ID: 1103670815

View in Genome Browser
Species Human (GRCh38)
Location 12:122613793-122613815
Sequence CAGGATTCTGAGTAGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 248}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103670815_1103670823 21 Left 1103670815 12:122613793-122613815 CCCTGCCCCTACTCAGAATCCTG 0: 1
1: 0
2: 0
3: 26
4: 248
Right 1103670823 12:122613837-122613859 CTTTTTGTTGTTGTTGTTGTTGG 0: 19
1: 151
2: 607
3: 1271
4: 3012
1103670815_1103670824 22 Left 1103670815 12:122613793-122613815 CCCTGCCCCTACTCAGAATCCTG 0: 1
1: 0
2: 0
3: 26
4: 248
Right 1103670824 12:122613838-122613860 TTTTTGTTGTTGTTGTTGTTGGG 0: 80
1: 352
2: 692
3: 1459
4: 4312
1103670815_1103670825 23 Left 1103670815 12:122613793-122613815 CCCTGCCCCTACTCAGAATCCTG 0: 1
1: 0
2: 0
3: 26
4: 248
Right 1103670825 12:122613839-122613861 TTTTGTTGTTGTTGTTGTTGGGG 0: 44
1: 310
2: 711
3: 1797
4: 4797
1103670815_1103670820 -8 Left 1103670815 12:122613793-122613815 CCCTGCCCCTACTCAGAATCCTG 0: 1
1: 0
2: 0
3: 26
4: 248
Right 1103670820 12:122613808-122613830 GAATCCTGAAAGAGAAAACCAGG 0: 1
1: 0
2: 3
3: 30
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103670815 Original CRISPR CAGGATTCTGAGTAGGGGCA GGG (reversed) Intronic
900386920 1:2414807-2414829 CAGGGTTCTGGGGTGGGGCATGG + Intergenic
900766633 1:4510235-4510257 CAGGCTTCTTTGTAGGGCCAGGG + Intergenic
900935499 1:5764030-5764052 CACGATTCAGAGCAGGGGGAAGG - Intergenic
901149147 1:7088745-7088767 CATGGTCCTGAGCAGGGGCATGG + Intronic
903059135 1:20657311-20657333 GACGATTCTGAGCAGGGGCCTGG + Intronic
903605229 1:24570677-24570699 GAGGGTTCTGAGCAGGGGCCTGG - Intronic
903895458 1:26600463-26600485 AAGGATTCTGAGCTGGGGAATGG + Intergenic
904384851 1:30134581-30134603 CAGGATTCAGGGCAGGAGCAGGG - Intergenic
905666082 1:39763954-39763976 CAGGCTTCTGAGCTGGGTCATGG - Intronic
909027734 1:70502400-70502422 CTGGATTCAGAGTAGGGCAAAGG - Intergenic
911182727 1:94875502-94875524 CAGGAGGCTCAGAAGGGGCAAGG - Intronic
915553817 1:156650237-156650259 CTGGATCATGAGGAGGGGCAGGG + Intronic
916830299 1:168484120-168484142 CAGCATTATGAGTATTGGCAAGG - Intergenic
917449874 1:175138541-175138563 CAGGATTCTGAGTAGGAGTTGGG + Intronic
919581126 1:199374387-199374409 CAGTATTCTTAGTAGAGACAGGG - Intergenic
920836241 1:209513695-209513717 CAGGATGTGGAATAGGGGCACGG - Intergenic
921124416 1:212164335-212164357 CAGGATCCAGAGTAGGGTGATGG + Intergenic
922007731 1:221549208-221549230 CAGGATTCAGCCTAGAGGCAGGG - Intergenic
924701807 1:246462143-246462165 TAGCATTGTGAGTACGGGCATGG + Intronic
1063915110 10:10873780-10873802 GAGGATTCAGAGAAGGGACAGGG - Intergenic
1067466065 10:46500126-46500148 CTGGATTATGAGAAGGAGCAGGG + Intergenic
1067585810 10:47475386-47475408 CAAGAGTCAGGGTAGGGGCATGG - Intronic
1067621123 10:47884480-47884502 CTGGATTATGAGAAGGAGCAGGG - Intergenic
1068920946 10:62483262-62483284 CAGGAATCTGACTACGGGAAAGG + Intronic
1069631670 10:69901021-69901043 CAGGATTCTGAGGAGGTTCCGGG + Intronic
1069696211 10:70387367-70387389 CAGGATGATGTGTCGGGGCAGGG - Intergenic
1069930375 10:71877779-71877801 CTGGATTGTGAGGATGGGCAGGG - Intergenic
1070322253 10:75363037-75363059 CAGGAGTCTGTGTGTGGGCATGG + Intergenic
1073443732 10:103568458-103568480 GTGGATTCTGAGTAGAGGCTGGG + Intronic
1074870873 10:117575105-117575127 CAGACTGCAGAGTAGGGGCAGGG - Intergenic
1075579002 10:123602740-123602762 CAGGATGCTAAGGTGGGGCAAGG + Intergenic
1077065238 11:638130-638152 CAGGGTTCTCAGCAGGGGCCTGG - Intronic
1077112706 11:868969-868991 CAGGATGGTGACGAGGGGCAGGG + Exonic
1077483333 11:2826738-2826760 TGGGATTCTGAGTGGAGGCAGGG - Intronic
1078090986 11:8264531-8264553 CAGGATTCTGGGGAGAAGCAGGG - Intronic
1078559325 11:12356914-12356936 CAGAATTCTGAACAAGGGCAGGG + Intronic
1079133874 11:17765078-17765100 GAGGATTCTGAGGCAGGGCAGGG - Intronic
1079996726 11:27303506-27303528 CAGAAGTGTGGGTAGGGGCAGGG - Intergenic
1080032261 11:27674218-27674240 CAGCATTCTGAGTAGTAACAAGG + Exonic
1080861634 11:36155009-36155031 CAGAATTCAAAGTAAGGGCAAGG - Intronic
1081192500 11:40120655-40120677 TAGGATTCTGAGAAGGGCTATGG - Intronic
1082133927 11:48526099-48526121 CAGGATCCTGAGTAAGGCCTAGG - Intergenic
1082299567 11:50489917-50489939 CAGGACTGTGAGTATGGGAAGGG - Intergenic
1082566943 11:54692486-54692508 CAGGATCCTGAGTAAGGCCTAGG - Intergenic
1083295534 11:61713511-61713533 CAGGATCCTGGGTAGTGACAGGG - Intronic
1083418135 11:62538406-62538428 CAGGACTCTGCATAGGGCCACGG + Intronic
1084106285 11:66982977-66982999 CAGGATTCTGGGAAGGTGAAGGG - Intergenic
1084439050 11:69160476-69160498 CAGGATTCTGAGGCCGGGCATGG - Intergenic
1084595495 11:70114411-70114433 CAGTATTCTGGGTAAGGACATGG - Intronic
1085483482 11:76842076-76842098 CAGGACTCTGAGCAGGGCCCTGG - Intergenic
1085640718 11:78191007-78191029 GAGAGTTCTGAGCAGGGGCATGG + Intronic
1087158694 11:94928474-94928496 CAGGAAACTGAATAGGGCCAGGG - Intergenic
1087403357 11:97696526-97696548 GAGGATTCTGAGAAGGAACAGGG - Intergenic
1087762831 11:102120590-102120612 CAGGATTCTCAGTTGGGGGTGGG + Intronic
1088863228 11:113821557-113821579 CAGCATTCTTTGAAGGGGCAGGG + Intronic
1089009281 11:115119524-115119546 CAGGAATCAGGGTAGGGGCCTGG - Intergenic
1089226768 11:116930742-116930764 CAGGACTCTAGCTAGGGGCATGG - Intronic
1089621103 11:119722672-119722694 CAGGCTCCCGAGTGGGGGCAGGG + Intronic
1090669661 11:128937435-128937457 CAGGATTCCGAGGAGGAGGAGGG + Intronic
1091689535 12:2586283-2586305 CTGCCTCCTGAGTAGGGGCAAGG - Intronic
1091936581 12:4439746-4439768 CAGGATTCTGGGGAAGGCCAGGG - Intronic
1094033701 12:26043464-26043486 GAGGATTCTGACCAGGGGAATGG + Intronic
1097146097 12:56940277-56940299 AAGGTTTCTGAGTAGGGGAAGGG - Intergenic
1097151814 12:56984754-56984776 AAGGTTTCTGAGTAGGGGAAGGG - Intergenic
1099084343 12:78226590-78226612 CAGGAATCTGAGAAGTGGCTTGG - Intergenic
1102034389 12:109762518-109762540 CAGGCTTCTCAGCAGTGGCAAGG - Intronic
1103284998 12:119793483-119793505 CAGGATTTTGAATAGGGTCATGG - Intronic
1103670815 12:122613793-122613815 CAGGATTCTGAGTAGGGGCAGGG - Intronic
1104033106 12:125079264-125079286 CAGGGTTCTGAGCAAGGGCTGGG + Intronic
1104160522 12:126175552-126175574 CAGGATTCTCAGTGTTGGCATGG - Intergenic
1104800681 12:131553630-131553652 CTGCATTTTGAGTAGGGGCTGGG - Intergenic
1105452887 13:20516312-20516334 GATGATTCTGAGTGGGGACAAGG + Intronic
1105758635 13:23493062-23493084 CAGGATTCTGAGGCTGGGCGCGG - Intergenic
1108618898 13:52161821-52161843 CAGCATTCTGAGTACAGGCATGG - Intergenic
1109309536 13:60676283-60676305 CAGGACCCTGTGTAGGGTCAAGG - Intergenic
1110432717 13:75443749-75443771 TGTGATTCTGAGTAGGGACAGGG - Intronic
1116791704 14:49346403-49346425 AAGTATTCTTAGTAGAGGCAGGG - Intergenic
1117231894 14:53728260-53728282 CAGGATTCTGAGCAAAGGAAGGG - Intergenic
1121702302 14:95963697-95963719 CAGTAGTCTGGGTAGGGTCAGGG + Intergenic
1123481989 15:20640691-20640713 GAGCATTCTGAGTCAGGGCAAGG - Intergenic
1123636023 15:22359674-22359696 GAGCATTCTGAGTCAGGGCAAGG + Intergenic
1128745614 15:70111983-70112005 AATGATTCTGAGCAGGGGAATGG - Intergenic
1129599449 15:76989769-76989791 CAGCCTTCTGAAGAGGGGCAGGG - Intergenic
1132675495 16:1119682-1119704 CAGGATTCTGAGTGGGGATTGGG - Intergenic
1132692602 16:1188330-1188352 CAGGGTCCTGGGTAGGGACAGGG - Intronic
1132769950 16:1556300-1556322 CTGGGTTCTGGGTGGGGGCATGG - Intronic
1132973614 16:2700933-2700955 CACGATTCTGATGAGGTGCAGGG - Intronic
1133286058 16:4691400-4691422 CAGGATTCTGATTAGCTGCTGGG - Intergenic
1133367656 16:5223724-5223746 CAGGATTCTGATGAGGAGGAAGG + Intergenic
1133395324 16:5442455-5442477 CAGGGTGCTGAGTGGAGGCAGGG + Intergenic
1134174405 16:11994189-11994211 GAGGATTCTGAGTAGAGTTAGGG + Intronic
1134327940 16:13224198-13224220 CAGAAGTCTGAGTAGAGACAGGG - Intronic
1134609447 16:15596802-15596824 GAGGTTTCCGAGGAGGGGCAGGG + Exonic
1137531293 16:49280531-49280553 CAGGCTTCTGAGCCGGGGCAAGG + Intronic
1137568511 16:49549407-49549429 CATGATTCTGCTTAGGGGCATGG + Intronic
1138865818 16:60818094-60818116 CAGGATTTGGAGTAGGGCAAGGG + Intergenic
1139319636 16:66103624-66103646 CAGGACTCTGAGTAAAGGAATGG + Intergenic
1141677537 16:85525423-85525445 CAGGATGCTGAGAAGGAGCGAGG + Intergenic
1141991189 16:87611275-87611297 CAGGGACCTGAGGAGGGGCAGGG + Intronic
1142809929 17:2390965-2390987 CAGGTGTGTGTGTAGGGGCAAGG - Intronic
1144782388 17:17814603-17814625 CAGGAGTCTGAGTGAGTGCACGG - Exonic
1145959706 17:28880199-28880221 CAGGATTCTGAGGAGCAGCAGGG + Exonic
1146040106 17:29444335-29444357 CAATATTCTGAATAGGTGCAGGG + Intronic
1147311882 17:39600306-39600328 CAGGATTCAGAACCGGGGCAGGG + Intergenic
1147318619 17:39632922-39632944 CAAGATGCTGAGGAGGGGCTGGG - Intronic
1147606437 17:41776259-41776281 CAGGATTCTGAGTGAGGAGAGGG + Intronic
1147661892 17:42121214-42121236 CAGGAGTCGGAGTTGGGGCAGGG + Exonic
1148458593 17:47824543-47824565 CAGGATTTTGAGAAGGGCAATGG - Intronic
1148739087 17:49881745-49881767 CAGGATTTAGAGAAGGGGCTTGG - Intergenic
1150872686 17:68931010-68931032 CAGGATGGTGAATAGGGGCTGGG - Intronic
1151321759 17:73356742-73356764 CAGGACTCGGAGCAGGGCCAGGG - Intronic
1152430575 17:80246359-80246381 CAGGAGACTGAGCAGGGGCTGGG + Intronic
1157678638 18:49586615-49586637 AAGGCTTTTGAGTCGGGGCATGG + Intronic
1158537052 18:58317687-58317709 TTGGATTCTGAGTGGAGGCAGGG + Intronic
1159023108 18:63158994-63159016 CTGGAGTCTGACTAGAGGCAGGG + Intronic
1161115749 19:2495593-2495615 CAGGATTTTGGGGAGGGGCAGGG + Intergenic
1161357786 19:3828661-3828683 CAGGATTCTGCCTAAGGGCTTGG - Intronic
1162332020 19:10035972-10035994 CAGTATGCTAAGTAGGGGCCAGG + Intergenic
1163518443 19:17778710-17778732 CAGGAATCTGGGGAGGGGCCAGG - Exonic
1164908137 19:31984287-31984309 CAGGATTCAAACTAGGGGCTGGG - Intergenic
1165310814 19:35028510-35028532 CATGACTCTGGGCAGGGGCACGG + Intergenic
1165544490 19:36523079-36523101 CAAGAGTTTGAATAGGGGCAGGG - Intronic
1165549580 19:36573027-36573049 CAGGACGGTGAGTAGGGGCGGGG - Intronic
1166109239 19:40612589-40612611 AGGGATTCTGAGAAGAGGCAGGG - Intronic
1167523448 19:49970318-49970340 CAGGCTTCTGAGTCAGGGCTGGG - Intergenic
1167600831 19:50453931-50453953 GAGGATTCTGAGCAGGGGAATGG + Intronic
1167756621 19:51416933-51416955 CAGGCTTCTGAGTCAGGGCTGGG + Exonic
1167776806 19:51563936-51563958 CTGGATTCTGGGCAGGGGAAGGG - Intergenic
925428380 2:3770002-3770024 CAGGGTTCTGAGAAGGGGCGGGG + Intronic
926841976 2:17090754-17090776 CAGGATTCAGAGCAGTGGGAGGG - Intergenic
929589156 2:43134013-43134035 CAGGTTTCTGAGCAGGGGACCGG + Intergenic
931538404 2:63303001-63303023 CAGTTTTCTGAGTGGGGTCAGGG + Intronic
934634416 2:95970150-95970172 CAGGATACAGAGCAGGGTCAAGG + Intronic
934799215 2:97135089-97135111 CAGGATACAGAGCAGGGTCAAGG - Intronic
934834225 2:97568378-97568400 CAGGATACAGAGTAGGGTCAAGG + Intronic
934927579 2:98392150-98392172 CAGGACGCTGAGCAGGGGCCAGG + Intronic
936607500 2:113972957-113972979 CAGTATTATGAGTGGGAGCAGGG + Intergenic
938106442 2:128534119-128534141 CAGCATTCTGAGTAGCGCCCAGG - Intergenic
938193867 2:129308886-129308908 CAGCTTCCTGAGAAGGGGCAGGG + Intergenic
939020087 2:136948239-136948261 AAGGTTTGTGAGCAGGGGCATGG - Intronic
940011402 2:149059133-149059155 CAGGATTCTGAGTGAGGGTTGGG + Intronic
941347811 2:164391592-164391614 CAGGATTCTGACCAGGGTCAGGG - Intergenic
941468268 2:165855485-165855507 CTTGATTTTGAATAGGGGCATGG - Intergenic
941784390 2:169481770-169481792 AAGGTTTCTGAGTAGAGGAAAGG - Intronic
942037233 2:172022173-172022195 CAGGAGTCTGCATGGGGGCAGGG - Intronic
944066165 2:195621469-195621491 CTGAATTCAGCGTAGGGGCAAGG + Intronic
944122133 2:196251650-196251672 CAGGACTTTGAGTAGAGGTAGGG - Intronic
944985232 2:205168696-205168718 CAGGAAACTGTGCAGGGGCATGG - Intronic
948197144 2:236104477-236104499 AAGGAATCTGAGAAGGGACAAGG - Intronic
948509853 2:238456804-238456826 CAGGATGCTGAGCAAGGGCAAGG + Intergenic
948667569 2:239546007-239546029 CAGAATTCAGGGCAGGGGCATGG - Intergenic
1170601269 20:17843348-17843370 CTGGATTCTGTCTGGGGGCAGGG - Intergenic
1170907384 20:20528393-20528415 CAGGAGGCTGAGTATTGGCAGGG + Intronic
1171196635 20:23205075-23205097 CTGGATTCCTAGGAGGGGCAGGG - Intergenic
1174180316 20:48670304-48670326 CAGGGTTCTCAGCAGGGGCAGGG - Intronic
1175171395 20:57084008-57084030 CAGGCTTCTGGGTTAGGGCATGG - Intergenic
1176430672 21:6573635-6573657 CTGGGTTCTGGGTGGGGGCACGG + Intergenic
1178348346 21:31851257-31851279 GAGGATTCTGAATAAGAGCATGG - Intergenic
1178661974 21:34514494-34514516 CAGGATTCTGATGAGGGACTCGG - Intronic
1178904878 21:36628451-36628473 CAGGATGCTGGGTAGGGGGCTGG - Intergenic
1179023467 21:37659637-37659659 CAGGAGTCTGAGTGGGTACAGGG + Intronic
1179706066 21:43181097-43181119 CTGGGTTCTGGGTGGGGGCACGG + Intergenic
1180875655 22:19174117-19174139 CATGATTCTGAGCACCGGCAGGG + Intergenic
1181054327 22:20252935-20252957 CAGGATGCTGGGTGGGGGCCTGG - Intronic
1181414040 22:22746562-22746584 CAGGACACTGAGCAGGGGCCTGG + Intronic
1181687112 22:24537007-24537029 AAGGAGTCTGAGAAGGTGCAGGG + Intergenic
1182142932 22:27978232-27978254 AAGGTGTCTGAGGAGGGGCAGGG + Exonic
1183523664 22:38310987-38311009 CAGGATGGTGAGTCAGGGCAGGG + Intronic
1184477331 22:44728827-44728849 CTGGAGGCTGAGAAGGGGCAGGG - Intronic
1184834138 22:47011075-47011097 CAGGACTCTGAGTACGGGGATGG - Intronic
1185001847 22:48251019-48251041 CAGGAGCCTAAGCAGGGGCAGGG - Intergenic
1185098510 22:48825067-48825089 CAGGGTTCTCAGGTGGGGCAGGG + Intronic
949822003 3:8125785-8125807 CAGAATGTTGGGTAGGGGCAGGG - Intergenic
951366305 3:21787451-21787473 CTGGATAAGGAGTAGGGGCACGG - Intronic
951916805 3:27809516-27809538 CAGGATACTGTGTAGGGGAAGGG + Intergenic
953368831 3:42370148-42370170 TAAGATTCTGAGTAGAGGAAGGG + Intergenic
955756495 3:62229896-62229918 CAGAATTCAGAGTAGGGCTAAGG + Intronic
956120592 3:65962222-65962244 CAGGAGGCTGAGTAGGAGAATGG - Intronic
956131244 3:66055737-66055759 CATGATACTGAGTTGGGGCAGGG + Intergenic
956319692 3:67983259-67983281 CAGGATTCTGAGTTGGTGTGAGG + Intergenic
956329735 3:68093071-68093093 CAGGATTTTGAGGAAGGACAGGG - Intronic
960485609 3:118249397-118249419 TAAGAGTCTGACTAGGGGCAAGG + Intergenic
961837381 3:129674299-129674321 GATGATTCTGAGTAGGAGCCAGG - Intronic
963744808 3:149115485-149115507 CAGGAGGCTGGGGAGGGGCATGG - Intergenic
966494848 3:180568338-180568360 GAAGATTTTGAGTAGGGGGAGGG - Intergenic
966583991 3:181601332-181601354 CAAGATTCTGGGCAGTGGCAGGG + Intergenic
967010740 3:185431028-185431050 CAGGAGACAGAGAAGGGGCAAGG + Intronic
967685041 3:192408973-192408995 CCGGAGTCTGGGTAGGGGCGCGG + Exonic
967812767 3:193774532-193774554 GAGCATTTTGAGTAGGGCCAAGG - Intergenic
970075228 4:12210803-12210825 CTGGAGTCAGAGTCGGGGCAGGG + Intergenic
970369551 4:15393472-15393494 GATGATTCTGAGAAAGGGCAGGG - Intronic
970607066 4:17690871-17690893 CAGGATTGTGACTAGGGGTGAGG + Intronic
979029441 4:115622125-115622147 CAGCATGCTGACTAAGGGCATGG + Intergenic
979786992 4:124728171-124728193 AAGCATTCTGTGTAGGGACAAGG + Intergenic
980636903 4:135518064-135518086 CAGGAGGCTGAGTTGGGGAACGG - Intergenic
981788764 4:148511305-148511327 CAGACTTCTGGGTAGGAGCAAGG - Intergenic
983550799 4:169015514-169015536 TAGGAGTCTGAGTAGCCGCAGGG - Intergenic
985969771 5:3365852-3365874 CAGGATGCTGAGGAGGTGCTTGG - Intergenic
986079646 5:4376655-4376677 CAAGATTCAGCGTAGGGGAAAGG + Intergenic
986320267 5:6625780-6625802 GAGGATTGTGAATAGGAGCAGGG - Intronic
987037493 5:14032750-14032772 CAGGATTATGAGTGTGGTCAAGG - Intergenic
988129566 5:27085457-27085479 AATGTTTATGAGTAGGGGCATGG + Intronic
991941578 5:71858120-71858142 CAGGATGTGGAGCAGGGGCAGGG - Intergenic
993965787 5:94358943-94358965 CATGATTCTTAGTATAGGCATGG - Intronic
997212244 5:132083865-132083887 GAGGATACTGATTAGGAGCAGGG - Intergenic
997368723 5:133342321-133342343 CAGGTTGCAGAGAAGGGGCAGGG + Intronic
997531046 5:134581503-134581525 CAGGATGGTGTGAAGGGGCAAGG - Exonic
998165160 5:139838559-139838581 CGGGATGCTGAGTAGGGGACAGG + Intronic
998374093 5:141680144-141680166 CAGGTCTCTGAGTGGTGGCAGGG + Exonic
1002044182 5:176532870-176532892 CAGGGCTCGGAGGAGGGGCACGG - Intronic
1005176254 6:23047951-23047973 AAGGATTCTGAATAGCTGCAGGG - Intergenic
1005298480 6:24449016-24449038 CAGGATGCTAAGTGGGGACAAGG + Intronic
1006537232 6:34709566-34709588 CAGGCATCTGGGTAGGGGCGAGG + Intergenic
1007717910 6:43867928-43867950 CAGGAGTGTGAGCAGGGTCAAGG + Intergenic
1008788425 6:55198444-55198466 CAGGATTTTGTGTAGGGTGAGGG - Intronic
1013547690 6:111175166-111175188 AAGGATTCAGAGAAGGGACATGG - Intronic
1014547062 6:122746600-122746622 CAGGATTACAATTAGGGGCAAGG - Intergenic
1016330329 6:142946851-142946873 CATAATTGTGAGTAGAGGCAGGG - Intergenic
1017570775 6:155742143-155742165 GAGGAGTCTGAGGAGGAGCAAGG - Intergenic
1018899288 6:168043235-168043257 CTGGAGTCTGAGTCGGGGGAGGG - Intronic
1022559652 7:31335742-31335764 CAAGATTCTGAGCAGGTGCGAGG + Intergenic
1023012526 7:35936867-35936889 CGGGGTTCTGAGAAGGGGCGAGG + Intergenic
1023940604 7:44766438-44766460 CAGGATTGTGAGTGGGGTCCAGG - Exonic
1024520373 7:50300577-50300599 CAGGATGCAGAGGAGAGGCAGGG - Intergenic
1026521312 7:71120563-71120585 CAGGATTCTTCTTAGGGGCAGGG + Intergenic
1026639058 7:72108626-72108648 CAGGAGTCTGCCTAAGGGCAGGG - Intronic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1029032752 7:97486093-97486115 CAGAATTCTGAGTCAGTGCAGGG + Intergenic
1031997524 7:128242359-128242381 TAGGATTCTGAGGTGGGCCATGG + Intronic
1033266966 7:139895072-139895094 CAGGATTCTGGGTAGAATCATGG + Intronic
1033669508 7:143477800-143477822 CAGGACTGTGGCTAGGGGCAGGG + Intergenic
1034424457 7:151007287-151007309 CAGGAGTCAGAGCAGGGGCTGGG - Intronic
1034642609 7:152616372-152616394 CAGAATTCTGAACAGGGGCCGGG + Intergenic
1034984182 7:155497227-155497249 CAGAATCCTGAGAAGGGGCTGGG - Intronic
1035239331 7:157519791-157519813 CAGGATCCTGAGGTGGGGGACGG + Intergenic
1038323602 8:26552633-26552655 CAGAGTTCTGAGGAGGTGCAGGG + Intronic
1039760879 8:40573752-40573774 CAGGATCATGAGCAAGGGCATGG + Intronic
1042036412 8:64539067-64539089 CAGCATTCTGTCTAGGGGCAAGG - Intergenic
1042127956 8:65557981-65558003 TAGCATTCTGAGTATGGGCTAGG - Intergenic
1042552721 8:70008508-70008530 AAGGATTTTAAGGAGGGGCAGGG + Intergenic
1044531918 8:93316828-93316850 CAGGATTCTGTGAAGGGGTAAGG + Intergenic
1044625276 8:94230579-94230601 CAGCACACTGGGTAGGGGCAGGG - Intergenic
1045327651 8:101128453-101128475 CAGTATTCTGAGTTGGCGTAGGG + Intergenic
1047790687 8:128200492-128200514 CAGCATTCTGAGCAGCGTCAGGG - Intergenic
1048481284 8:134796081-134796103 CAAGATACTGAGAAGGGTCACGG - Intergenic
1049195840 8:141315229-141315251 CAGGATGGGGAGGAGGGGCAGGG + Intergenic
1049296870 8:141845448-141845470 CAGGATTCTCTGTAGAGGGAGGG - Intergenic
1051532967 9:18125875-18125897 CAGTATGCTGAGAAAGGGCAGGG + Intergenic
1055249108 9:74281053-74281075 GAGAATTCTGAATGGGGGCAGGG + Intergenic
1055771614 9:79722697-79722719 TAGAATTCTGAAGAGGGGCATGG - Intronic
1056953686 9:91065801-91065823 AGGAGTTCTGAGTAGGGGCAAGG + Intergenic
1060005882 9:119998925-119998947 CAGCATTCTGAGCACGGGCATGG - Intergenic
1060215145 9:121734435-121734457 CAGACTTCTGAGCAGGGGCTAGG + Intronic
1060273242 9:122162814-122162836 GAGGATTGTGGGCAGGGGCAAGG + Intronic
1060819334 9:126652277-126652299 CAGGAGTCTGAGGAGGAGAAGGG + Intronic
1061683858 9:132259124-132259146 CAGGGGTCTGAAGAGGGGCAGGG + Intergenic
1062113294 9:134794364-134794386 CAGGAAGCTGAGTTGGGACACGG + Intronic
1062433898 9:136537918-136537940 TTGTATTCTTAGTAGGGGCAGGG - Intronic
1185774829 X:2793992-2794014 GAGGATTCTGAGCAGGGGATGGG + Intronic
1186156645 X:6733043-6733065 CAGGGTGATGAGAAGGGGCATGG + Intergenic
1186828611 X:13366954-13366976 CTTGATTCTGAGTATTGGCAAGG - Intergenic
1187134875 X:16538347-16538369 CAGGTGTCTGAATAGGGGCAAGG - Intergenic
1188358518 X:29223038-29223060 CAGGTGTCTGAGTAGAGACAAGG - Intronic
1189200896 X:39195019-39195041 CAGGATTGTGAGGAGGGGAGGGG - Intergenic
1190261584 X:48801179-48801201 AAGGAGTCTTAGTGGGGGCAGGG - Intergenic
1190426708 X:50340007-50340029 CAGGTTTCTGAGTAGATCCAAGG + Intronic
1191035381 X:56020552-56020574 CAGGATTCTGATTTGGGCAATGG + Intergenic
1192511045 X:71720584-71720606 CGGGATTGTGGGAAGGGGCACGG - Intergenic
1192515652 X:71760969-71760991 CGGGATTGTGGGAAGGGGCACGG + Intergenic
1192528860 X:71869723-71869745 CGGGATTGTGGGAAGGGGCATGG + Intergenic
1196173052 X:112611000-112611022 AGGGATTCTCAGCAGGGGCAGGG + Intergenic
1197016837 X:121635227-121635249 TAGCAGTCAGAGTAGGGGCATGG + Intergenic
1197178904 X:123513102-123513124 CAGTATTTGGAGTAGGGGCAAGG - Intergenic
1199817414 X:151411212-151411234 GAGGATTTTGAGCAGAGGCATGG - Intergenic
1200073325 X:153539467-153539489 GGGGCTTCTGAGGAGGGGCAGGG - Intronic