ID: 1103664157

View in Genome Browser
Species Human (GRCh38)
Location 12:122548618-122548640
Sequence CATTCAACAGAGTTGGAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103664152_1103664157 25 Left 1103664152 12:122548570-122548592 CCTTAAATACAAACTGTAGAATG 0: 1
1: 0
2: 1
3: 28
4: 259
Right 1103664157 12:122548618-122548640 CATTCAACAGAGTTGGAATATGG 0: 1
1: 0
2: 0
3: 13
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103664157 Original CRISPR CATTCAACAGAGTTGGAATA TGG Intronic
901562858 1:10086664-10086686 CATTCAACAGTGGTGGGATAAGG + Intronic
903050998 1:20600986-20601008 CAGTTAATACAGTTGGAATATGG - Intronic
903162372 1:21498208-21498230 CATTCAACAGAGAATGAAAACGG - Intergenic
908736289 1:67280161-67280183 CATTCAACAAAATTTTAATATGG + Intergenic
912166030 1:107043923-107043945 GACTCAACAGAGTTGTAGTATGG - Intergenic
912523839 1:110266217-110266239 CATGCAACAGTGTTGGGATCTGG - Intronic
912593227 1:110848709-110848731 CATCCAAGAGAGATGGAAAAGGG - Intergenic
912615713 1:111097620-111097642 CATTCAAGACAGTGGGAAAAAGG - Intergenic
917035995 1:170747375-170747397 GATTCCACAGAGCTGGAATGAGG - Intergenic
918764325 1:188458983-188459005 CTTTCCACAGAATTGGAATCAGG + Intergenic
918857196 1:189772210-189772232 CAATCAACCCAGTTGGAATCAGG - Intergenic
923385349 1:233460524-233460546 CAGTCGCTAGAGTTGGAATATGG + Intergenic
1068742019 10:60484150-60484172 CATTCAACAGAGATCTAAGATGG + Intronic
1068991274 10:63153564-63153586 CATCCAAGAGAGATGGAAAAGGG + Exonic
1069205077 10:65671608-65671630 CAAGTAACAGAGTTGGAATGAGG + Intergenic
1069234288 10:66050704-66050726 CATTCCCCAGAGAAGGAATATGG - Intronic
1070764114 10:79046788-79046810 CATCCAACAAATTTGGAAAAGGG + Intergenic
1074215831 10:111382753-111382775 CATTGAACATAGCTGGAAAAGGG + Intergenic
1074459897 10:113627187-113627209 CATTCAACACAGTGGAACTAGGG - Intronic
1077692173 11:4353894-4353916 GATTCACCAAAGTTGAAATAAGG - Intergenic
1080848385 11:36046237-36046259 CATGCAACAGAGCTGGTACAGGG - Intronic
1083729888 11:64647173-64647195 CATTTTACAGACATGGAATACGG - Intronic
1087317662 11:96622924-96622946 GATTCAAAATAGTTGGAAAAAGG + Intergenic
1092521613 12:9280449-9280471 CATTGACAAGAGTTGGAAAAGGG + Intergenic
1093071567 12:14710855-14710877 CATTGAATAGAGTTGGAATGGGG - Intergenic
1093980783 12:25472991-25473013 AATACAACAGAGTTGGCAAATGG - Intronic
1097510959 12:60539345-60539367 CATTCAAAAGAATTGAAATCAGG - Intergenic
1099592373 12:84610906-84610928 CATTCAACATAGCGGGATTATGG + Intergenic
1100398267 12:94203835-94203857 CTTTCAACAGAGTTGCATTGGGG - Intronic
1100765233 12:97856820-97856842 CATTCAACAGATTCCCAATACGG + Intergenic
1101651459 12:106681198-106681220 CATTCAACAGATGTGGATTGGGG + Intronic
1101809948 12:108098878-108098900 CATGGAACAGAGTTTGAAAATGG - Intergenic
1103664157 12:122548618-122548640 CATTCAACAGAGTTGGAATATGG + Intronic
1106674125 13:31939748-31939770 CACTCAACAGAGTAAGAACAAGG - Intergenic
1107420212 13:40239171-40239193 AATTCAACATAGTTGGATTTGGG - Intergenic
1111795828 13:92918515-92918537 CATACAACAGGGTTGGAAGAAGG + Intergenic
1112144541 13:96683030-96683052 GATGCAACAGAGTTGTTATAAGG + Intronic
1112988036 13:105476644-105476666 CATTCATCAGATTTAGAATGAGG - Intronic
1114640521 14:24216647-24216669 CACTTAATAGAGTTGGAAAAAGG + Intronic
1116014860 14:39394241-39394263 AATACAACAGAGTTGGAAAGTGG + Intergenic
1116301063 14:43184274-43184296 CTTTCAACAAACTGGGAATAAGG + Intergenic
1117305819 14:54472089-54472111 CATGCAACAGTGTTGGACGATGG + Intergenic
1117468003 14:56013638-56013660 AATGCAACAGTGTTGGAAGATGG + Intergenic
1118422303 14:65620245-65620267 CAGTCAACACAGTTGAAAAATGG - Intronic
1120145575 14:80975160-80975182 CATTCAGCAGAGTAAGACTATGG + Intronic
1120442086 14:84554228-84554250 CATTCACGTGAGTTGTAATAGGG - Intergenic
1121983609 14:98477155-98477177 CATTCATCATATTTGGAATAGGG + Intergenic
1123463733 15:20497958-20497980 CACGCAAGAGAGTTGGAATATGG - Intergenic
1123654330 15:22502471-22502493 CACGCAAGAGAGTTGGAGTATGG + Intergenic
1124274580 15:28315328-28315350 CACGCAAGAGAGTTGGAGTATGG - Intronic
1124308238 15:28597665-28597687 CACGCAAGAGAGTTGGAGTATGG + Intergenic
1124857284 15:33401679-33401701 CATTTAACAGTTTTGAAATAAGG + Intronic
1126064484 15:44815705-44815727 CATGCAATAGAGTTGTTATAAGG + Intergenic
1126132052 15:45351516-45351538 CATTCATAAGAGCTGGAATGTGG + Intergenic
1129973824 15:79804407-79804429 CAGTCAACAGCCTTGCAATAGGG - Intergenic
1134015353 16:10884301-10884323 CATTCAACGGTGCTGGAATTGGG + Intronic
1138754513 16:59467115-59467137 CATACAACAGAGTTTTAATGTGG + Intergenic
1139756212 16:69145769-69145791 CCTGCAAGAGAGTTGGCATAAGG + Intronic
1140401504 16:74675512-74675534 CATTCAACAGAGTTGAGTTTAGG + Intronic
1140683512 16:77410429-77410451 GATTCAACAGATCTGGAATGGGG + Intronic
1146838421 17:36131702-36131724 CATTCAGCAGTGTTAGACTAAGG - Intergenic
1146994568 17:37307550-37307572 CATTCAACACAATAGAAATATGG - Intronic
1148143680 17:45346180-45346202 CATTCAAAAGAGTTGGGTTTGGG - Intergenic
1149852085 17:60043805-60043827 CCTTGAACTGAGTGGGAATATGG - Exonic
1150966016 17:69969624-69969646 CAATCAACACAGTTGTAATCTGG + Intergenic
1155124492 18:22858407-22858429 TATTTATCAGAGTTGGAATTTGG + Intronic
1159255747 18:65943267-65943289 CATTCAACAATGTTAAAATAAGG - Intergenic
1159293694 18:66454031-66454053 CATTAAAATGAGATGGAATATGG + Intergenic
1159992159 18:74921460-74921482 CAAGCAGCAGAGTTTGAATAAGG + Intronic
1162897973 19:13776712-13776734 CTTTGAAGAGAGTTGGAAGAAGG - Intronic
1163459148 19:17425765-17425787 CATTCTACAGAGTGGGAAACAGG + Intronic
1163978768 19:20878377-20878399 CATTCATTAGAGTTGGAACCTGG + Intergenic
1164656825 19:29927873-29927895 CATTCAAGAGGGATGGAATTAGG - Intronic
1166650332 19:44569202-44569224 CAATTGACAAAGTTGGAATATGG + Intergenic
926587526 2:14704689-14704711 CATTAGAAATAGTTGGAATATGG + Intergenic
927398417 2:22682711-22682733 CATCCAACACAGTAGTAATACGG - Intergenic
927403096 2:22736729-22736751 CATTCAATAGAATTGAAATCAGG - Intergenic
927667636 2:25043090-25043112 CATTCATCAGAGCTGCAATGTGG - Intronic
929135122 2:38616512-38616534 CATCCAACAGATTTGGAACAAGG + Intergenic
933894762 2:86800730-86800752 CTTTCAACAAAATTGGAAGAAGG + Intronic
935027048 2:99286769-99286791 CATCCAAAAGAATTGGAATCAGG + Intronic
936829179 2:116620965-116620987 TATTCAAAGGAGTTGAAATAAGG + Intergenic
937336201 2:121063892-121063914 CATTCAACAGACTCGTAATGAGG + Intergenic
937495912 2:122418998-122419020 CATCCCACAGAGATGGAGTAAGG - Intergenic
938832397 2:135065465-135065487 CATTAAACAGATTTGCAAAAAGG + Intronic
940506731 2:154565005-154565027 CATTCAACAGAGGACCAATATGG - Intergenic
940742918 2:157532103-157532125 CATTTTACTGAGTTGAAATAAGG - Exonic
942018796 2:171845766-171845788 CAATCAGCAAAGTTGGAAGAAGG + Intronic
944151126 2:196560076-196560098 GATTCAACAGGGCTGGATTAGGG + Intronic
944676904 2:202041158-202041180 CTGTCAACATAGTTGGAGTAAGG + Intergenic
945348945 2:208753330-208753352 TATTCAAAAGAGTTAGAATCAGG - Intronic
945715746 2:213355891-213355913 AATTCAACATAGTTGGAAGTTGG - Intronic
947309967 2:228790867-228790889 CAGACAACAGAGTGGTAATATGG + Intergenic
947665660 2:231904023-231904045 AAAGCAACAGTGTTGGAATATGG - Intergenic
948763043 2:240204402-240204424 AATTGAACAGAGCTGGAACAGGG + Intergenic
1169600861 20:7259188-7259210 CATTCCAAAGACTTGGCATAAGG - Intergenic
1169968794 20:11246820-11246842 CTCTCAATAGAGTTGTAATATGG - Intergenic
1170275759 20:14584989-14585011 CTTTCAACAAAGTTGGTCTAAGG + Intronic
1173178687 20:40785295-40785317 CATCCAATAGAGATGGAATGTGG - Intergenic
1178967310 21:37133578-37133600 CATTCAACACAGTTTGATTGAGG + Intronic
1181943857 22:26499739-26499761 TATTCAACAGAGCTGGAGAAGGG + Intronic
1182485213 22:30635238-30635260 CATCCAGCAGAGCTGGATTACGG - Intergenic
1183663118 22:39233135-39233157 CATTTCACAGAGTTGGAAACTGG - Intronic
1184633105 22:45801699-45801721 CCTTCAGCAAAGTTTGAATATGG - Intronic
951710271 3:25579945-25579967 CATTCATCAGAGTTAGAAAATGG + Intronic
952535357 3:34303686-34303708 TATTCAACAGGATTGCAATAGGG + Intergenic
953801148 3:46023505-46023527 CATCCAAGAGAGATGGAAAAGGG + Intronic
955041657 3:55323279-55323301 CATTCAATAAATTTGCAATATGG + Intergenic
955773777 3:62412586-62412608 CATTTTACAGAGTTGGAATTTGG - Intronic
955803290 3:62707871-62707893 TATTGAACAGTGTTGGTATAAGG + Intronic
956596636 3:70974169-70974191 GATTCAAAAAAGTTGGAAGAAGG + Intronic
956804918 3:72800040-72800062 AATGCAACAGTGTTGGAAGATGG + Intronic
956945702 3:74220030-74220052 GATTCAACAGAGCTGGAGTGGGG - Intergenic
957031709 3:75249891-75249913 GATTCAACAGATTTGAGATAAGG - Intergenic
961476239 3:127147921-127147943 CATGCAACAGAGCTGGGAAAAGG + Intergenic
963623881 3:147646657-147646679 CATTTAACAGAGGTGGAAATCGG - Intergenic
964517116 3:157523389-157523411 TATTTAATAGAGTTGGAAAAGGG - Intronic
964776058 3:160278784-160278806 GATTCAACCAAGTTGGAAAAAGG + Intronic
967259929 3:187632069-187632091 AATTCAACAGAATTGGTTTAAGG - Intergenic
968673680 4:1865653-1865675 CATTCTACAGATTTGGAATTAGG - Intergenic
970027158 4:11635801-11635823 TATTTTACAGAGTTGGAATAGGG + Intergenic
972111877 4:35572735-35572757 TAGTCAACAGAGTTAGAATTTGG - Intergenic
974091927 4:57320574-57320596 CATTCAGCAGGGTTGGTGTATGG + Intergenic
975123087 4:70750399-70750421 CAATCAACAGACTTTGAAAATGG - Intronic
980305771 4:131059846-131059868 CATTCATCAGAGTTACAGTAAGG + Intergenic
981947396 4:150363772-150363794 CATTCAACAGACATGTATTAGGG - Intronic
985115982 4:186591295-186591317 CATTCAACAGTGTTATAATTTGG + Intronic
985325737 4:188767752-188767774 CATGCAACAGTGTTGGGAGATGG - Intergenic
986639116 5:9854508-9854530 CATCTATCAGAGTTGTAATAAGG + Intergenic
993447755 5:88035353-88035375 CAATCAACAGAGTAGGAAAAAGG + Intergenic
997420008 5:133759061-133759083 CATTCAACGGGATGGGAATAAGG + Intergenic
997708458 5:135981509-135981531 AATACAACAGTGTTGGGATATGG + Intergenic
997786655 5:136719606-136719628 AATTCAACCGATATGGAATAAGG - Intergenic
997834539 5:137181636-137181658 CATTAAACAGAGCTGGAAACAGG + Intronic
998909520 5:146943614-146943636 CATTCTAAAGAGTTGAAAGATGG - Intronic
999283737 5:150381732-150381754 CATTCAAAAGAGCTTAAATAAGG + Intronic
999347865 5:150840347-150840369 CAGTCAGCAGAGTTGGATTTGGG + Intergenic
999357628 5:150951527-150951549 AATACAACAGTGTTGGAAAAGGG - Intergenic
1001239872 5:170060435-170060457 AATTCAACAGAGATGGAGGAGGG - Intronic
1003470913 6:6431224-6431246 CATTCAATAAACTAGGAATAGGG + Intergenic
1004159803 6:13203575-13203597 CTTTCCACAGAGTGGGAAGAGGG + Intronic
1004421840 6:15477468-15477490 TATTCCAAAAAGTTGGAATATGG + Intronic
1006381920 6:33703851-33703873 CAATTGACAGAATTGGAATATGG - Intronic
1007892585 6:45309766-45309788 CATATAACAGAGTTCAAATAAGG + Intronic
1008277267 6:49556131-49556153 GATTCAACAGATCTGGAATGGGG - Intronic
1009888332 6:69651635-69651657 CAAACAACAGAACTGGAATAAGG + Intergenic
1009949882 6:70383216-70383238 CATTCATCAGTGTTGTAAGAAGG - Intergenic
1010545066 6:77143829-77143851 CATTCATCAGAGTTACATTAAGG - Intergenic
1016904328 6:149133875-149133897 CTTTCAACAGAGTTGGTCAAGGG - Intergenic
1017240427 6:152162222-152162244 CATGCCACAGAGTTCGAAGAAGG - Intronic
1018149553 6:160925576-160925598 CATGCAACAGTGTTGGGAGACGG - Intergenic
1018297048 6:162359363-162359385 CATTTTACAGAGGTGGAAAATGG + Intronic
1022156482 7:27665791-27665813 GTGTCAACAGAGGTGGAATAAGG + Intergenic
1023102358 7:36731799-36731821 CATTCAACAGAGCTCCAATATGG - Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1028829865 7:95315390-95315412 GATCCAACAGTGTTGGAATTGGG - Exonic
1030689499 7:112517832-112517854 ACTTCAACAGAGTTGGAGCATGG + Intergenic
1032980907 7:137281536-137281558 CATTCAAAAGTGCTGGAGTAAGG - Intronic
1034749340 7:153554216-153554238 CATACCAAAGGGTTGGAATAAGG + Intergenic
1035950302 8:4012688-4012710 CATTCTATGGAGTTGAAATAGGG - Intronic
1039337023 8:36602543-36602565 CATTAAAATGAGGTGGAATATGG - Intergenic
1039612158 8:38928568-38928590 CTGTCACCAGAGTTGGAAGACGG + Intronic
1042651895 8:71052318-71052340 CCTTCAACTGAGTTGGGGTAAGG + Intergenic
1042657535 8:71116269-71116291 CATTGAACAGAGTTGAAAGATGG - Intergenic
1043012506 8:74898821-74898843 CATTAAACTGAGTTTGAATCTGG - Intergenic
1044359788 8:91269497-91269519 CATTGAACAGAGTCTCAATATGG - Intronic
1045962401 8:107983325-107983347 CATCCAAGAGAGATGGAAAAGGG + Intronic
1046079639 8:109355681-109355703 CATTCAAAGGAATTGAAATAAGG + Intergenic
1048812015 8:138297154-138297176 AATGCCACAGAGTTGAAATATGG + Intronic
1048870679 8:138794529-138794551 TATTCAAAAGAGTTAGAATCAGG + Intronic
1049233422 8:141495968-141495990 CATTCAATGGTGTTTGAATAAGG + Intergenic
1049294606 8:141825262-141825284 TATTCAACATATTGGGAATAAGG - Intergenic
1051494407 9:17703108-17703130 GATTCAACAGAGATGAAATGTGG + Intronic
1055249618 9:74287278-74287300 CATTCAACAAATATGAAATATGG - Intergenic
1058078556 9:100676164-100676186 AAAACAACAGAGTTGGAAGAAGG + Intergenic
1058541770 9:106019223-106019245 CACTCAACAGGCTTGGAAAATGG + Intergenic
1059637667 9:116186763-116186785 CATCCAACAGCTTTGGAAAATGG + Intronic
1060355835 9:122906037-122906059 GATGAAACAGACTTGGAATAGGG + Intergenic
1061587356 9:131577614-131577636 CATTCAACAGAGCTGGGCAAGGG + Exonic
1188338945 X:28975330-28975352 CAATCTACAGAGTTGAAAGATGG - Intronic
1188751909 X:33914485-33914507 CATTCATCAGAGTTACAGTAAGG - Intergenic
1189080291 X:37963889-37963911 CACTCAACAAACTAGGAATAAGG - Intronic
1191856606 X:65632143-65632165 AATGCAACAGTGTTGGAATGTGG + Intronic
1192040641 X:67617518-67617540 AACTCAAGAGAGTTGGATTAGGG - Intronic
1192733826 X:73829391-73829413 CATTCAACAGAATAGGAAACTGG + Intergenic
1192829256 X:74733111-74733133 CATTCAGCAGAATTGGTGTAGGG + Exonic
1196018758 X:110967183-110967205 CATTCTACAGACTTGCCATAGGG + Intronic
1196926917 X:120642452-120642474 AATTCACTAGAGTTGCAATATGG + Intergenic
1198111025 X:133502707-133502729 CATGCAAGAGAGTCGGAATGGGG - Intergenic
1198762920 X:140052609-140052631 TATGCAACAGAGATGGTATACGG - Intergenic