ID: 1103680663

View in Genome Browser
Species Human (GRCh38)
Location 12:122690966-122690988
Sequence AATAACAAGCAGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103680663_1103680665 27 Left 1103680663 12:122690966-122690988 CCTTCCTCTTTCTGCTTGTTATT No data
Right 1103680665 12:122691016-122691038 TTCAAGTACTTGCATCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103680663 Original CRISPR AATAACAAGCAGAAAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr