ID: 1103687093

View in Genome Browser
Species Human (GRCh38)
Location 12:122740759-122740781
Sequence AGGGCTAACTGCTCTTTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103687084_1103687093 18 Left 1103687084 12:122740718-122740740 CCACCTTACAGGGAGCCCTGGAG No data
Right 1103687093 12:122740759-122740781 AGGGCTAACTGCTCTTTTGTAGG No data
1103687087_1103687093 2 Left 1103687087 12:122740734-122740756 CCTGGAGACGCTCTTCCTTCCTC No data
Right 1103687093 12:122740759-122740781 AGGGCTAACTGCTCTTTTGTAGG No data
1103687085_1103687093 15 Left 1103687085 12:122740721-122740743 CCTTACAGGGAGCCCTGGAGACG No data
Right 1103687093 12:122740759-122740781 AGGGCTAACTGCTCTTTTGTAGG No data
1103687086_1103687093 3 Left 1103687086 12:122740733-122740755 CCCTGGAGACGCTCTTCCTTCCT No data
Right 1103687093 12:122740759-122740781 AGGGCTAACTGCTCTTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103687093 Original CRISPR AGGGCTAACTGCTCTTTTGT AGG Intergenic
No off target data available for this crispr