ID: 1103688885

View in Genome Browser
Species Human (GRCh38)
Location 12:122754043-122754065
Sequence ACTAGGTTATTTCAGCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103688881_1103688885 16 Left 1103688881 12:122754004-122754026 CCTGAAGAAGCTTACAGTCCATT 0: 1
1: 0
2: 7
3: 62
4: 443
Right 1103688885 12:122754043-122754065 ACTAGGTTATTTCAGCCTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 119
1103688883_1103688885 -2 Left 1103688883 12:122754022-122754044 CCATTTGTAACAGGATGTGCAAC 0: 1
1: 0
2: 1
3: 8
4: 82
Right 1103688885 12:122754043-122754065 ACTAGGTTATTTCAGCCTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103688885 Original CRISPR ACTAGGTTATTTCAGCCTGA AGG Intronic
902106736 1:14043348-14043370 ACTGGGTTATTCCAGCCTTTTGG + Intergenic
902797547 1:18809148-18809170 ACTAGATTATTTCAGGCAAAGGG + Intergenic
906376170 1:45298639-45298661 ACTAGGTGTTTTCAGAATGAAGG + Intronic
909473836 1:76059849-76059871 AATGGGTTATATCAGCCTGAGGG + Intergenic
910042403 1:82868542-82868564 ACTAGGATTGTTTAGCCTGAAGG + Intergenic
911944892 1:104094608-104094630 AATCTGTTATATCAGCCTGAAGG + Intergenic
913218657 1:116642293-116642315 ACTAAGTCATTTCAGACTTAGGG - Intronic
916183183 1:162105751-162105773 ACTCCGTCATTTCAGCCTGGTGG - Intronic
916183743 1:162111213-162111235 ACTAGAGTATTCCAGCCAGAAGG + Intronic
916484228 1:165243916-165243938 CCTAGGTTATTTCAGGATGGGGG + Intronic
924753408 1:246919258-246919280 ACTAGGCTACATCAGCCTAAAGG + Intronic
1065653113 10:27915238-27915260 ATTCTGTTATTGCAGCCTGAAGG - Intronic
1065750073 10:28877844-28877866 AATAGTATATTTCAGCCTTAGGG + Intronic
1067175440 10:43942763-43942785 AGTAGGATCTTTCTGCCTGAAGG - Intergenic
1076296324 10:129387605-129387627 ACTAGATTATTTCAGTGTGTGGG - Intergenic
1079512963 11:21232513-21232535 ATTTGGTTATTTCAGGCAGAAGG - Intronic
1087481788 11:98710817-98710839 CCTTGCTGATTTCAGCCTGAGGG - Intergenic
1090031698 11:123211846-123211868 ACTGGGTTACTTCAGCCTCTTGG + Intergenic
1090325903 11:125886498-125886520 ACTAGGATATTGAACCCTGAGGG + Intronic
1096164672 12:49412169-49412191 ATTAGGTAATTTGAGACTGATGG - Intronic
1097068824 12:56339928-56339950 CCTATGTCCTTTCAGCCTGAGGG + Exonic
1097649559 12:62280366-62280388 ACTTTGTTATAGCAGCCTGAAGG - Intronic
1103688885 12:122754043-122754065 ACTAGGTTATTTCAGCCTGAAGG + Intronic
1105487141 13:20846060-20846082 TCTAGGTTCTTTCAGCTTGCAGG - Intronic
1109506534 13:63309644-63309666 ATTCGGCTCTTTCAGCCTGAAGG - Intergenic
1111819146 13:93192767-93192789 ACTATGTTCTGGCAGCCTGAGGG - Intergenic
1113000964 13:105636290-105636312 ACCACATTTTTTCAGCCTGATGG + Intergenic
1114058843 14:19000998-19001020 ACTTAGTCATTCCAGCCTGAGGG + Intergenic
1114103701 14:19400756-19400778 ACTTAGTCATTCCAGCCTGAGGG - Intergenic
1114871359 14:26663126-26663148 GCTAGGTGATCTCACCCTGAGGG + Intergenic
1117545214 14:56788529-56788551 CGTAGGTTAATTCAGCCTGTGGG - Intergenic
1118773082 14:68955341-68955363 ACTGGATCATTTCAGCCTGGGGG - Intronic
1202836111 14_GL000009v2_random:78538-78560 ACTTAGTCATTCCAGCCTGAGGG + Intergenic
1127052954 15:55103789-55103811 CCTAGAATACTTCAGCCTGAAGG + Intergenic
1127910655 15:63413423-63413445 ACTAGGGCATTTCAGCCTTAGGG - Intergenic
1131742745 15:95412054-95412076 CCAAGATTATTTCTGCCTGAAGG - Intergenic
1144120815 17:12150765-12150787 ACTCAGCCATTTCAGCCTGATGG + Intergenic
1144485655 17:15662089-15662111 ACTTGGTTACTGCAGCCTGTCGG + Intronic
1146139696 17:30354935-30354957 TCTAGCTTATTTAAGCATGAAGG + Intergenic
1147543500 17:41380536-41380558 ACTTGGGTGTTTCAGTCTGAGGG - Intronic
1148471848 17:47898957-47898979 ACTGGTTTAGTTCAGCCTGTAGG - Intronic
1148720270 17:49747530-49747552 ACTAGGATCTTTGATCCTGAAGG - Intronic
1153667219 18:7376916-7376938 CCTGGGCTATTTCAGCCTTAGGG - Intergenic
1153766548 18:8380217-8380239 GCTAGGTTATTTCATGCAGAAGG - Intronic
1155435299 18:25806330-25806352 ACTAGGTTCTTTCATCCCTAGGG + Intergenic
1155464598 18:26120741-26120763 ACTTGGCTATTCCAGCCTGCAGG + Intergenic
1156662772 18:39366583-39366605 ACTCGATTATTTCAGCTTAAAGG + Intergenic
1158395910 18:57078228-57078250 ACTTGGTTATTTGAGAGTGAGGG + Intergenic
1159781051 18:72660853-72660875 TCAATGTTAATTCAGCCTGACGG - Intergenic
1164954781 19:32372890-32372912 ACTTTGTTATAGCAGCCTGAAGG - Intronic
1166965805 19:46528826-46528848 ACCAGGTTCTTTCTGCCTGAAGG + Intronic
1202636525 1_KI270706v1_random:48823-48845 ACTTAGTCATTCCAGCCTGAGGG - Intergenic
928885127 2:36139533-36139555 TCTAGCCTATTACAGCCTGAAGG + Intergenic
933733567 2:85477006-85477028 ACTAGGTTGTTTCTCCCAGATGG - Intergenic
934993066 2:98935123-98935145 ACTAGGTTATTGGAGCCTGCAGG - Intronic
937314417 2:120921876-120921898 ACTCAGTGATTTCAGCATGAAGG - Intronic
937867379 2:126762698-126762720 ACTGGATTACTGCAGCCTGAGGG - Intergenic
941499315 2:166249731-166249753 ACTATGCTATTTCAGACTGTAGG - Intronic
943145306 2:184036412-184036434 TGTCTGTTATTTCAGCCTGATGG - Intergenic
944482052 2:200167597-200167619 ACAAGGCTATTACAGCGTGAGGG - Intergenic
945466194 2:210172327-210172349 ACTAGGCTTTTTAAGCCAGAAGG + Intergenic
1171882658 20:30629755-30629777 ACTTAGTCATTCCAGCCTGAGGG - Intergenic
1178290948 21:31367400-31367422 ATGAGGTTATTTCGGCCTGTTGG - Intronic
1180477328 22:15723614-15723636 ACTTAGTCATTCCAGCCTGAGGG + Intergenic
1180819952 22:18820355-18820377 ACTAAGTCATTTCAGACTTAGGG - Intergenic
1181206174 22:21254827-21254849 ACTAAGTCATTTCAGACTTAGGG - Intergenic
1203220746 22_KI270731v1_random:40596-40618 ACTAAGTCATTTCAGACTTAGGG + Intergenic
1203270077 22_KI270734v1_random:46226-46248 ACTAAGTCATTTCAGACTTAGGG - Intergenic
949375559 3:3385522-3385544 ACTAGGTGTGTTCTGCCTGAAGG - Intergenic
949672791 3:6418755-6418777 AATAGATTGTTTCTGCCTGAAGG + Intergenic
954020257 3:47734124-47734146 AGTAGGTAATTTCAGCTTCAAGG + Intronic
955235718 3:57137283-57137305 ACTTGGCTATTTCAGCCCTATGG - Intronic
957130055 3:76212760-76212782 GCTGGGATATTTCAGCCTAATGG - Intronic
958177051 3:90009415-90009437 ACTAAGTTATTACAGCTTAAGGG + Intergenic
958686387 3:97403102-97403124 ACTAGATTTTTTCCTCCTGAGGG - Intronic
959602758 3:108207467-108207489 ACAAGGATATTTCAACCTTAAGG + Intronic
961969714 3:130948187-130948209 ACTTTCTTATTTCAGCCTAAAGG + Intronic
962439120 3:135395662-135395684 ACTATCTCATTCCAGCCTGATGG + Intergenic
964322517 3:155512984-155513006 ACTAAGTTCTTCCAGCCTGAAGG + Intronic
966573821 3:181477249-181477271 ACTCAGTTGTTTCAGCCTGTTGG - Intergenic
966953672 3:184849849-184849871 AATAGATTATTCCAGCCAGAAGG + Intronic
968404370 4:327210-327232 ACTAAGCCATTTAAGCCTGAGGG + Intergenic
969673913 4:8604415-8604437 ACTAGGTTATTTCATAATAATGG + Intronic
973366333 4:49212192-49212214 ACTTGGTCATTCCAGCCTGAAGG - Intergenic
973394272 4:49580242-49580264 ACTTAGTCATTCCAGCCTGAGGG + Intergenic
973991280 4:56410293-56410315 ACTATATCATTTCAGCCTGAAGG - Intronic
979135721 4:117111119-117111141 ACTAGGTAATATTAGCATGAAGG + Intergenic
979835338 4:125360000-125360022 TTTAGGTTGTTTCATCCTGAGGG - Intronic
979857222 4:125649628-125649650 GCTAGGTTAGTTCATCCAGAAGG + Intergenic
984209421 4:176827211-176827233 ATTCTTTTATTTCAGCCTGAAGG - Intergenic
984482677 4:180326174-180326196 ACTATGGTATTACAGCGTGACGG - Intergenic
1202763842 4_GL000008v2_random:134694-134716 ACTTAGTCATTCCAGCCTGAGGG - Intergenic
986268265 5:6209230-6209252 ACTTTGTTATTGCAGCCTGAAGG - Intergenic
987609161 5:20179857-20179879 AATAGGTTCTGGCAGCCTGAGGG + Intronic
991439577 5:66633121-66633143 ACTGGGGTATTTGAGCCTCAAGG - Intronic
993858327 5:93102774-93102796 TCTAAGTTAGTTCAGCCAGAAGG + Intergenic
996321494 5:122222279-122222301 ACCAGTTTAGCTCAGCCTGAAGG - Intergenic
997034171 5:130167538-130167560 CCTAAGTTATTTCAAGCTGAGGG + Intronic
999666370 5:153917243-153917265 ACTAGGCTATTCCAGCTTGTGGG - Intergenic
1005326801 6:24710142-24710164 ATAAGGTTACTTCAGCCTTAAGG + Intronic
1010035634 6:71322457-71322479 ATTCAGTTATTTCTGCCTGAAGG + Intergenic
1010391120 6:75338786-75338808 AATCGTTTATTTCAGCCTCATGG - Intronic
1010653924 6:78489170-78489192 ACTGGGTTCTTTTAACCTGAAGG + Intergenic
1013178847 6:107701089-107701111 AATAGGTTATTGCAGCGTGAAGG + Intergenic
1013703495 6:112803087-112803109 ACTAAGTTGTTTCATGCTGAAGG + Intergenic
1014564400 6:122930414-122930436 ACTCGGCTATTTTAGCCTGCTGG - Intergenic
1017889527 6:158627211-158627233 ACTAGGTAATTTGAGGGTGAGGG - Intronic
1020669281 7:11086434-11086456 ACGAGGTTATTTCAGAGAGAAGG - Intronic
1021246062 7:18262492-18262514 ACCCTTTTATTTCAGCCTGAAGG - Intronic
1021441265 7:20679746-20679768 ACTTGGTTCTTTCTGTCTGATGG - Intronic
1022353332 7:29586689-29586711 GCAAGTTTATATCAGCCTGATGG + Intergenic
1022678097 7:32519459-32519481 ACTAGCTTGTATCAGTCTGAAGG - Intronic
1023047279 7:36221173-36221195 ATTAGGTTATTTTAAACTGAAGG - Intronic
1035785153 8:2254119-2254141 ACAGGGTTACGTCAGCCTGAGGG - Intergenic
1035807658 8:2467597-2467619 ACAGGGTTACGTCAGCCTGAGGG + Intergenic
1039034658 8:33346757-33346779 ACTAGATTATTTTATCCTGGGGG - Intergenic
1040647020 8:49410557-49410579 AATGAATTATTTCAGCCTGAAGG + Intergenic
1042424310 8:68629165-68629187 ACCAGGTTTTCTCAGCCAGATGG + Intronic
1048421955 8:134285601-134285623 TCTAGGTTATACCAGCCTGTAGG - Intergenic
1051011096 9:12415529-12415551 AATATGTTATTTCTGCCTGAGGG + Intergenic
1057360266 9:94366926-94366948 AAGAGGCTATTTCAGACTGAGGG + Intergenic
1057663073 9:97021151-97021173 AAGAGGCTATTTCAGACTGAGGG - Intergenic
1058457225 9:105148787-105148809 GCTGGGCCATTTCAGCCTGATGG - Intergenic
1203544594 Un_KI270743v1:119567-119589 ACTTAGTCATTCCAGCCTGAGGG - Intergenic
1186264161 X:7813696-7813718 ATTAGGAAATTTCATCCTGATGG - Intergenic
1186349905 X:8731045-8731067 CGTAGGTTCTTTCAGCCTGAGGG - Intronic
1187926973 X:24259485-24259507 ACTACGTAATTTTATCCTGATGG + Intergenic
1192830464 X:74745752-74745774 TATAGGTTATTTCAGCTAGAGGG + Intronic
1194972578 X:100360211-100360233 ACAAGCTTATTTAAGACTGAAGG + Intronic
1195966992 X:110437874-110437896 ACTCAGGTAATTCAGCCTGAGGG + Intronic
1197114705 X:122818403-122818425 ACTCAGTCATTTCAGCCTGCTGG + Intergenic