ID: 1103663255

View in Genome Browser
Species Human (GRCh38)
Location 12:122539261-122539283
Sequence CATGGTAACCAAGACCCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103663255_1103663260 20 Left 1103663255 12:122539261-122539283 CCTTTGGGGTCTTGGTTACCATG 0: 1
1: 0
2: 3
3: 21
4: 107
Right 1103663260 12:122539304-122539326 AGTTTCTTCCCTATACTGAATGG 0: 1
1: 0
2: 2
3: 12
4: 177
1103663255_1103663256 -7 Left 1103663255 12:122539261-122539283 CCTTTGGGGTCTTGGTTACCATG 0: 1
1: 0
2: 3
3: 21
4: 107
Right 1103663256 12:122539277-122539299 TACCATGTCTCTTGCCTGCCAGG 0: 1
1: 1
2: 1
3: 22
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103663255 Original CRISPR CATGGTAACCAAGACCCCAA AGG (reversed) Intronic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
902664040 1:17925068-17925090 CATGGAAACAAAGACCCAGAGGG - Intergenic
903677059 1:25071102-25071124 CACGGAAGCCAAGACCCAAAGGG - Intergenic
905243892 1:36599068-36599090 CATGGTCACCAAGACCCGGAGGG + Intergenic
913034463 1:114949599-114949621 CATAGTAATCAAGACCCCATGGG - Intronic
914228475 1:145742528-145742550 CAGGGAAACAAAGACCCTAAAGG + Exonic
918025743 1:180744082-180744104 CATGTCAACCAAGTTCCCAAAGG - Intronic
920021936 1:202962888-202962910 CCTGGTAAACAGGAACCCAAAGG + Intronic
922318305 1:224462121-224462143 GATGGTAACAAATACACCAACGG - Intronic
923162124 1:231323697-231323719 CATGGGGAACAAGACCCCACAGG + Intergenic
1065737068 10:28763913-28763935 AATGGTAACCGAGACCTGAAAGG + Intergenic
1066182376 10:32975682-32975704 AATTGTAACCAAAACACCAAGGG - Intronic
1068599119 10:58937115-58937137 CTTGGTAACCAAGATCTCAATGG + Intergenic
1072893081 10:99342391-99342413 CATGGTAACCAACATCACTAGGG - Intronic
1077333627 11:1994049-1994071 CCTGGACACCAAGACCCCAAGGG + Intergenic
1078066543 11:8082489-8082511 CATGGCAACCAAGGAGCCAATGG - Intronic
1085689539 11:78654117-78654139 CATTCTAACAAGGACCCCAAGGG + Exonic
1086065404 11:82738329-82738351 CTTGGGAACCAAGTCCCCCAGGG + Intergenic
1087781446 11:102305024-102305046 CAAGGCAACCAAGACCTCAAGGG + Intergenic
1088370955 11:109088241-109088263 CATGGTAACCATGACCAGAATGG + Intergenic
1090154605 11:124424457-124424479 CATGGTCACCATGTCCCCAAGGG - Exonic
1202816608 11_KI270721v1_random:49231-49253 CCTGGACACCAAGACCCCAAGGG + Intergenic
1093260044 12:16924753-16924775 CATGTTAACCTAGACCCCAAGGG + Intergenic
1097559748 12:61188722-61188744 CACGGTAACCAAGATCCCAATGG + Intergenic
1103663255 12:122539261-122539283 CATGGTAACCAAGACCCCAAAGG - Intronic
1106009626 13:25806892-25806914 AATGGAAACCAAAACCACAATGG - Intronic
1108589837 13:51903343-51903365 ATTGGAAACCAAGACCTCAATGG - Intergenic
1111092881 13:83470407-83470429 CTTCGTAATCAAGACCCCTATGG + Intergenic
1118753721 14:68823748-68823770 CATGGTAAGCCAGATCCCAGTGG - Intergenic
1120953619 14:90062803-90062825 CATGTTAACAAAGTCCCCAAAGG + Intronic
1122573148 14:102722327-102722349 CATGGTAAAGAAGAGACCAATGG + Exonic
1122802042 14:104235994-104236016 ACTGGTCACCAAGACCCCAGTGG - Intergenic
1123945772 15:25238220-25238242 CATGGGCACCAAGCCCGCAACGG - Intergenic
1124496556 15:30191123-30191145 CATGGTAACCAAGACAGGAATGG - Intergenic
1124560860 15:30771874-30771896 CCTGGTGACCAAGTCCCTAAGGG - Intronic
1124670353 15:31633576-31633598 CCTGGTGACCAAGTCCCTAAGGG + Intronic
1124747019 15:32347525-32347547 CATGGTAACCAAGACAGGAATGG + Intergenic
1126868814 15:52965537-52965559 CATGCAAACCAAAACCACAATGG + Intergenic
1130518919 15:84647409-84647431 CATGGCATCCAAGCCCCAAATGG - Intronic
1131490045 15:92854816-92854838 CTTGGAAACCAAGACCCAACAGG + Intergenic
1135128765 16:19834492-19834514 CATGGTAACTAAGGACCCACAGG + Intronic
1135843217 16:25895198-25895220 CATGGTAACCATGCCTACAAAGG + Intronic
1143239318 17:5430519-5430541 AATGGTAACACAGACTCCAAAGG - Intronic
1143574042 17:7779394-7779416 CATGGTAATGAAGATCCCACAGG - Exonic
1148120181 17:45204571-45204593 CATCATGACCAAGAGCCCAAAGG - Intergenic
1151492875 17:74443190-74443212 CCGGGAAACCAACACCCCAAAGG + Intronic
1152246003 17:79184873-79184895 TGTGGAAACCAAGGCCCCAAGGG - Intronic
1155527454 18:26731504-26731526 CATGTTCACCAACAGCCCAAGGG - Intergenic
1162332399 19:10038395-10038417 CATGGCAACCTAGCTCCCAAAGG + Intergenic
1164701642 19:30288977-30288999 CTTGCTAACCAAGGTCCCAAGGG - Intronic
1165168773 19:33875981-33876003 AATTGTCACAAAGACCCCAATGG + Intergenic
1165467506 19:35983734-35983756 CCTGGTTACCAGGACCCCAAGGG - Intergenic
1166359977 19:42249034-42249056 CATGGCACCCGAGACCCCACCGG - Exonic
1167717897 19:51155668-51155690 GGTGGTACCCAGGACCCCAAAGG - Intergenic
927371968 2:22366624-22366646 TATGGTAACCATTACCACAAAGG + Intergenic
930177592 2:48315525-48315547 AAAGGTAACCACGGCCCCAAAGG - Intronic
930301206 2:49618263-49618285 CATGGTAACCATGAACCCCAAGG - Intergenic
932448826 2:71796719-71796741 CATGCTAACCAAGACCATGACGG - Intergenic
932738649 2:74274692-74274714 AATGCTAACCAAGATCACAAAGG + Intronic
939484406 2:142792217-142792239 AATGCAAACCAAAACCCCAATGG + Intergenic
940642074 2:156355389-156355411 CCTGGTAACCAATTCCCCCATGG + Intergenic
941003978 2:160228400-160228422 CCTGAAAACCCAGACCCCAAAGG + Intronic
941783602 2:169475570-169475592 CAATGGAACCAAGAGCCCAAAGG - Intergenic
943567868 2:189537871-189537893 CATGGTAAAAAAAACCCCAAAGG - Intergenic
947344132 2:229173281-229173303 CATGGTCACCAAAATGCCAATGG + Intronic
1169240958 20:3980366-3980388 ACTGATAACCAAGACCCTAATGG + Intronic
1170212828 20:13862317-13862339 GATGGGAACATAGACCCCAAGGG - Intronic
1170669281 20:18415830-18415852 TATGGAAACCAAAACTCCAAAGG - Intronic
1171121318 20:22571476-22571498 CATGATGACCAAGAGCCCAGAGG + Intergenic
1173017532 20:39239074-39239096 CAATCTCACCAAGACCCCAAAGG - Intergenic
1173327350 20:42046159-42046181 CATGGGCACTAAGACCCTAATGG - Intergenic
1175956329 20:62611442-62611464 CATGTTCACCAAGATCCCATTGG + Intergenic
1180015480 21:45080019-45080041 CCTGGAAACCAAGACACCGAGGG + Intronic
1181973258 22:26709854-26709876 CAAGGTGACCAAGACCCCACTGG + Intergenic
1182621427 22:31620768-31620790 CATGGCAGCCAAGACCCAAAGGG + Intronic
950334153 3:12180504-12180526 CATGGTAGCCAAGCCCCACAGGG + Intronic
952325638 3:32318236-32318258 CATGGCAAGGAAGACCCCAAAGG + Intronic
954134206 3:48574684-48574706 AATGGTGACCAAGGTCCCAAAGG - Exonic
956041018 3:65144937-65144959 CATGGGAGCCAAGATGCCAAGGG + Intergenic
957199084 3:77108887-77108909 CATGTTATCCTAGAACCCAAGGG + Intronic
958173400 3:89965097-89965119 CATGGTAACCAAAATCCCAATGG + Intergenic
959621849 3:108407258-108407280 GATGGAAAACAAGACCCCAAAGG - Intronic
960692865 3:120365406-120365428 TTTGGTAACCATGACCCTAATGG + Intergenic
963074587 3:141334258-141334280 CATGGTAACCTAGAACCTCAGGG + Intronic
964233216 3:154494989-154495011 CATTGTAACTGAGACCACAAGGG + Intergenic
965320595 3:167248244-167248266 GACGGTAACCATGACCCCACAGG + Intronic
967949527 3:194830142-194830164 TAAGGTAACCCAGACCCCTAAGG + Intergenic
969214035 4:5708787-5708809 CGAGGTTACCAGGACCCCAAGGG + Intronic
973156624 4:46963066-46963088 CATGGCAACCAAAACCACAATGG + Intronic
974290725 4:59926222-59926244 GATCTTAACCAAGACCACAAAGG + Intergenic
975260563 4:72292630-72292652 CATGGTTACCAAGTCCCAAAGGG + Intronic
977561978 4:98541791-98541813 CAGGATAACCAAGACCCAGATGG - Intronic
979562917 4:122120389-122120411 CATGCTAACCCAGACTCCCATGG + Intergenic
981172622 4:141642463-141642485 CATGGTAATCCAGAAGCCAAAGG - Intronic
984220804 4:176972087-176972109 CATGTTAGCCATGACCCCCAGGG - Intergenic
991236486 5:64405508-64405530 CATGGTAACCAAGGGCCTGATGG + Intergenic
994844555 5:104970504-104970526 CATTTTATCCAGGACCCCAAAGG - Intergenic
996874458 5:128225891-128225913 GATGGGAACCATGAACCCAAAGG - Intergenic
997501419 5:134377700-134377722 GAGGGTCTCCAAGACCCCAAGGG - Intronic
998996861 5:147875311-147875333 CAAGGTCAGCAAGGCCCCAAGGG + Intronic
1003746377 6:9007004-9007026 CAAGGTCACTAAGATCCCAATGG + Intergenic
1003960972 6:11209018-11209040 CATGGTTGCCAAGAACCCACAGG - Intronic
1004240395 6:13916129-13916151 CCTGGTGACCAAGACCTCACTGG - Intergenic
1006021698 6:31121282-31121304 GCTGGTAACCCAGACCTCAAGGG + Intronic
1009608248 6:65902375-65902397 GATGGGAACCAAGATCCCTAAGG - Intergenic
1017706393 6:157127305-157127327 CATGGTAACCAAGAGAGCACTGG - Intronic
1020927297 7:14347162-14347184 CATAATAACCAAGATCCCAGTGG - Intronic
1026199376 7:68201045-68201067 CACGGAAACCATGACCCCATGGG - Intergenic
1031642469 7:124181239-124181261 CATGGTAACCAAGACTGACACGG - Intergenic
1032440756 7:131941384-131941406 CATTGTGGCCAAGTCCCCAAGGG + Intergenic
1035218431 7:157389545-157389567 CTTTGAAATCAAGACCCCAAAGG - Intronic
1036503148 8:9331787-9331809 CCTAGGAACCAAAACCCCAAAGG - Intergenic
1037899245 8:22677936-22677958 CACAGTTGCCAAGACCCCAAGGG + Intergenic
1038364039 8:26912959-26912981 CAAGGGGACTAAGACCCCAAGGG + Intergenic
1040879891 8:52193089-52193111 CATGGTGACCAAGGGCTCAAAGG + Intronic
1041991251 8:63994705-63994727 CATGGTACCCATTCCCCCAACGG - Intergenic
1043523318 8:81069890-81069912 GATAGAAACCAAGACGCCAATGG - Intronic
1043701790 8:83298344-83298366 CATGGTAACCAAGATGCCATGGG + Intergenic
1046750962 8:117926001-117926023 TAAGGAAACCAAGACCCAAAGGG + Intronic
1048175041 8:132144335-132144357 CCTGAAATCCAAGACCCCAAAGG + Intronic
1048410097 8:134163562-134163584 CCTGGTAAGCAAGAACACAATGG - Intergenic
1050085388 9:1959750-1959772 TATGGCAACCAAGACACCAGTGG - Intergenic
1051409113 9:16770553-16770575 CATGGTAACCAATCACCCAGGGG + Intronic
1051551114 9:18330485-18330507 CATGGAAAGCAAGACCCTGAGGG - Intergenic
1051756930 9:20411362-20411384 CATGTAAACCATGAACCCAAAGG - Intronic
1057463392 9:95288617-95288639 CTTGGTAACCAAGACGTCAGGGG - Intronic
1190744843 X:53316375-53316397 AAAAGTACCCAAGACCCCAAAGG + Intronic
1194479380 X:94401290-94401312 GATGGTAACCCAGGGCCCAAGGG + Intergenic
1194534867 X:95094184-95094206 GGTTGTAACCAAGTCCCCAAGGG - Intergenic
1196101738 X:111853978-111854000 CATGGGAAACAGGAACCCAATGG + Exonic
1198228047 X:134664540-134664562 CATGCTAACTCAGGCCCCAAAGG - Intronic
1199025265 X:142928874-142928896 CATGGTAAAGAAAACCCCCAAGG - Intergenic