ID: 1103688722

View in Genome Browser
Species Human (GRCh38)
Location 12:122753072-122753094
Sequence CAACCCCGGGGACGCCAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103688722_1103688727 -3 Left 1103688722 12:122753072-122753094 CCCTTCTGGCGTCCCCGGGGTTG 0: 1
1: 0
2: 0
3: 2
4: 70
Right 1103688727 12:122753092-122753114 TTGCTCCTTCGCCTCAGACCTGG 0: 1
1: 0
2: 1
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103688722 Original CRISPR CAACCCCGGGGACGCCAGAA GGG (reversed) Intronic
900409052 1:2504656-2504678 CAGCCCCAGGGAGGCCGGAAGGG - Exonic
900787136 1:4655945-4655967 CAGCCCCGGGGCCCCGAGAAAGG - Intronic
901691110 1:10973933-10973955 CACCCTCGGGGACCCCAGGAAGG + Intronic
902455337 1:16529869-16529891 CACCGCAGGGGACACCAGAAGGG - Intergenic
913141934 1:115949926-115949948 CAGCCCCGGAGATGCCAAAAAGG - Intergenic
915024049 1:152811007-152811029 TAACACCGGGGAGGCAAGAAGGG + Intronic
915597796 1:156905306-156905328 CAACCCTGCGGAGGCCAGGAAGG - Exonic
916059010 1:161086360-161086382 CAAACCCAGGGAAGCCAGCAAGG - Intronic
917312458 1:173691308-173691330 CACCCCTGAGGCCGCCAGAAGGG + Intergenic
922470965 1:225876967-225876989 AAACCCCAGGGATGCCAGAGGGG + Intronic
923219654 1:231881561-231881583 TAACCCCTGGGACCTCAGAATGG - Intronic
1064817134 10:19278600-19278622 TAACCCCAGGGAAGCAAGAATGG - Intronic
1077056604 11:597069-597091 TAACCCCGGGGACCGCAGAGTGG - Intronic
1080776186 11:35388928-35388950 AAACACCGGGGACTCCAAAAGGG + Intronic
1080780765 11:35427835-35427857 AAACACCGGGGACTCCAAAAGGG - Intergenic
1090923632 11:131230598-131230620 GAACCCTGGGGACTTCAGAAAGG + Intergenic
1103688722 12:122753072-122753094 CAACCCCGGGGACGCCAGAAGGG - Intronic
1118329570 14:64804909-64804931 CAGCCCCGGGGCCCACAGAAGGG + Intronic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1122985887 14:105211447-105211469 CAGCCCCCAGGAGGCCAGAAGGG - Intronic
1124803509 15:32858377-32858399 CAACCCTGGGGACTACAAAACGG + Intronic
1129167216 15:73785441-73785463 CAACGCCGGGGAGGACAGACTGG - Intergenic
1129784968 15:78304052-78304074 CACCCTCGTGGACCCCAGAAAGG + Intergenic
1130898846 15:88192044-88192066 CCACCCCTGGGACCACAGAAAGG + Intronic
1131431480 15:92392620-92392642 CATCCCCGGGGGCGCCATGAAGG + Intergenic
1140407001 16:74717779-74717801 CAGCCCCTGGGGCCCCAGAATGG + Intronic
1144638549 17:16925581-16925603 CGACCCCGGGGTGGCCAAAAAGG - Intergenic
1146176221 17:30667930-30667952 CAACCCGAGGGGCGCAAGAAGGG - Intergenic
1146267091 17:31459879-31459901 CAAGCCCTGGGACCCCAGGAGGG - Intronic
1146349677 17:32084041-32084063 CAACCCGAGGGGCGCAAGAAGGG - Intergenic
1152336904 17:79703800-79703822 CAAGCCCGGGAAGGCCAGACGGG + Intergenic
1153481795 18:5554612-5554634 CAACCCTGGTGACACCAGTAGGG + Intronic
1155746576 18:29362047-29362069 CACCCCCGAGGCCGCCACAAGGG + Intergenic
1160524659 18:79527896-79527918 GAACCCCAGGGGTGCCAGAAGGG - Intronic
1162982600 19:14248976-14248998 CAACCCGAGGGGCGCAAGAAGGG + Intergenic
1163738905 19:18998834-18998856 CAAACCAGGGGACACCAGACAGG + Intronic
1167428969 19:49443452-49443474 AAACCCCTGGGACCCCAGAACGG + Intergenic
927067980 2:19493068-19493090 CAACACCTGGGAGGTCAGAAAGG - Intergenic
933875952 2:86622716-86622738 CAACCCCCGGCACTCCAAAATGG + Exonic
938723123 2:134084069-134084091 CCACCCAGGGGAGGCAAGAATGG + Intergenic
948111715 2:235461665-235461687 CAACCCCCGGGCCCCCAGGAAGG + Intergenic
1168971453 20:1933743-1933765 CAACCCCGGGGATGTTAGCATGG - Intronic
1173864781 20:46307126-46307148 CAACCCTGGCGACGCCCGAAGGG + Intronic
1176240814 20:64075049-64075071 GAACACCTGGGAGGCCAGAAGGG + Intronic
1176241205 20:64076748-64076770 GAACACCCGGGAGGCCAGAAGGG - Intronic
1183173482 22:36204918-36204940 CAACCCCGAGGATGCCAGGCAGG - Intergenic
954912361 3:54121246-54121268 CAACTCCGGTGACCCCAGCAAGG - Intergenic
969100812 4:4766781-4766803 CCTCCCCTGGGACTCCAGAAAGG + Intergenic
972818052 4:42666546-42666568 CAACCCAGAGGAAGCCAAAAGGG - Intergenic
974552659 4:63398161-63398183 CAACACTGGGGACTCCAAAAAGG - Intergenic
981049728 4:140298129-140298151 CACCTCCGGGGAGGCCAGCATGG - Intronic
989646153 5:43634968-43634990 CAACCCAGGGAAAGCCAGGAAGG - Intronic
993719915 5:91312096-91312118 CAACTACGGGGAGGCAAGAAAGG + Intergenic
999371757 5:151059980-151060002 CAACCCCGGGGGAGAAAGAAGGG - Intronic
999935982 5:156486295-156486317 CAATGCAGGGTACGCCAGAAAGG + Intronic
1000184179 5:158843149-158843171 CAACCCTGGGGAAGCAAGCAGGG - Intronic
1002693763 5:181070501-181070523 CACCCTCGGGGGCCCCAGAAAGG - Intergenic
1007745973 6:44043107-44043129 CACCCCCAGGGAGGCCTGAAGGG - Intergenic
1008099081 6:47372105-47372127 CAACCCCCTAGACCCCAGAATGG + Intergenic
1008931691 6:56947088-56947110 CAGCCTCGGGGTCACCAGAAAGG + Intronic
1011450251 6:87484214-87484236 CACCCCTGAGGACGCCACAAGGG + Intronic
1017815076 6:158010634-158010656 TAACCCCCGGGACCTCAGAAGGG + Intronic
1019337096 7:490700-490722 CAAGCCCCGGCACGCCAGAGCGG + Intergenic
1019625197 7:2012352-2012374 AAACGCCAGGGACGGCAGAAGGG + Intronic
1025818624 7:64943065-64943087 CCACCTCGGGGAGGACAGAAGGG + Intergenic
1028233251 7:88330341-88330363 CACCCTCGGGGACCCCAGGAAGG + Intergenic
1029090724 7:98046090-98046112 CAACCTCCAGGACGTCAGAATGG + Intergenic
1042971561 8:74414994-74415016 CAACACCAGGGAGGGCAGAAAGG + Intronic
1062569631 9:137179145-137179167 CAACCCCAGGTACCCCAGGAAGG - Intronic
1198973016 X:142302669-142302691 CCACCACAGGGACCCCAGAATGG - Intergenic
1200251824 X:154558063-154558085 CACACCCGGGGCCGCCAGGATGG - Intronic
1200265943 X:154646353-154646375 CACACCCGGGGCCGCCAGGATGG + Intergenic
1200981286 Y:9265379-9265401 CAACCCCGGGGAACACAGGAGGG + Intergenic