ID: 1103676683

View in Genome Browser
Species Human (GRCh38)
Location 12:122661352-122661374
Sequence GGGCAGTCCCAGCAACCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103676683_1103676690 16 Left 1103676683 12:122661352-122661374 CCCTGAGGTTGCTGGGACTGCCC No data
Right 1103676690 12:122661391-122661413 CTAGAGCGTTGTGATCCCCACGG No data
1103676683_1103676692 26 Left 1103676683 12:122661352-122661374 CCCTGAGGTTGCTGGGACTGCCC No data
Right 1103676692 12:122661401-122661423 GTGATCCCCACGGGCAGAGCAGG No data
1103676683_1103676691 17 Left 1103676683 12:122661352-122661374 CCCTGAGGTTGCTGGGACTGCCC No data
Right 1103676691 12:122661392-122661414 TAGAGCGTTGTGATCCCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103676683 Original CRISPR GGGCAGTCCCAGCAACCTCA GGG (reversed) Intergenic
No off target data available for this crispr