + Intergenic
1144736342 17:17557668-17557690 CAGCAGGACTGAAATGGGGTGGG + Intronic
1144768763 17:17747370-17747392 GAGGATGTGGAAGATGGGGTGGG + Intronic
1144782560 17:17815337-17815359 GAGGAGGAGGTGAGTGGGGTGGG + Intronic
1145038035 17:19555021-19555043 GAGAAGGAAGAGAAAGGGGTGGG + Intronic
1145975845 17:28983949-28983971 GAGGAGGGAGGAAATTGGGTGGG + Intronic
1146471381 17:33127770-33127792 GAGGAGGAAGGGAGTGGGGTGGG - Intronic
1146490781 17:33280101-33280123 GGGAAAGACGAAAATGGGGCAGG - Intronic
1146987346 17:37232891-37232913 GAGGAGGAGGACAAGGGGGATGG - Intronic
1147121752 17:38339201-38339223 GAGCAGGAGGAATAGGGGGTGGG + Intronic
1147178559 17:38671548-38671570 GAGGAGGAGGAAGAAGGGGTGGG - Intergenic
1148466093 17:47866151-47866173 GAGGAGCACCTAACTGGGGTGGG + Intergenic
1148748298 17:49930679-49930701 GAGGAGGAGGAAAAGTGGGAAGG - Intergenic
1149512695 17:57256448-57256470 GAGGAGGAGGAGATGGGGGTGGG + Intronic
1150481834 17:65516859-65516881 GAGGAGGGAGAAAATGGGGGAGG + Intergenic
1150747451 17:67826588-67826610 GAAGAGGAAAAAAAGGGGGTTGG - Intronic
1152297027 17:79473797-79473819 GAGGAGGAGAAAAATGGAGGCGG - Intronic
1152300329 17:79491648-79491670 GAGGAGGAAGAAGTTGGGCTTGG + Intronic
1152315949 17:79580273-79580295 GAGGAGGAGGAGGATGGGGGGGG - Intergenic
1152336699 17:79703048-79703070 GAGGAGGAAGAAGAGGGGGAGGG - Intergenic
1153018589 18:606531-606553 GAGGACAAGGAAGATGGGGTGGG - Intronic
1153185234 18:2478829-2478851 GAGGAGGAGGAAGATGGAGGAGG + Intergenic
1153331306 18:3878460-3878482 GAGGAGGAGGAAAAGGAGGAAGG - Intronic
1155064725 18:22258397-22258419 GAGGAGGAGGAAAAGGAGGAAGG - Intergenic
1159116191 18:64115423-64115445 AAGAAGGAGGAAAATGAGGTAGG + Intergenic
1160055657 18:75477532-75477554 GACAAGGAGGAGAATGGGGTGGG - Intergenic
1160340462 18:78084971-78084993 GAGGAAAATAAAAATGGGGTGGG + Intergenic
1160793203 19:932506-932528 GAGGAGGACGAGGAGGGGCTGGG + Exonic
1160965754 19:1746258-1746280 GAGGAGGAAGGAAATGGAGGAGG + Intergenic
1160983431 19:1827035-1827057 GAGGAGGAGGAGGATGGGGCGGG + Exonic
1161165357 19:2784149-2784171 GAGTAGGACGAAAATGAATTGGG - Intergenic
1161346537 19:3771243-3771265 GAGGAGGCAGAGAATGGTGTGGG - Intronic
1161403794 19:4080919-4080941 GAGGAGGAGGAGAAGGGGGAGGG + Intergenic
1161534731 19:4811987-4812009 GGGGAGGGCGAAAAGGGGATGGG - Intergenic
1161586980 19:5110951-5110973 GAGGAGGACGAAAGAGGAGGCGG - Intronic
1161607356 19:5222449-5222471 GAGGAGGAGGAAGAGGGGGGAGG + Intronic
1161909735 19:7184259-7184281 GAGGAGAAGGAACGTGGGGTTGG - Intronic
1162996487 19:14339142-14339164 GGGGAGGAGGAAAGTGGGGAGGG - Intergenic
1163690906 19:18737760-18737782 GAGGAGGAGGAAAAGGGAGGAGG - Intronic
1164868703 19:31625866-31625888 GAGGAAGAAGAAAAGGGGGATGG - Intergenic
1165860657 19:38907544-38907566 GAGGCGGGCGAGGATGGGGTTGG - Exonic
1166299614 19:41906486-41906508 GCGGAGGAAGACAATGGGGCGGG + Exonic
1166386241 19:42383165-42383187 GAGGAAGAGGCTAATGGGGTAGG + Intergenic
1167799229 19:51729580-51729602 GAGGAGGAGGAGAATGGAGGAGG + Intergenic
1167945429 19:52984545-52984567 GAGGAGGACGAACACGGGAATGG + Intergenic
1168384008 19:55947933-55947955 GAGGAGGATGAAAAGGGAATGGG - Exonic
1168652021 19:58097746-58097768 GAGGGGGGCGAAAAGGGGGAGGG - Intronic
926512324 2:13797781-13797803 GAGGAGGTAGAAAAAGAGGTAGG - Intergenic
927557602 2:24047171-24047193 GAGGATGAGGAGAATGGGGCGGG - Intronic
927787213 2:25982260-25982282 AAGGAAGAGGAAAATGGGATGGG + Exonic
928724219 2:34152159-34152181 GAGGAGGAGGAAGCAGGGGTGGG - Intergenic
928771348 2:34705528-34705550 GAGGAGGAAGGAAAAGGGGAAGG - Intergenic
929768308 2:44869330-44869352 GGGGAGGACGAAACTGGAGAAGG + Intergenic
930266032 2:49200134-49200156 AAGGAGGAGCAAATTGGGGTAGG - Intergenic
931007199 2:57865240-57865262 GAGGAAGAGGAGAATGGGGATGG + Intergenic
931693242 2:64852955-64852977 GAGGAGGAAGAAAAAGAGGAAGG + Intergenic
931840871 2:66146721-66146743 GGGGAAGATGAAAATGTGGTTGG - Intergenic
931940776 2:67249562-67249584 AAGTAGGAGGGAAATGGGGTTGG - Intergenic
932146000 2:69317810-69317832 AAGGAAGAGGAAAATGGGGTGGG + Intergenic
932220809 2:69997596-69997618 GAGGAGGACGCAGCTGGGGCAGG - Intergenic
932746794 2:74340550-74340572 GAGGATGAGATAAATGGGGTGGG + Intronic
932795353 2:74690410-74690432 GAGGAGGACGATGAAGAGGTGGG + Intergenic
933167903 2:79095505-79095527 CAGGAGGAGGGAAATGCGGTCGG + Intergenic
933242355 2:79936445-79936467 CAAGAGGAGGAAAAGGGGGTCGG - Intronic
934926557 2:98385851-98385873 GAGCAGGAGGAAGGTGGGGTAGG + Intronic
935848989 2:107198310-107198332 GAGGAGGAAGAAAAAGAGGGAGG + Intergenic
936231061 2:110699926-110699948 CAGGAAGTGGAAAATGGGGTGGG + Intergenic
936554911 2:113487524-113487546 GAGGGAGACGAAAATTGGGAGGG - Intronic
937343230 2:121105102-121105124 GAGGAGGCCCACAGTGGGGTGGG + Intergenic
937600642 2:123727341-123727363 GAGGAGGAAGAAAATGAGATTGG + Intergenic
938671965 2:133595366-133595388 GAGGAGGAAGAAGAAGGGGGAGG - Intergenic
939159405 2:138568353-138568375 TAGGAGGAAGAATTTGGGGTTGG + Intronic
939997830 2:148936951-148936973 GAGGAGGAGGAAAAGGGAGCAGG - Intronic
940691640 2:156926350-156926372 GAGGAGGAAGAATGTGGGGTTGG - Intergenic
941016595 2:160364488-160364510 GAGGAGGAGGCATGTGGGGTAGG - Intronic
941668815 2:168268585-168268607 GAGGAGGAAAAAAATGTGATTGG + Intergenic
942123411 2:172800919-172800941 AATGAGGAGGGAAATGGGGTTGG + Intronic
943099746 2:183473427-183473449 CAGGAGGACCAAAAGGGAGTAGG + Intergenic
943153779 2:184148078-184148100 GAGAAGGACGAAAGTGGGATAGG - Intergenic
943483264 2:188448859-188448881 GAGAAGGAGGAAAAAGGGGAGGG - Intronic
944923258 2:204437499-204437521 GGGAAGGACGAGAATGGGGGTGG - Intergenic
944968356 2:204961977-204961999 GGGGAGGCAAAAAATGGGGTGGG + Intronic
945889731 2:215416785-215416807 GAGGAGGATAAAAATGGGCAGGG + Intronic
945950461 2:216034520-216034542 GAGGAGGAAGGGAATTGGGTAGG - Intronic
946062586 2:216956824-216956846 GGGTAGGAGGAAAAGGGGGTTGG + Intergenic
946294731 2:218774992-218775014 GAGGAGGCCGAAGATTGGGTTGG - Intergenic
946857670 2:223968899-223968921 GAGGAGGAGGAAAAGGGGGATGG - Intergenic
947636948 2:231684987-231685009 GAGGAGGAGGAGGATGGGGAAGG + Intergenic
948492564 2:238322391-238322413 GAGGAGGAGGAACATGGGCTGGG + Intronic
1168901472 20:1368780-1368802 GAGGAGGGGGAATGTGGGGTAGG - Intronic
1169171006 20:3465356-3465378 GAGGAGGAGGAAAATGCAGAAGG - Intergenic
1170444341 20:16409801-16409823 GAAAAGGACCAAGATGGGGTGGG + Intronic
1171360216 20:24582102-24582124 GGGGAGGACGTACATGGGGGAGG - Intronic
1172115000 20:32568532-32568554 GAGCAGGAAGAACATGGGGAGGG - Intronic
1172956561 20:38763841-38763863 GAGGAGGAGGAAGATGGGTTGGG - Intronic
1173201958 20:40960975-40960997 GAGGGGGAAGAAAAGGGGGAGGG + Intergenic
1173417105 20:42866439-42866461 GGGGAGGAGGAAAAGGGGGTTGG - Intronic
1173562098 20:44013276-44013298 GAACAGGAAGAAAATGGGGGAGG - Intronic
1174551188 20:51362874-51362896 GGAGAGGAAGCAAATGGGGTGGG - Intergenic
1174783969 20:53415453-53415475 GAGGAAGAGGAAGAAGGGGTGGG - Intronic
1175516543 20:59574061-59574083 GAGGAGGATGGAAGTGGGGTAGG - Intergenic
1175722567 20:61296008-61296030 CAGGAGGACGGAGAAGGGGTGGG + Intronic
1175923004 20:62458794-62458816 GGGGAGGAGGAAGACGGGGTGGG - Intergenic
1176222330 20:63975543-63975565 GAAGAGGGTGAGAATGGGGTGGG + Intronic
1176720414 21:10388126-10388148 GAGGAGGAGGAAGAAGGGGAAGG + Intergenic
1180070867 21:45435287-45435309 GAAGAGGAGGAAGGTGGGGTGGG + Intronic
1181054954 22:20256512-20256534 GGGGAGGAAGAAAAGGGGATGGG - Intronic
1181348768 22:22240421-22240443 GAGGAGGAAGAGGAGGGGGTTGG + Intergenic
1181711861 22:24696182-24696204 GTGGAGGAGGAGAAAGGGGTGGG - Intergenic
1182069689 22:27454907-27454929 GAGAAGGAGTTAAATGGGGTGGG - Intergenic
1182551822 22:31104806-31104828 GGGAAGGAAGAAAGTGGGGTTGG + Exonic
1182862318 22:33570748-33570770 GAGGAGGAGGAAAAGTGCGTGGG + Intronic
1184547792 22:45183910-45183932 GAGGAGGAGGAAGACGGGGCAGG + Intronic
1185398208 22:50603352-50603374 GAGGAGGAGGGAGATGGGGAAGG + Exonic
950104161 3:10377732-10377754 GAGGAAGACAAGAATGGGTTTGG - Intronic
950421630 3:12903072-12903094 GAGGAGTACAAAATTGGGGCTGG - Intronic
951116888 3:18874030-18874052 GAAGAGGAAGAAAATGGGGTAGG + Intergenic
951618377 3:24573761-24573783 GAGGAGGAGGAAAGTAGGATTGG - Intergenic
951745739 3:25975229-25975251 GAGGAGGAAGAAGATGTGGAAGG - Intergenic
951765585 3:26194881-26194903 GAGCAGGAACAAGATGGGGTGGG - Intergenic
952158377 3:30668623-30668645 GAGTAGGGCAGAAATGGGGTGGG - Intronic
952241202 3:31532887-31532909 GAGGAGGAAGAAAAAGGAGGAGG - Exonic
953066205 3:39473314-39473336 GAGGAGGGGGAACATGGGGAAGG + Intronic
953411040 3:42690672-42690694 GAGGAGCAAGAGAATGGGGAAGG + Intronic
956482660 3:69688603-69688625 GAGGAGGAGGAAGAGGGGGAGGG - Intergenic
956542292 3:70354533-70354555 GAGCATGACGAAAATGGTGGTGG + Intergenic
956879671 3:73498200-73498222 GAGGATGGAGAAAATGGGATGGG - Intronic
957421510 3:79977535-79977557 GGGGAGGAAGAAGATGGGTTGGG + Intergenic
957520342 3:81311215-81311237 GAGGAGGAAGAAAAGGAGGAAGG + Intergenic
957998052 3:87716243-87716265 GAAGAGGAGGAAAATGGAGGTGG + Intergenic
960815604 3:121668770-121668792 ACGGAGGAGGAAAAGGGGGTTGG - Intronic
960899661 3:122542219-122542241 GAGGAGGAGAAGAAAGGGGTAGG - Intronic
961103827 3:124224030-124224052 CAGCAGGACACAAATGGGGTGGG + Intronic
961399761 3:126630556-126630578 GACGAGGGGGAAAATGGGGTTGG + Intronic
961520451 3:127464686-127464708 GAGGAGGAGGAATGTGAGGTGGG + Intergenic
962130251 3:132665221-132665243 GAGGGAGAGGAAAATGGGGGTGG + Intronic
962498405 3:135965681-135965703 GAGGAGGAGGAGAAGGAGGTAGG + Exonic
963032626 3:140993807-140993829 GAGGAGGAGGAAGAAGGGGCTGG - Intergenic
963274669 3:143318021-143318043 GAGAAGGAAGAAAATGAGGCCGG - Intronic
963489214 3:145977984-145978006 CTTGAGGATGAAAATGGGGTAGG - Intergenic
964441722 3:156718178-156718200 GAGGAGGAGGAAGGGGGGGTTGG + Intergenic
964667623 3:159191311-159191333 GAGGAGGAGGAGGCTGGGGTTGG + Intronic
964838844 3:160971538-160971560 GAGGAGGAAGAAATTAGGTTTGG + Intronic
966949594 3:184804189-184804211 GAGGAGGAGAAAAATAGGGCTGG - Intergenic
967341708 3:188405910-188405932 GAGGAGGAGGAAAAGGAGGAAGG - Intronic
967703325 3:192620132-192620154 GAGGAGGATGAGAGTGAGGTCGG - Intronic
967813651 3:193781134-193781156 GAGGAGGAAGGAAGCGGGGTGGG + Intergenic
968555479 4:1244589-1244611 GAGGGGGAAGAAGATGGGGTTGG - Intronic
968889187 4:3358946-3358968 GAGGAGGAGGAAGAAGGGGAGGG - Intronic
968889207 4:3358997-3359019 GAGGAGGAGGAAGAAGGGGAGGG - Intronic
968889216 4:3359020-3359042 GAGGAGGAGGAAGAGGGGGAGGG - Intronic
969134038 4:5015667-5015689 GAGGAGGAGGAAACTGGGTGTGG + Intronic
969580423 4:8061408-8061430 GAGGAGGAAGAAAAGGGGAGAGG + Intronic
969607766 4:8211103-8211125 GAGGGGGAAGAAAATGGGAGGGG - Intronic
971626673 4:28929756-28929778 GAGGGGGAAGAAAATGGAGATGG - Intergenic
971662975 4:29444098-29444120 GAGGAGGAAGAAGATGGGAAGGG - Intergenic
971732063 4:30397156-30397178 GAGGAGAAAGAAAAAGGGATGGG - Intergenic
972032382 4:34477783-34477805 GAGGAGGAGGAGGAGGGGGTGGG - Intergenic
972391283 4:38616032-38616054 GAGGAGGAGGAAAAAGGAGCAGG + Intergenic
973368696 4:49228232-49228254 GGGGTGGAAAAAAATGGGGTGGG - Intergenic
973392349 4:49567182-49567204 GGGGTGGAAAAAAATGGGGTGGG + Intergenic
973577307 4:52303092-52303114 GAGGAGGATTGTAATGGGGTGGG + Intergenic
974573730 4:63689227-63689249 GAGGAGGGGAAACATGGGGTTGG + Intergenic
975847677 4:78541995-78542017 GAGTAGGAGGAAAGTGTGGTGGG - Intronic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
977934395 4:102784774-102784796 GAGGAGGAGGAGGTTGGGGTGGG - Intergenic
978108113 4:104929760-104929782 GTGGAGGAAGAAAATGGAATTGG - Intergenic
978311403 4:107388126-107388148 GAGAAAAAGGAAAATGGGGTTGG - Intergenic
980018909 4:127684599-127684621 GAGGAGGAGGAAAGAGGGGAGGG - Intronic
980492129 4:133541922-133541944 GAGGAGGACACACATGGGGGAGG - Intergenic
980844912 4:138312811-138312833 GAGGAGGAGGAGAAAGGGGCAGG - Intergenic
980875914 4:138661975-138661997 GAGGACTAGGAAAATGAGGTTGG - Intergenic
981085301 4:140677177-140677199 GAGGAGGTGGAAAATGGGCTGGG - Intronic
981394302 4:144229125-144229147 GAGGAGGAAGAAAAAGGAGGAGG + Intergenic
982114361 4:152085163-152085185 GAGGAGGACTAGAATGGTGGAGG - Intergenic
982373983 4:154667310-154667332 GAGGAGGAGGAGAATGGGAGGGG + Intronic
984334512 4:178372399-178372421 GAAGAGGAGGAAAAAGAGGTTGG - Intergenic
984868765 4:184309005-184309027 GAAGAGGAGGAAGAGGGGGTTGG + Intergenic
984979715 4:185267993-185268015 GAGGAGGAAGAGAATGAGGAGGG + Intronic
986916365 5:12625296-12625318 GAAGAGGAATAATATGGGGTTGG + Intergenic
986953349 5:13119304-13119326 GAGGAGGAGGAAGAGGAGGTAGG + Intergenic
988040918 5:25888139-25888161 GTGGAGGAGAAATATGGGGTTGG - Intergenic
988615595 5:32771650-32771672 GAGGAGGACGAGAAGGGGATGGG + Intronic
988954570 5:36301942-36301964 GAGGAGGAGCAAAGTGGGCTAGG + Intronic
989112836 5:37923862-37923884 GAAGAGGTAGAAAATGAGGTTGG - Intergenic
989600219 5:43193398-43193420 CAGGAGGACGAAAACAGGGGAGG - Exonic
990012301 5:51014166-51014188 AAGTAGGAAGAAAATGGAGTTGG - Intergenic
990184147 5:53194915-53194937 GAGGAAGAAGAAAAATGGGTAGG + Intergenic
990995238 5:61726627-61726649 GAGGAGGAGGAAAAAGGAGGAGG - Intronic
992090675 5:73313093-73313115 GAGGAGGAAGAAAAAGGAGGAGG - Intergenic
992349684 5:75916299-75916321 GAAGAGGACGAGAAAGGGGAAGG - Intergenic
993107984 5:83622065-83622087 GAGAAGGAGGAAAATAGGATTGG + Intergenic
993696406 5:91066955-91066977 GTGGAGGATGAACATGGAGTAGG + Intronic
993716128 5:91277355-91277377 GAGGAGGAGGAGAAGGGGGAGGG + Intergenic
993858103 5:93100216-93100238 GAGGAGGAGGGTTATGGGGTTGG - Intergenic
994007311 5:94854048-94854070 GAGGAAGATGAAGATGGGATGGG + Intronic
996015643 5:118531295-118531317 GAGGATGAGGTAGATGGGGTAGG - Intergenic
996165745 5:120220734-120220756 GAGGAGGAGGAAAAGGAGGTGGG - Intergenic
999439650 5:151591347-151591369 GAGGAGGAGGAAAAAGGAGGTGG + Intergenic
999503093 5:152166215-152166237 AAGGAGGTTGAAAATGGGGTGGG + Intergenic
1001683782 5:173577468-173577490 AGGGAGGAGGAAGATGGGGTGGG + Intergenic
1001769883 5:174286309-174286331 GAGGAGGAGAAAGATGGGGGAGG + Intergenic
1002168540 5:177362673-177362695 GAGGGGGAGGAAAATGGGTGAGG + Intronic
1002720804 5:181260596-181260618 GAGGAGGACGAGGAAGCGGTGGG - Exonic
1003551623 6:7106972-7106994 GAGGGGGACCAAAGTCGGGTCGG + Intergenic
1004166576 6:13262092-13262114 GAGGAGGACCAGAGTGGGATAGG + Intronic
1004204034 6:13574789-13574811 GAGGGGGATGGAAACGGGGTTGG + Intronic
1004720337 6:18263836-18263858 GAGGAGGAGGAAAAAGGTGGGGG - Exonic
1004813125 6:19281692-19281714 AAGGAGAAAAAAAATGGGGTGGG + Intergenic
1005451546 6:25977695-25977717 GAGGAGGAAGAGAAAGAGGTGGG + Intronic
1005506869 6:26476975-26476997 GAGGAGGAAGAAAATGAGAGTGG - Intergenic
1006063389 6:31442355-31442377 GAGGAGGAGGAAAAAGGAGGAGG + Intergenic
1006197477 6:32254827-32254849 GGGGAGGAGGAAGATGGGGGAGG + Intergenic
1006197483 6:32254846-32254868 GAGGAAGAGGATGATGGGGTGGG + Intergenic
1006632846 6:35441679-35441701 GAGGAGGAGGGAAAGGGGGCGGG + Intergenic
1007289142 6:40771856-40771878 GAGGTGGAAGAAAATGGAATTGG - Intergenic
1007361562 6:41360390-41360412 GTGGAGGGCAAATATGGGGTTGG + Intergenic
1008517172 6:52329094-52329116 GAGTAGACCGAGAATGGGGTGGG - Intergenic
1008908179 6:56703643-56703665 GAGGATGAGGATAAGGGGGTAGG - Intronic
1009611643 6:65950318-65950340 AAGGAGAAGGAAAATGTGGTTGG - Intergenic
1010041671 6:71391907-71391929 GAGGAAGAGGAAAATGAGGCTGG - Intergenic
1010204565 6:73310486-73310508 GAGGGCGTCGAAAATGGGGCTGG + Intergenic
1011398611 6:86936880-86936902 GAAGTGGACGAAAATTGGGGTGG - Intergenic
1011483222 6:87815852-87815874 GAGGAGGAAGAAAATAAGTTTGG + Intergenic
1011483556 6:87819116-87819138 GAGGAGGAAGAAAATAGGTTTGG + Intergenic
1013044693 6:106473112-106473134 AAGGAGGAATAAAATGGGCTTGG + Intergenic
1013668823 6:112376151-112376173 GAGGAGAAGGAAAATGAGGGAGG + Intergenic
1014126132 6:117779268-117779290 GAGGAGGAGAAAAATGGGTGGGG - Intergenic
1014465401 6:121750370-121750392 AAGGAAGAGGAAAATGGGGCAGG + Intergenic
1014501637 6:122197762-122197784 GAGGAGGAAGAAAACGGGATGGG + Intergenic
1014617553 6:123622128-123622150 GAGGAGGAGGAAAAAGAGGAAGG - Intronic
1014989073 6:128051649-128051671 TAGGAGGAAGAAAGTGAGGTAGG - Intronic
1017252414 6:152295419-152295441 GTGGAGGACTGAAGTGGGGTGGG - Intronic
1017599553 6:156065576-156065598 GAGGTGGAAGACAATGGTGTGGG + Intergenic
1017777006 6:157688392-157688414 GAGGAGGAAGACAAGGGGGATGG + Intergenic
1017792346 6:157812481-157812503 GAGGAAGAAGGAAATGGGTTTGG - Intronic
1018355537 6:163011104-163011126 GAAGAGGAAGAAAAGGGGCTGGG + Intronic
1018861809 6:167716038-167716060 GGGGAGGAAGAAAAGTGGGTAGG + Intergenic
1019517469 7:1446283-1446305 GAGGAGGGGGAAAAAGGGGGAGG + Intronic
1019517498 7:1446370-1446392 GAGGAGGAAGAGAAGGGGGGAGG + Intronic
1019517507 7:1446389-1446411 GAGGAGGGGGAAAAAGGGGGAGG + Intronic
1020770368 7:12384558-12384580 GGGGACGTCGACAATGGGGTTGG + Intronic
1021777975 7:24072528-24072550 GAGGAGGCCGAAAAGGGGTGAGG - Intergenic
1022845936 7:34209741-34209763 GTGAAGGAAGAAAATGGGGAGGG + Intergenic
1023372930 7:39530085-39530107 GAGGAGGACGGAGAAGGGATGGG + Intergenic
1023889659 7:44383064-44383086 GAGGAGGCTGGAGATGGGGTGGG + Exonic
1024104352 7:46067066-46067088 GAGGAGGAGGAAAAGGAGATGGG - Intergenic
1024157225 7:46638153-46638175 GAGGAGGACCACAGTGGGATGGG - Intergenic
1024294296 7:47830401-47830423 AAGGGGGAGGAAAATGGGTTGGG + Intronic
1024295966 7:47842586-47842608 GTGGAGGATGAAGATGGGGTGGG - Intronic
1024955136 7:54910519-54910541 TAGGAGCAGGAAAAAGGGGTAGG + Intergenic
1025085922 7:56023177-56023199 AAGGAGAACGAAAATGGTGAAGG + Intronic
1025770538 7:64501237-64501259 GAGGAGGAGGAAAATGTGCTGGG - Intergenic
1025887750 7:65614423-65614445 GAGGAGGAGGAAGAAGGGGAAGG - Intergenic
1026121114 7:67538615-67538637 CAGGAGGAAGAAAGTGGGGGTGG - Intergenic
1026360787 7:69599464-69599486 GAGGAGAAAGAAAAGGGGGAAGG - Exonic
1026388942 7:69880158-69880180 CAGGAGGAAGAAAGTGGGGGTGG + Intronic
1028212055 7:88085743-88085765 GAGGAGGATGAAAAGGGCTTGGG - Intronic
1028433527 7:90775652-90775674 GAGGAGGAGGAGAAAGGGGGAGG - Intronic
1028829355 7:95310578-95310600 GAGGATGAGGAAAATGAGATTGG - Intronic
1029425032 7:100489567-100489589 GAGGAGGAAGAAGAGGAGGTGGG + Exonic
1029537947 7:101166780-101166802 GGGGAGGACGGAAATGGGGAGGG + Intergenic
1030638255 7:111974568-111974590 GAGGAGGAAGGAAAAGGGATGGG + Intronic
1031586000 7:123532990-123533012 CAGGAGGAAGAAAGGGGGGTTGG + Intronic
1032014976 7:128373545-128373567 GAAGAGCAGGGAAATGGGGTGGG - Intergenic
1032867167 7:135937768-135937790 GAGGAGGAGGAATTGGGGGTTGG - Intronic
1033024622 7:137760440-137760462 GAAGGGGACGAAGATGGGGCGGG - Intronic
1035948282 8:3990053-3990075 GAGAATGACTAAAATGGAGTGGG + Intronic
1037494494 8:19425608-19425630 GAGGAGGACGAACAAAGGGATGG - Intronic
1037691225 8:21183234-21183256 GAGGAGGAGGAAAAGGGGAAGGG - Intergenic
1039436012 8:37559668-37559690 GAGGAGGAGGAAAAGGAGGAGGG + Intergenic
1039582445 8:38677959-38677981 GGGGAGGATAAAAAAGGGGTTGG + Intergenic
1040682561 8:49831040-49831062 GAGGAGGAGGAAGAAGGGGAGGG + Intergenic
1041746166 8:61211386-61211408 GAGGAGGAGGTAAAGGGGGAAGG - Intronic
1041936596 8:63338756-63338778 GAGGAGGAAAAAAATGGTGAAGG + Intergenic
1042959515 8:74288525-74288547 GAAGAGTAAGAAAATGGGGTTGG + Intronic
1043486300 8:80702176-80702198 GAGGAGAACAAAGATGGGCTGGG + Intronic
1043499475 8:80838567-80838589 GAGGAGGAGGAAAAGGGGGGAGG + Intronic
1044489047 8:92790335-92790357 GAGGAGGAAAAGAATGGGTTGGG + Intergenic
1046175532 8:110570904-110570926 GTGGAGGGGGAATATGGGGTTGG - Intergenic
1048007638 8:130432027-130432049 AAGGAGGGGGAAAATGAGGTGGG + Intronic
1048325563 8:133436528-133436550 GAGTAGGAGGAAAACAGGGTTGG - Intergenic
1048543533 8:135365024-135365046 GAAGAGGACGGAGATGGGATGGG - Intergenic
1049281656 8:141752666-141752688 GAGGGGGACGGAAATGAGGAGGG + Intergenic
1049469265 8:142768212-142768234 GAGGAGGAGGGAGGTGGGGTGGG + Intronic
1049654770 8:143792683-143792705 GAGGGGCACGGAAGTGGGGTGGG - Intronic
1049898098 9:129660-129682 GAGGGAGACGAAAATTGGGGGGG + Intronic
1050375820 9:4971733-4971755 AAGGAGGAGGAAGATTGGGTAGG - Intergenic
1050744193 9:8857928-8857950 GAGGAGGAGGAAAAGGGGGTAGG - Intronic
1051038291 9:12775911-12775933 GAGGAGGACGACAAGGAGGGAGG - Exonic
1052204756 9:25826416-25826438 GAGGAGGTAGATAATGAGGTAGG - Intergenic
1052406835 9:28072027-28072049 AAGGAGGATGAAGATGGGATTGG - Intronic
1058278406 9:103077609-103077631 GAGGAGGAAAAAAATGGGGTTGG + Intergenic
1058705744 9:107636945-107636967 GAGGAGGAAGAAGAGAGGGTAGG + Intergenic
1058889977 9:109353235-109353257 GAGGAGGAAGAAAGTGGGAAAGG + Intergenic
1059419735 9:114183463-114183485 GAGGAGGATGAATGCGGGGTGGG + Intronic
1059449195 9:114359708-114359730 GAGGAGGAGGAAGAGGGGGGAGG - Exonic
1059882842 9:118710802-118710824 GAGGAGGAAGAAAAAGGAGTAGG + Intergenic
1061370730 9:130196007-130196029 GAGGAGGGGGAAAATGGGCCGGG + Intronic
1062361513 9:136190438-136190460 GCAGAGGAAGAAAATGGGGAGGG + Intergenic
1185603646 X:1355122-1355144 GAGGAGGAGGAGAATGGGCAGGG + Intronic
1186551147 X:10507143-10507165 GGGGAGGAAAAAAAGGGGGTAGG - Intronic
1187196751 X:17093660-17093682 GAGGAGAAAGATAATGGGGGAGG - Intronic
1187403746 X:18984425-18984447 GAGGAGGAAGGAAAAGGGGGCGG + Exonic
1188165858 X:26862689-26862711 CAGGAGCAAGAAAATGGGGGAGG - Intergenic
1190073838 X:47300976-47300998 GAGGAGGAGGAAAAAGGGGAAGG + Intergenic
1190250268 X:48718189-48718211 GAGGAGGAAGAAAGGGGGGTGGG - Intergenic
1190334290 X:49253075-49253097 GAGGAAGACAAAGATGGGGTGGG - Intronic
1190823890 X:53999213-53999235 GAGGAGGAAGAAAAAGGAGAGGG - Intronic
1191736929 X:64396991-64397013 GAGCAGGAGGAAAATGGGCAGGG - Intergenic
1193594001 X:83423343-83423365 GAGGAAGAAAAAAATGAGGTTGG + Intergenic
1194297186 X:92141604-92141626 GATGAGGAAGAAAATGGCATTGG - Intronic
1195278778 X:103310232-103310254 ATGGAGGACGAAGAAGGGGTGGG + Intronic
1195289752 X:103420681-103420703 GTGGAGGAGAAATATGGGGTTGG - Intergenic
1197669898 X:129264944-129264966 GAGGAGGAATAAAAGAGGGTAGG - Intergenic
1200614704 Y:5366175-5366197 GATGAGGAAGAAAATGGCATTGG - Intronic
1201300269 Y:12498827-12498849 GAGGAGGAGGAGAAGGGGGAGGG - Intergenic