ID: 1103700394

View in Genome Browser
Species Human (GRCh38)
Location 12:122846173-122846195
Sequence CAGCCCCTGCCTCCTGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1203
Summary {0: 1, 1: 1, 2: 20, 3: 155, 4: 1026}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103700388_1103700394 25 Left 1103700388 12:122846125-122846147 CCTGGCTTGTGACAGGACAGCTG 0: 1
1: 0
2: 1
3: 18
4: 203
Right 1103700394 12:122846173-122846195 CAGCCCCTGCCTCCTGCCCTGGG 0: 1
1: 1
2: 20
3: 155
4: 1026
1103700392_1103700394 -2 Left 1103700392 12:122846152-122846174 CCAGTGAGCTGGGGAAAGTCACA 0: 1
1: 0
2: 1
3: 34
4: 273
Right 1103700394 12:122846173-122846195 CAGCCCCTGCCTCCTGCCCTGGG 0: 1
1: 1
2: 20
3: 155
4: 1026

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103700394 Original CRISPR CAGCCCCTGCCTCCTGCCCT GGG Intronic
900137834 1:1125912-1125934 CGGACCCTGCTTCCAGCCCTGGG + Intergenic
900142814 1:1145627-1145649 CTGCCCCTGCCCCCAGCCCTCGG - Intergenic
900242489 1:1623707-1623729 CTGCCCGTCCCGCCTGCCCTTGG - Intronic
900259781 1:1720472-1720494 CAACCTCTGCCTCCTGTCCCAGG + Intronic
900342993 1:2197448-2197470 AGGCCCGTGCCTCCTACCCTTGG - Intronic
900373909 1:2344638-2344660 CTGCTCCGGCCTCCTTCCCTGGG + Intronic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
900474009 1:2867970-2867992 AAGCCCCAGCCTCCTGGCCAGGG + Intergenic
900497704 1:2983553-2983575 GACCCCCAGCCTCCTGCCCTGGG - Intergenic
900505251 1:3027166-3027188 CAGCTCCTGCCTCTTGTCCCGGG + Intergenic
900522814 1:3113764-3113786 CAGCCTCTGCCTCTGGCCCAGGG - Intronic
900546641 1:3233180-3233202 CAGCAGCTGCCCCCTGCCCAGGG + Intronic
900623875 1:3599372-3599394 CAGCTGCTGCCTCTCGCCCTCGG + Intronic
900632819 1:3646155-3646177 CAGGCACTGTCTGCTGCCCTGGG - Intronic
900683280 1:3930897-3930919 CAGCCTCTCCCTCCTGCCTCAGG + Intergenic
900919169 1:5659822-5659844 CAGTCCCTGCCATCTGCCATCGG + Intergenic
901023744 1:6268450-6268472 CAGCCCCTCCTTTCTTCCCTAGG + Intronic
901224614 1:7605980-7606002 CATCCCTGCCCTCCTGCCCTCGG + Intronic
901235258 1:7664239-7664261 CGGCTCCAGCCTCCTGCCGTCGG + Exonic
901278417 1:8011235-8011257 CAGCCCCTGCCTCCATCCAAAGG + Intronic
901491964 1:9601301-9601323 CAGCAACTGCCGCCAGCCCTCGG - Exonic
901692412 1:10982047-10982069 CAGCAGCTCTCTCCTGCCCTGGG + Intergenic
901798767 1:11695040-11695062 CAGCTCATGCCACCTTCCCTGGG + Intronic
901814827 1:11788080-11788102 CAGCCCTTGCCCCCATCCCTCGG - Exonic
901835481 1:11921398-11921420 CAGCCCCTTGCTCCAGGCCTCGG - Intronic
902283462 1:15390844-15390866 CAGCCCCTTCCACTTGCTCTGGG + Intronic
902734361 1:18390461-18390483 CAGCCCCTCCCTCCCTGCCTGGG - Intergenic
902808799 1:18876602-18876624 CAGACCCTGGCTTTTGCCCTTGG - Intronic
902893930 1:19465743-19465765 AAGCCAGTGCCTCCTGTCCTGGG + Intronic
903303139 1:22393130-22393152 CAGCTCTTGCCTCCTTGCCTTGG - Intergenic
903305156 1:22408164-22408186 CAGCCCAAGCCTCCTGCCACCGG + Intergenic
903490884 1:23727413-23727435 CAGCCCCGGCCTCCCACGCTGGG - Intergenic
903499448 1:23793386-23793408 CAGCACCAGCCCCCAGCCCTAGG + Intronic
903774401 1:25783478-25783500 CAGCCACAGCCTCCTTCCCCAGG + Intronic
904749167 1:32730261-32730283 CTGCCCCTCCCTCCGACCCTGGG + Intergenic
905303709 1:37003549-37003571 CAGCCTCTCCTTCCTGCCCCTGG + Intronic
905446435 1:38030947-38030969 CAGCTCTGGCCTCCTTCCCTGGG + Intergenic
905477352 1:38238446-38238468 CATCCCAAGCCTCCTGCCCCAGG + Intergenic
906005152 1:42462971-42462993 GAGCCCCTGCCTACTAACCTTGG - Intronic
906293797 1:44636762-44636784 CAGCTGCTCCCTCCTTCCCTTGG + Intronic
906544546 1:46612057-46612079 CAACCCCCTCCTGCTGCCCTCGG + Intronic
906642080 1:47447231-47447253 CAGCCCCTGCAGCCTGCCTGGGG + Intergenic
906662872 1:47594836-47594858 CGGCTCCTGCCAGCTGCCCTCGG - Intergenic
906721550 1:48009118-48009140 TAGTCCCTGGTTCCTGCCCTTGG + Intergenic
906727179 1:48052500-48052522 CCTCCTCTGCCCCCTGCCCTTGG - Intergenic
907012668 1:50978051-50978073 CCGCTCCCGCCTCCTGCCCGCGG - Intergenic
907085780 1:51672492-51672514 CAGCCCCAGCCCCCGGCCCCAGG + Intronic
907319808 1:53595094-53595116 CAGCCTCTGCCTCCTGCCCTGGG - Intronic
907391062 1:54158500-54158522 CAGCATCAGCCCCCTGCCCTTGG - Intronic
907605923 1:55817406-55817428 CGCCCCTTGCCTTCTGCCCTGGG - Intergenic
908105153 1:60833691-60833713 CATCCTCTGCCTCCACCCCTGGG - Intergenic
909618054 1:77634967-77634989 CAGTCCCTTCCTCCTGCCTTTGG + Intronic
910130063 1:83893843-83893865 CATCCCCTGCCCCTTCCCCTAGG - Intronic
910205876 1:84748243-84748265 CGCCCCCTGCAGCCTGCCCTAGG + Intergenic
910309821 1:85810565-85810587 CAGCCCCCACCTCCTGCACTGGG - Intronic
910468271 1:87523640-87523662 CAGCCTCTGCCCTGTGCCCTTGG + Intergenic
912996576 1:114537360-114537382 CAGCCCTGGCCTCCTGGACTGGG - Intergenic
913988077 1:143584019-143584041 AGGGCCCTGCCTCCTGACCTTGG + Intergenic
914263154 1:146016382-146016404 CAACCTCTGCCTCCTGGCCCGGG + Intergenic
915118010 1:153612468-153612490 CAGCCCCCGCCTCCTCTTCTCGG + Intronic
915146172 1:153796835-153796857 CCGCCCTTACCTCCTGACCTTGG - Intergenic
915214008 1:154328426-154328448 CAGCTCCTGCTTTCTGGCCTAGG + Intronic
915225352 1:154407275-154407297 CAGCCCAAGGCTCCTGCCCCAGG + Intronic
915299300 1:154942819-154942841 CAGGCCCAGCCACCTGCCCCAGG + Intergenic
915641280 1:157228934-157228956 CAGCCCCTGCAGCCTCCCCCTGG + Intergenic
915763029 1:158334740-158334762 CACCACCTGCTTCCTGCCCCTGG - Intergenic
916484164 1:165243356-165243378 AAGCCCCTGCCTCCGCCCCCAGG + Intronic
916712847 1:167427151-167427173 CAGCCCCTGCAGGCAGCCCTAGG - Exonic
918433586 1:184487297-184487319 CAGCTCCTGCCTTCTGCACTTGG + Intronic
919303929 1:195805947-195805969 CAGCACCTGCCTCCAGACCTAGG + Intergenic
919766384 1:201130006-201130028 CAGCTCCCGCCTCATCCCCTAGG + Intergenic
919883070 1:201913524-201913546 CAACCTCTGCCTCCTGACTTCGG - Intronic
919972949 1:202592383-202592405 CCACCCCTGCCTCCTCCCATCGG - Exonic
920194603 1:204218541-204218563 CAGGCCCTGGCACCTTCCCTTGG - Intergenic
920398258 1:205661700-205661722 CAGCCCAAGCCTCTGGCCCTGGG + Intronic
920921507 1:210301095-210301117 GAGACCCAGCCTGCTGCCCTTGG + Intergenic
921157205 1:212447810-212447832 CGGCCTGTGCCTCCTCCCCTGGG - Intergenic
922289429 1:224198277-224198299 TAGCCACTGCCTCCAGCCCCAGG + Intergenic
922724168 1:227914816-227914838 CAGCCCCTGCCTGATAGCCTGGG - Intergenic
922748649 1:228060676-228060698 CAGCCCCTCCTCCCTGCCCTCGG + Exonic
922751808 1:228073580-228073602 CAGCTCCTAACTCCTACCCTGGG - Intergenic
922753423 1:228081733-228081755 CAGGCCCTGCCCCCGGGCCTCGG + Intergenic
923087213 1:230710769-230710791 CATCCTCTGCCTCCTGGCCTGGG - Exonic
923205190 1:231752525-231752547 CAGGCCCTGCCTCCAACACTTGG + Intronic
924335246 1:242981015-242981037 CAGCTCCTGCATCCTGCTCAGGG + Intergenic
924471174 1:244343881-244343903 CAGCTCCTGACTCCTTTCCTCGG - Intergenic
924491163 1:244539048-244539070 CTGCACCTGCCTTCTGGCCTGGG - Intronic
1062982583 10:1737443-1737465 CGGGCTCTGCCTCCTGCTCTGGG + Exonic
1062996876 10:1874358-1874380 CAGCCCCTGTGGCCTGCCTTTGG + Intergenic
1063338948 10:5244863-5244885 CAGGCCCTGCCTCCAGCACTGGG - Intergenic
1063344150 10:5295511-5295533 CAGGCCCTGCCTTCAGCACTGGG + Intergenic
1063418105 10:5889887-5889909 CCGCCCCAGCCTCCAGCCCCTGG + Exonic
1063652006 10:7947196-7947218 CAGCCCTAGAATCCTGCCCTTGG + Intronic
1064523375 10:16227444-16227466 CAGGCCCTGCCTCCAACACTAGG - Intergenic
1064618700 10:17192034-17192056 CCCCACCTGCCTCCTGGCCTGGG - Intronic
1065136857 10:22679857-22679879 CAACCCCTACCCCCAGCCCTAGG - Intronic
1066371979 10:34825118-34825140 CAGCCTATCCCTCCTGCCCCAGG + Intergenic
1066990884 10:42512241-42512263 CAGGACCTACCTCCAGCCCTGGG - Intergenic
1067090429 10:43263633-43263655 GAGCCCCTGCTGGCTGCCCTGGG + Intronic
1067116059 10:43436567-43436589 CAGCCTCTGCCGCCGGCTCTTGG - Intergenic
1067157715 10:43795909-43795931 CAGCCCCTCCCTGCAACCCTAGG - Intergenic
1067169959 10:43898360-43898382 CAGCCCCTGCCCCCTGACAAGGG - Intergenic
1067217746 10:44316729-44316751 CTGCCCCTCCCACCAGCCCTGGG + Intergenic
1067222226 10:44352586-44352608 CAGGCCCGGCCTCTTACCCTTGG + Intergenic
1067433956 10:46264441-46264463 CCACCCCTGCCTCCTGGCCCAGG + Intergenic
1067439737 10:46301868-46301890 CCACCCCTGCCTCCTGGCCCAGG - Intronic
1067440398 10:46306042-46306064 AAGGCCCTGCCCCCTGTCCTGGG + Intronic
1068909217 10:62360297-62360319 CACTCTCTTCCTCCTGCCCTTGG + Intergenic
1069121370 10:64573765-64573787 CAGCCACTTCCTCCAGGCCTAGG - Intergenic
1069570672 10:69492748-69492770 CTTCCCCTCCTTCCTGCCCTGGG + Intronic
1069639135 10:69943776-69943798 CAGCCCCCGGCCCCTGCCCCGGG + Intronic
1069686383 10:70321687-70321709 GAGCCCCTGCTGCCTGGCCTCGG - Intronic
1069785417 10:70984803-70984825 CAGGCCCTACCTCCAGCACTGGG + Intergenic
1069872609 10:71542485-71542507 CAGGCCCTGAGTCCTGCCATCGG - Intronic
1069891750 10:71656510-71656532 CATCATCTGCCTCCTGCCCCTGG - Intronic
1069943748 10:71972446-71972468 CAGTACCTGCCGGCTGCCCTGGG + Intronic
1070306866 10:75244949-75244971 CAGCCCCTACACCCTGCCCGTGG - Intergenic
1070316754 10:75320982-75321004 CAGGCCCCACCTCCTGCACTGGG - Intergenic
1070688947 10:78510633-78510655 CAGCGTCTGCCTCCTGCACAGGG + Intergenic
1070788802 10:79177579-79177601 CGGACCCTGCCTCCTGCCCCGGG + Intronic
1071505666 10:86230051-86230073 CAGCCCCTGCATCCTGCTCCTGG + Intronic
1071573245 10:86709393-86709415 CTGCCCCCGCCTGCTGCCCAAGG - Intronic
1072137836 10:92563672-92563694 CAACCTCTGCCCCCTGCCCCAGG - Intronic
1072318867 10:94229409-94229431 CAGCCTCTGCCTCCCTCTCTTGG - Intronic
1073326103 10:102644590-102644612 CTGCCCCGGCCCCCTGCCCGCGG + Exonic
1073350137 10:102813653-102813675 CAGTCCCAGCCTCCTTCCTTGGG - Exonic
1073480689 10:103784405-103784427 CATTCCCTTCCTCCTGCCTTGGG - Intronic
1073663906 10:105508678-105508700 TATGCCCTACCTCCTGCCCTGGG - Intergenic
1074126572 10:110533310-110533332 CAGCCCCTGCTTGCTGCCTGAGG - Intergenic
1074399385 10:113129276-113129298 AAGTGCCTGCCTCCTGCACTCGG + Intronic
1074418095 10:113284888-113284910 CAGCCCCTGCCTGTTTCCCTTGG - Intergenic
1074702473 10:116104544-116104566 CAGTCCCTGCGTCCTGCCTTGGG + Intronic
1075197694 10:120375275-120375297 CAGACCCTGCCCCCAGCCCCTGG - Intergenic
1075242635 10:120792705-120792727 CAGCCCCTGCCCCCTATACTGGG + Intergenic
1075527472 10:123198756-123198778 CAGTCCCTGGCGCCTTCCCTAGG - Intergenic
1075643715 10:124084175-124084197 CAGCGCGTGGCCCCTGCCCTTGG - Intronic
1075671783 10:124268032-124268054 GTGCCCCTGCCTCCTGCTCGGGG - Intergenic
1075756188 10:124813576-124813598 CAGCCCCTGCCTGCTTCCAGAGG + Intronic
1075778780 10:125003937-125003959 CAGCCCCTCTCACCTGCGCTGGG + Intronic
1075935464 10:126337301-126337323 CTTCCCATTCCTCCTGCCCTGGG - Intronic
1076022998 10:127089595-127089617 CTGCCCCTGCCCACTGCCCCTGG + Intronic
1076035579 10:127196424-127196446 CCGCCCCCGCCTCCTGGCCCTGG - Intronic
1076327066 10:129632624-129632646 CAGACCCTGCCTGCTGCTCCGGG + Intronic
1076532940 10:131157030-131157052 CAGCCCCTGGCTTCTGGGCTAGG + Intronic
1076548117 10:131259783-131259805 CAGCCCCTGTGTCCAGCCCAGGG + Intronic
1076701757 10:132276887-132276909 CAGCCACGGCCTCGAGCCCTGGG - Intronic
1076738466 10:132468958-132468980 CAGCCCCTGCCCCCTGCCCAGGG + Intergenic
1076752135 10:132548609-132548631 CAGTCCCTGCTCCCGGCCCTGGG + Intronic
1076868275 10:133180011-133180033 CAGCCTCGTCCTGCTGCCCTGGG + Intronic
1076882717 10:133247455-133247477 CAGCACCTGCCTCCTGACTTGGG - Intergenic
1076904684 10:133356078-133356100 GAGCCCCTGCCAGCTGTCCTGGG + Intronic
1076981067 11:205055-205077 CAGCCCCTCCCCCCTCCCCCAGG - Exonic
1077018093 11:405796-405818 CAACCCCTGCCAGCAGCCCTGGG - Exonic
1077081338 11:725967-725989 CAGCCCTTTCCTTCTGCCCAGGG - Intronic
1077194224 11:1271197-1271219 CAGCCCCTCCTGCCTGCACTGGG + Intergenic
1077243884 11:1526518-1526540 CAGCGCCTGCTCCCTGCCCTGGG + Intergenic
1077303356 11:1857047-1857069 GGTCCCCTTCCTCCTGCCCTGGG + Intronic
1077326028 11:1964486-1964508 CGGCCCCCTCCTCCTGGCCTGGG + Intronic
1077366908 11:2164923-2164945 CTGTCCCGGCCCCCTGCCCTGGG - Intronic
1077529745 11:3089663-3089685 CACACCCTCTCTCCTGCCCTCGG + Intronic
1077541237 11:3147440-3147462 CAGCCTCTCCCTCGTGCCCCAGG + Intronic
1077600692 11:3572483-3572505 CTGGCCCTGGCTCCTGCCCTGGG + Intergenic
1077697906 11:4411880-4411902 GAGCCACTGCCTCCAGCCATGGG + Intergenic
1078095291 11:8292667-8292689 GAGGCCCTGCCTCCTTCTCTTGG - Intergenic
1078167900 11:8906004-8906026 CAGCTCCTGCCTCTGGTCCTAGG - Intronic
1078254705 11:9648112-9648134 CAGGCTCTGCCTCTTGCCCTTGG + Intergenic
1078594384 11:12674319-12674341 CAGGCCCCGCCTCCAGCCCCGGG + Intergenic
1078771853 11:14358906-14358928 CCGCCGCTGCCGCCCGCCCTAGG + Exonic
1079027425 11:16960314-16960336 GGGCCCATGCCTCCTGCTCTGGG - Intronic
1079431031 11:20388167-20388189 CAGCGCCTGGCCTCTGCCCTAGG + Intronic
1079992372 11:27259682-27259704 CAGGCCCTACCTCCAGCACTGGG + Intergenic
1080857104 11:36121844-36121866 CAGCACCTCCCACCTGCCATCGG + Intronic
1081037872 11:38172325-38172347 CAGCCACTGCATTCTGGCCTCGG - Intergenic
1081584123 11:44372485-44372507 CAGGCCCTGCCTCCTGGGATGGG + Intergenic
1081774571 11:45668562-45668584 AAGGCCCTGCCACCTGCCATTGG - Intergenic
1081811691 11:45917800-45917822 CAGCTTCTCCATCCTGCCCTCGG + Exonic
1081868609 11:46372939-46372961 CAGTCCCTGCCTGCTCCCCCAGG + Exonic
1081870276 11:46380099-46380121 CAGCTCCTGAGTCCAGCCCTAGG - Exonic
1081915343 11:46726904-46726926 CAGGCCCTGCCTGCAGGCCTGGG + Intronic
1081989803 11:47331805-47331827 CAGCCACTGACTTGTGCCCTGGG + Intronic
1082619480 11:55402177-55402199 CAGGCCCTACCTCCAGCACTCGG + Intergenic
1083052464 11:59789481-59789503 GAGCCACTGCCTTCTGGCCTGGG - Intronic
1083179743 11:60977467-60977489 CAGGCCCTCCATCCTGTCCTCGG + Intronic
1083191805 11:61057406-61057428 GAGGCCCGGCTTCCTGCCCTGGG + Intergenic
1083212260 11:61195555-61195577 CACCCCCAGCCTACTGCCCCTGG + Intergenic
1083252207 11:61475637-61475659 CACCCCCAGCCTCCTGGGCTGGG + Intronic
1083299048 11:61730739-61730761 CAGCCCCTGCCCGGAGCCCTGGG + Intronic
1083617162 11:64032022-64032044 CAACCCCTGACCACTGCCCTGGG + Intronic
1083618902 11:64039359-64039381 CAGGCCCTGGCTGCTGCCCCCGG + Intronic
1083637757 11:64129553-64129575 CAGCACCTGGCTCCATCCCTGGG - Intronic
1083639019 11:64135461-64135483 GAGCCCTTGCCGCTTGCCCTCGG + Intronic
1083663338 11:64262210-64262232 CTCACCCCGCCTCCTGCCCTTGG + Intronic
1083677281 11:64333128-64333150 CAGCCTCTGTCTCCTCCCCAGGG - Intergenic
1083695506 11:64439617-64439639 CTGCCCCTCCCTCCTGGCCCAGG - Intergenic
1083860743 11:65418680-65418702 CCTCTCCTGCCTCCTGACCTGGG + Intergenic
1084041892 11:66547236-66547258 CAGCCCTCTCCTCCAGCCCTGGG - Intronic
1084112590 11:67023524-67023546 CAGCCCCCTCCTCGGGCCCTGGG + Intronic
1084125640 11:67097193-67097215 CACCCGCTGCCACCTGCCATTGG - Intergenic
1084238825 11:67805384-67805406 CTGCCCCCGCCCACTGCCCTGGG - Intergenic
1084256606 11:67947082-67947104 CTGGCCCTGGCTCCTGCCCCGGG + Intergenic
1084321416 11:68375481-68375503 CTTCCCCTGCCCCCTGCCCCCGG + Intronic
1084460754 11:69295329-69295351 CAGCGTCTGGCTCCTTCCCTCGG + Exonic
1084526821 11:69703261-69703283 CAGCCCCTGCATCTTGCCGTCGG + Exonic
1084531565 11:69730740-69730762 CACCCCTTGACTCCTGCCCCTGG - Intergenic
1084649559 11:70480908-70480930 CAGCCCCAGGCTCCTGTGCTGGG + Intronic
1084694175 11:70744103-70744125 AGGCCCCTGCCTCCTACCCAAGG + Intronic
1084764721 11:71300827-71300849 AGGCCCCTGCCTCCTTCCCTGGG - Intergenic
1084816177 11:71648262-71648284 CCGGCCCTGGCTCCTGCCCCAGG - Intergenic
1084857498 11:71998298-71998320 CTCCCCCTACCTCCTGCCCCAGG - Intergenic
1084978674 11:72816924-72816946 CAGCCCTTGGCTGCTGCCCAGGG + Intronic
1085350534 11:75795508-75795530 CAGGGCCCACCTCCTGCCCTGGG - Intronic
1085411177 11:76291649-76291671 CACCCCCACCCTCCTGACCTCGG + Intergenic
1085642312 11:78200264-78200286 AGGCCCCTGCCTGCTGCCCCTGG + Intronic
1085650391 11:78262612-78262634 CAGCCCCTGCCTCCAGTCCCGGG + Intronic
1085688867 11:78649667-78649689 CAGCCCCCACGTCCTGCCCATGG - Intergenic
1086158250 11:83692469-83692491 CACCCCCTACCTCCAGCCCTAGG - Intronic
1086181170 11:83953500-83953522 CTGCCCCTGCCACCTGTCCATGG + Intronic
1088604456 11:111514675-111514697 CAGCCCCTGCCGGCTGCCCTCGG - Intergenic
1088627668 11:111742967-111742989 CACCCTCTGCCCCCTGCCCAAGG + Intronic
1089063365 11:115644042-115644064 AAGTCCATGCCTCCTGCCCCAGG + Intergenic
1089165400 11:116472135-116472157 CAGCCCCAGCCCCCAGCTCTAGG + Intergenic
1089329051 11:117677269-117677291 CAGCCCCCGACCCCAGCCCTTGG - Intronic
1089340059 11:117751053-117751075 CAGCCCCTGCCCTCTGCCTCTGG - Intronic
1089356948 11:117860193-117860215 CAGCCCCAAACTCCAGCCCTTGG + Intronic
1089429505 11:118410926-118410948 GAGCCACTGCACCCTGCCCTGGG - Intronic
1089443946 11:118536750-118536772 GAGCCCCTTTGTCCTGCCCTTGG + Intronic
1089669680 11:120045093-120045115 CAGGCCCTGCCTCCAACACTGGG + Intergenic
1089691379 11:120188859-120188881 CACCCACCACCTCCTGCCCTGGG + Intergenic
1090029408 11:123194772-123194794 CAGTCCCTGCCTCCTGGCCACGG - Intronic
1090078615 11:123595366-123595388 CCGCCCCTGCCCCCAGCCCCTGG + Intronic
1090190072 11:124761566-124761588 CCCCTCCTGCTTCCTGCCCTGGG - Intronic
1090220310 11:125015894-125015916 AAGCCCCTGCCTCTAGCCCCCGG + Intronic
1090331517 11:125935987-125936009 CAGCCCCTGCCCGGAGCCCTAGG + Intergenic
1090361450 11:126175486-126175508 CAGCCCCTTCTTCCTGTCGTGGG - Intergenic
1090952229 11:131483807-131483829 CAGAGCCTGTCTTCTGCCCTTGG + Intronic
1091030830 11:132186320-132186342 CATCCACTGCCTGCTTCCCTTGG - Intronic
1091256959 11:134196955-134196977 CAGGCCCCGCCTCCAGCACTGGG - Intronic
1202809008 11_KI270721v1_random:19665-19687 CGGCCCCCTCCTCCTGGCCTGGG + Intergenic
1091750506 12:3018954-3018976 CCGCCCCTGCCGACTCCCCTGGG - Intronic
1091771807 12:3156887-3156909 CAGCCCTTGCCCCCTGCCCTGGG - Intronic
1092195910 12:6549657-6549679 CAGGCCCTGCCTCCTGCTTGGGG - Intronic
1092426821 12:8381782-8381804 CTGGCCCTGGCTCCTGCCCCGGG + Intergenic
1093547960 12:20369662-20369684 CAGCCCCTGGCTGCAGCCCTCGG + Exonic
1093792910 12:23275665-23275687 CAGGCCCCGCCTCCTGCACTGGG + Intergenic
1093883612 12:24434560-24434582 CAGGCCCTACCTCCAGCCCTAGG - Intergenic
1094242332 12:28242740-28242762 CAGGCCCTACCTCCAGCACTGGG - Intronic
1094544187 12:31389114-31389136 CAACCTCTGCCTCCTCCCTTGGG - Intronic
1094611490 12:31999607-31999629 CAACCCCTGCCTCCTGGGCTTGG + Intergenic
1094622082 12:32089351-32089373 AAGCCCGTCCCTCATGCCCTTGG + Intergenic
1094830323 12:34297261-34297283 CAGCCCCTGCCTGGCGTCCTCGG + Intergenic
1094833423 12:34311197-34311219 CAGCCCCTGCGCCATGCCCCAGG - Intergenic
1095097948 12:38158024-38158046 CAGCCCCTGCGTCAGGCCCGGGG + Intergenic
1095369770 12:41453185-41453207 CAGCCCATGCCCCCCGCCCCTGG + Intronic
1096109760 12:49021629-49021651 CTGCCCCAGCCTCCTGCTCCAGG + Exonic
1096242169 12:49965348-49965370 CAGCCCCTGGCCCCTACCCCAGG - Exonic
1096273468 12:50185429-50185451 CAGCTTCTGCCTCCTGCTCCTGG - Intronic
1096325111 12:50653444-50653466 CCGCCCCTACCCCCAGCCCTGGG + Intronic
1096346248 12:50849539-50849561 CTGCCCCTGCATCCAGCCCTTGG + Intronic
1096619018 12:52850881-52850903 AAGCCCCTTCCTCCTTCCCCTGG + Intergenic
1096679022 12:53242498-53242520 CAGCTCCTGCCTCCTTGCCAGGG - Intergenic
1096839487 12:54371573-54371595 CAGCCCCGGCTTCCTTGCCTGGG - Exonic
1097194452 12:57235915-57235937 GTACCCCTGCCTCCTGCCCTGGG + Intronic
1097710620 12:62913539-62913561 CAGCTCCTGACTCATGTCCTGGG + Intronic
1097790435 12:63809802-63809824 CAGGCCCTGCCTCCAACACTGGG + Intergenic
1098487781 12:71041491-71041513 CAGCCTCTGCCTCCAGCATTGGG + Intergenic
1099543252 12:83941791-83941813 CAGGCCCTGCCTTCAACCCTAGG + Intergenic
1100489264 12:95063318-95063340 AAACACCTCCCTCCTGCCCTGGG - Intronic
1100523423 12:95398467-95398489 CAGCCTCTGCCACCTGCACTTGG + Intergenic
1100774022 12:97954976-97954998 CAGGCCCAGTCTCTTGCCCTAGG + Intergenic
1101277750 12:103220808-103220830 CTTCCCCTCTCTCCTGCCCTTGG - Intergenic
1101957292 12:109222736-109222758 GAGCCTCTGCCTTCTGCCCTGGG + Intronic
1102029040 12:109729470-109729492 CAGGCCCTGCCTCCTGCCTCTGG - Intronic
1102243709 12:111341856-111341878 CAGCCCCTGCCTGCAGCCCCAGG + Exonic
1102355779 12:112234228-112234250 CTTCCCCTGCCTCCTGAACTTGG + Intronic
1102389332 12:112536901-112536923 CAGCCTCTGCCTCCAGCACTTGG - Intergenic
1102504371 12:113374452-113374474 CTGCCCCCGCCCCCTCCCCTAGG + Exonic
1102678853 12:114676564-114676586 CACACCCTGCCTGCTGCCCAGGG + Intronic
1102750944 12:115293697-115293719 TCTCCCCTGCCTCCAGCCCTTGG - Intergenic
1102795212 12:115683387-115683409 AAGCCCCTGCGGCCTGTCCTGGG + Intergenic
1102998386 12:117366625-117366647 CAGACCCTGCATCCTGAACTGGG - Intronic
1103533705 12:121620315-121620337 CCATCCCTGCCTCCTGCCCCAGG - Intergenic
1103700394 12:122846173-122846195 CAGCCCCTGCCTCCTGCCCTGGG + Intronic
1103725183 12:122994308-122994330 CAGTCCCTGCCCTGTGCCCTGGG - Intronic
1103900732 12:124302551-124302573 CTGCCCCGGCCCCCTGCCCCAGG + Intronic
1104468403 12:129008446-129008468 CAGGCCCCGCCTCCAACCCTGGG - Intergenic
1104944284 12:132408786-132408808 CAGGCCCTGCCTGCTCCCCTGGG - Intergenic
1104949659 12:132433735-132433757 CAGCGCCTGCCTGGGGCCCTGGG - Intergenic
1104989822 12:132619093-132619115 CAGCCCCTGCCCCGCGCCCCCGG - Intronic
1104989838 12:132619125-132619147 CAGCCCCTGCCCCGCGCCCCCGG - Intronic
1104989889 12:132619243-132619265 CAGCCCCTGCCCCGCGCCCCTGG - Intronic
1104989905 12:132619275-132619297 CAGCCCCTGCCCCGCGCCCCCGG - Intronic
1105209600 13:18250069-18250091 CAGACCATGCCTCTAGCCCTTGG + Intergenic
1105384913 13:19920662-19920684 CAGCCCCTTCCTCTTTCCCTAGG - Intergenic
1105546242 13:21352916-21352938 CAGCCTCATCCTCCTGCCCCTGG + Intergenic
1105580817 13:21693891-21693913 CTGCCCCTCCCTGCTGCACTGGG + Intronic
1105596818 13:21846847-21846869 CAGTGCCTGCCTGCTGCTCTGGG + Intergenic
1105812715 13:24008924-24008946 CAGCCCCCACCTCCCGCACTTGG - Intronic
1105988256 13:25590845-25590867 CTCCCCCTGCCTCCTGCCCTTGG - Intronic
1106522608 13:30511276-30511298 CAGGCCCTGCCTCCAGCGTTGGG - Intronic
1107291302 13:38857377-38857399 CAGGCAGTGCCTTCTGCCCTTGG + Intronic
1107318038 13:39155247-39155269 CAGCCCTTTCCTCCTCCCTTGGG + Intergenic
1107787689 13:43971351-43971373 CAGCTCCTGAGTCCAGCCCTAGG - Intergenic
1108165792 13:47691931-47691953 CAGGCCTTACCTCCTGCACTGGG - Intergenic
1111348363 13:86994209-86994231 CATCTCCTGCCTCCTGCCACTGG - Intergenic
1111653653 13:91126052-91126074 CTACCCCTGCCTCCAGCCCTTGG + Intergenic
1112771558 13:102799526-102799548 CGGCCCCTGCCCCCCGCCCCGGG - Intronic
1113499936 13:110765286-110765308 CAGGCCCTGCCTCCAACACTGGG - Intergenic
1113523011 13:110953910-110953932 GCACCCCCGCCTCCTGCCCTGGG + Intergenic
1113574990 13:111389056-111389078 CACCCCCTGCGTCCTTCCCCTGG - Intergenic
1113619468 13:111703117-111703139 CATCGCTTGCCTCCTGGCCTTGG + Intergenic
1113624997 13:111788378-111788400 CATCGCTTGCCTCCTGGCCTTGG + Intergenic
1113702358 13:112396899-112396921 GCACCCCCGCCTCCTGCCCTGGG - Intronic
1114080310 14:19197986-19198008 CAGCCCTGGCCTCATTCCCTTGG + Intergenic
1114415302 14:22538893-22538915 CAGCCCCTGGCTCCCGCCCCTGG + Intergenic
1115374073 14:32653327-32653349 CAGGCCCTGCCTCCAGCATTGGG - Intronic
1115795766 14:36933708-36933730 CAGCCCCCTCCTCCAGCCCCAGG + Intronic
1116946499 14:50840281-50840303 CATCCCCTGCCTCCAGCCAGTGG - Intergenic
1117028590 14:51646934-51646956 CAGACCCTGCCCCTTGCTCTTGG - Intronic
1117557099 14:56896754-56896776 CAACCTCTGCCTCCTGGGCTTGG - Intergenic
1117675477 14:58151480-58151502 CAGCCCCTGACTCGTCCCCCAGG - Intronic
1118009174 14:61592070-61592092 CAGCCCCTCCCTCCAGGCCTGGG + Intronic
1118185576 14:63534698-63534720 CAGCCTCAGCCTCCTGGGCTCGG + Intronic
1118453909 14:65928483-65928505 CGGCCCCCACCCCCTGCCCTGGG + Intergenic
1118768576 14:68926761-68926783 CAATCCCTTCCTCCTGCCCTGGG + Intronic
1118836135 14:69479324-69479346 CAGCTCCTACCTCCTGACTTTGG - Intergenic
1118884141 14:69852635-69852657 CTGCAACTCCCTCCTGCCCTGGG + Intergenic
1119252494 14:73168770-73168792 CAGCCCCTGCCCTCTCCTCTTGG - Intronic
1119383645 14:74243926-74243948 CAGCCCTTGCCTGGTCCCCTGGG - Intronic
1120571958 14:86129677-86129699 GAGCCTGTGCTTCCTGCCCTTGG - Intergenic
1120720689 14:87887327-87887349 CAGCCCCTGCTTCCAGCCCTTGG + Intronic
1120866503 14:89299733-89299755 CAGCCACTCCCTCCTTCCTTTGG + Intronic
1120985459 14:90330967-90330989 GTGCCGCTGCATCCTGCCCTGGG - Intronic
1121582044 14:95038904-95038926 CTGCCCCTGCCTTGTCCCCTGGG + Intergenic
1121680300 14:95788002-95788024 CATCATCTGCCTCCTGCCCTGGG + Intergenic
1121871485 14:97412079-97412101 CTGCCCCCACCTCCGGCCCTGGG + Intergenic
1122105068 14:99446806-99446828 CAGCATCTGCATCCTGCCCTCGG - Intronic
1122155569 14:99748222-99748244 CAGCCCCTGCCCGCAGCCCCAGG + Intronic
1122200192 14:100117824-100117846 CAGCCACTGTTTCCTGCTCTGGG + Intronic
1122290600 14:100678512-100678534 CAGCCGCTGTTTCCTGGCCTGGG - Intergenic
1122388471 14:101364687-101364709 CTCCGCCTGGCTCCTGCCCTGGG + Intergenic
1122535545 14:102459455-102459477 CATCTTCTGCCTCATGCCCTGGG - Intronic
1122605530 14:102945211-102945233 GGGCCCCTGCCCCCTGCCCATGG + Intronic
1122722149 14:103728176-103728198 CAGCACCTTCCTCCTTCCCCCGG + Intronic
1122843797 14:104479702-104479724 CCCCACCTGCCCCCTGCCCTGGG + Intronic
1122874504 14:104657433-104657455 CAGCCCCTGCCTCTTGACGAGGG - Intergenic
1122935576 14:104954505-104954527 CCGGCCCTGCCTTCTGCTCTTGG + Exonic
1122972679 14:105158756-105158778 CAGCCCCAGCCCCCTCCTCTGGG - Intronic
1123783580 15:23647486-23647508 ATGACCCAGCCTCCTGCCCTAGG - Exonic
1123818713 15:24004980-24005002 CACTCTCTACCTCCTGCCCTTGG - Intergenic
1123837835 15:24213985-24214007 CACTCTCTGCCTCCTGCCCTTGG - Intergenic
1123847366 15:24316284-24316306 CACTCTCTGCCTCCTGCCCTTGG - Intergenic
1123866360 15:24523353-24523375 CACTCTCTGCCTCCTGCCCTTGG - Intergenic
1123873345 15:24598338-24598360 CATTCTCTGCCTCCTGCCCTTGG - Intergenic
1123977828 15:25569722-25569744 GAGCATCTGCCTCCTGCCTTTGG + Intergenic
1124118399 15:26867872-26867894 CAGCGCCTTCCTCCTGGGCTGGG - Intronic
1124526795 15:30461702-30461724 GAGCCACTGCGCCCTGCCCTGGG - Intergenic
1124657753 15:31522951-31522973 CGGGCCCTGCATCCTGCTCTGGG - Intronic
1124771859 15:32545981-32546003 GAGCCACTGCGCCCTGCCCTGGG + Intergenic
1125600962 15:40915630-40915652 CAACCCCCGCCCCCTGCCCCTGG + Intergenic
1125981493 15:44005808-44005830 CAGGCCCTACCTCCAGCACTGGG + Intronic
1126142815 15:45451493-45451515 TAGTCCCTGCCTCCTGGCCCTGG - Intergenic
1126350670 15:47742066-47742088 CAGCTGAGGCCTCCTGCCCTTGG - Intronic
1126691064 15:51289406-51289428 CTGCCCCTGACTCCTGCTCCAGG + Intronic
1126914716 15:53453084-53453106 CAGCCACTGCCCACTGCCCAGGG + Intergenic
1127601451 15:60541549-60541571 CAGCTCCTGCCACTTCCCCTTGG - Intronic
1127995992 15:64153350-64153372 CAGCCCCTGGCCCCCGCCATCGG - Intronic
1128357159 15:66936258-66936280 CAGCCTCTGCTTCCTTCTCTGGG + Intergenic
1128470594 15:67948862-67948884 CAACCCCTGCCTCCTGGGTTCGG + Intergenic
1128610733 15:69071132-69071154 CAGCCCCCGCCTCCAACACTGGG + Intergenic
1128983107 15:72200513-72200535 CAGCCCAGGCCTCCTGGACTGGG + Exonic
1129167627 15:73787734-73787756 GCGGCTCTGCCTCCTGCCCTAGG + Intergenic
1129228657 15:74184444-74184466 CTGCCCCTTCCACCTGCCCTGGG + Intronic
1129333175 15:74838164-74838186 CAGCTCCCGCCTCCGGCCCGGGG + Exonic
1129394712 15:75237544-75237566 CAGCCCCCTCCTCCTGCCCCAGG - Intergenic
1129470289 15:75750013-75750035 CCTCCCCTGCATCCAGCCCTGGG + Intergenic
1129734726 15:77953102-77953124 CCGCCCCTGCATCCAGCCCTGGG - Intergenic
1129840864 15:78742889-78742911 CCGCCCCTGCATCCAGCCCTGGG + Intergenic
1129921386 15:79322212-79322234 TAGCCCCGGCATCCTGCTCTAGG + Exonic
1129945393 15:79535128-79535150 TAGGCCATGCCCCCTGCCCTGGG + Intergenic
1130040721 15:80403996-80404018 CCGCCCTGGCCTCCTGGCCTGGG + Intergenic
1130115471 15:81001599-81001621 CATCTCCTGCCTCCAGCTCTTGG - Exonic
1130552007 15:84895248-84895270 CACCCACTGGCTCCTGCCCTGGG - Intronic
1131798347 15:96043775-96043797 CACCCCATGCCTCCCTCCCTCGG - Intergenic
1131830527 15:96352111-96352133 CCGCGCCTGGCCCCTGCCCTGGG + Intergenic
1131838808 15:96415575-96415597 AAGCCCCTGCCCTCTTCCCTCGG - Intergenic
1132066235 15:98733293-98733315 CAGCCTCAGCCTCCTGCCTCTGG + Intronic
1132115248 15:99131242-99131264 CAGCTCCTCCCTCATGCGCTCGG - Exonic
1132206905 15:99992698-99992720 AGGCCCCAGCCTCCTGCCATGGG - Intronic
1132226950 15:100150301-100150323 CATCCCCTGCCTCCTCTCTTTGG + Intronic
1132342689 15:101088228-101088250 CAACCCCACCCTCCTGACCTTGG + Intergenic
1132498458 16:274656-274678 CAGCCCCTCCCTCAGGACCTGGG + Intronic
1132534518 16:471453-471475 CAGCTCGTGCCTCCTGCCTCCGG + Intronic
1132560565 16:591396-591418 CAGCACCTGCCACCAGACCTGGG - Intronic
1132585024 16:702347-702369 TCGCCCCTGCCTCCTGCTCCGGG + Intronic
1132604610 16:788479-788501 CAGCCCCCGCGTCCTGTCCTGGG - Intergenic
1132607387 16:799295-799317 CAGCTCCCGCCTCCTGCACTGGG + Intronic
1132654917 16:1037733-1037755 CAGCCTCTGCCTCCTGACCTGGG + Intergenic
1132661668 16:1064290-1064312 CACAGCCTGCCTCCCGCCCTGGG + Intergenic
1132742342 16:1421093-1421115 CAGCCCTGCCCGCCTGCCCTGGG + Intergenic
1132800003 16:1747306-1747328 CAAGCCCTGCCTCCTGCCCGAGG - Intronic
1132880399 16:2159543-2159565 CAGCCCCTGCCTCAGCCCCCTGG - Intronic
1132959082 16:2612314-2612336 CAGGCCCTGCCTCCTGGGCTTGG - Intergenic
1132972142 16:2694289-2694311 CAGGCCCTGCCTCCTGGGCTTGG - Intronic
1133039122 16:3050460-3050482 TAGCCCATGCCTTCTTCCCTGGG + Exonic
1133072257 16:3254420-3254442 CAGCCCCTGCAGCCTCCCCGCGG + Exonic
1133166225 16:3949554-3949576 CAGCCCCTTCCTCCCGCCCTTGG + Intergenic
1133191952 16:4140347-4140369 CAGACCCTACCTCCAGCACTGGG - Intergenic
1133236370 16:4389159-4389181 CAGGCCCTGCCTCTTGCCTGGGG - Intronic
1133287144 16:4695896-4695918 CAGCTCAGGCCCCCTGCCCTAGG + Intergenic
1133299990 16:4776551-4776573 CAGCCCCTTACTCCTGGCCCGGG - Intergenic
1133346329 16:5073062-5073084 CACCCCCTGCCCCCAGCCCATGG - Intronic
1133657445 16:7879616-7879638 CAGCATTTTCCTCCTGCCCTTGG + Intergenic
1133755827 16:8761685-8761707 GTGCCCCGGCCTACTGCCCTGGG - Intronic
1133776815 16:8903070-8903092 GAGCCCCTGACTCCTGCACAGGG - Intronic
1133933770 16:10252633-10252655 CGGACCCTGCCTGCTCCCCTCGG + Intergenic
1134135157 16:11672724-11672746 CTGCCCATGCCTCCTGGCCTGGG + Intronic
1134229680 16:12419217-12419239 CAACCCCTACCACCAGCCCTCGG - Intronic
1135526191 16:23215344-23215366 TTGCACCTGCCTCCAGCCCTAGG + Exonic
1136012301 16:27371795-27371817 CACCTCCTGCCTGCTTCCCTGGG + Intergenic
1136033840 16:27523554-27523576 CATCCCTTGCCTCCTGCGCACGG + Intronic
1136060143 16:27720853-27720875 CAGCCCCAGCCGCCTCCTCTTGG - Intronic
1136355795 16:29744376-29744398 TGGCCGCTGCCTCCTGGCCTGGG + Exonic
1136377189 16:29872576-29872598 CTCTCCCAGCCTCCTGCCCTGGG + Intronic
1136537080 16:30906197-30906219 AAGCCACAGCCTCCAGCCCTGGG + Intergenic
1138387214 16:56643814-56643836 ATGCACCTGCCTCCTGCCCCAGG - Intronic
1138457711 16:57130932-57130954 GAGCCCCCGCCTCCTGCCCCAGG - Intronic
1138575736 16:57906355-57906377 CAGCCACTGTTGCCTGCCCTGGG + Intronic
1138681131 16:58684410-58684432 CCGCCCCGGCCTCCTGGCCCGGG - Exonic
1139482218 16:67236841-67236863 CAGCCCCCACCTCCTCCACTGGG - Intronic
1140528984 16:75648044-75648066 CGGCCCCGGGCTCCTGCACTCGG - Exonic
1141173519 16:81705129-81705151 CAGTCCCTGCAGCCTGCCCCCGG + Intronic
1141431581 16:83973015-83973037 CTTGCCCTGCCTCCTTCCCTGGG + Intronic
1141519659 16:84569806-84569828 CTGCCCCTCCCTCATGCCGTGGG - Intronic
1141666148 16:85466351-85466373 CAGCCCCTGCCCACTCCCCAGGG - Intergenic
1141792097 16:86243820-86243842 CAGCCACTGCCTGCTGGGCTGGG + Intergenic
1141799292 16:86296197-86296219 AAGCCCCTGCCTGCTGGCCAAGG + Intergenic
1141839481 16:86565727-86565749 CTGTCCCTGCCTCCTGCTCCTGG - Intergenic
1141852545 16:86657273-86657295 CAGCCTCAGCCTCCTGGGCTCGG + Intergenic
1141920382 16:87131849-87131871 CAGCCTCTGCAGCCTGACCTCGG - Intronic
1141951559 16:87343136-87343158 GTGCCACTGCCTCCTGCTCTTGG - Intronic
1141982657 16:87560068-87560090 CAGCCCCTGTCTCCTCTTCTGGG + Intergenic
1141988976 16:87599423-87599445 CAGCTTCTGCCTCATGCTCTTGG - Intergenic
1142078017 16:88131690-88131712 CAGCCCCTGCCTTCTGCGAGCGG - Intergenic
1142527857 17:557254-557276 CAGCCTCTGCCTCCTTCTCACGG + Intronic
1142674712 17:1506685-1506707 GAGCAGCTGCCTCCTGACCTAGG - Intronic
1142737103 17:1907968-1907990 CAGGCTCTGCCTCCCGCCCCTGG - Intergenic
1143010168 17:3861872-3861894 CTGCCTCTGCCTCCTGCCCCAGG + Intronic
1143029793 17:3961542-3961564 CAGCCGCTGCCTCCCTCCCCTGG + Intronic
1143095256 17:4475410-4475432 CTGCCTCTTCCTCCTGCCCATGG - Intronic
1143120886 17:4606060-4606082 GGCCCTCTGCCTCCTGCCCTGGG - Intronic
1143893266 17:10118364-10118386 CAGCCTCTCCGGCCTGCCCTGGG + Intronic
1144099933 17:11934178-11934200 CAGCCCCTGCCTGCAGCCCATGG - Intronic
1144240360 17:13304759-13304781 CAGCCTCTGCTTTCTGCCCCTGG + Intergenic
1144326871 17:14190815-14190837 CAGGCCCTCTCTCCTGCCATAGG + Intronic
1144475753 17:15587678-15587700 CAGGCCCTCTCTCCTGCCATAGG + Intronic
1144672320 17:17139837-17139859 CAGCCCCTGCCTAGTGCCCCAGG + Intronic
1144762754 17:17716746-17716768 AGGCCCCTCCATCCTGCCCTGGG - Intronic
1144837260 17:18163169-18163191 CAGCCCTTGTCTCCTGCCCTGGG - Intronic
1144943986 17:18960481-18960503 CAGGCCCTGCCTGGAGCCCTGGG + Intronic
1144949381 17:18985750-18985772 CAGACTCTGCCACCTTCCCTGGG + Intronic
1144952392 17:19001246-19001268 AAGCCCCTGCTTTCTGCCCTGGG - Intronic
1145848703 17:28069073-28069095 CATCCCCCTCCCCCTGCCCTAGG + Intronic
1145905030 17:28511558-28511580 GTGCCCCTGCCTCCTCCCCTGGG - Intronic
1146038416 17:29428702-29428724 CAGCCTCTACCTCCTGAGCTTGG + Intronic
1146047597 17:29522788-29522810 GAGCCACTGCACCCTGCCCTTGG - Intronic
1146266835 17:31458420-31458442 CAGCCCCTTCCTGCTGCTTTTGG + Intronic
1146284062 17:31562503-31562525 GAGCCCCTGGCTGCTTCCCTGGG + Intergenic
1146375750 17:32293158-32293180 CACCCCCTCCCTCCAGCCCCTGG - Intronic
1146422109 17:32697092-32697114 CAGTCACTGCCTACTACCCTAGG + Intronic
1146455115 17:33003896-33003918 CACCCCCTGCCCCATGCCCCCGG + Intergenic
1147160320 17:38565879-38565901 CGGCCCCTCCCTACTGCCCCTGG - Intronic
1147317529 17:39627896-39627918 CAGCCTCATACTCCTGCCCTGGG - Intronic
1147466587 17:40615622-40615644 CAGCCCTTCCCTCCAGCCCCAGG - Intergenic
1147668108 17:42161467-42161489 CAGCCTCTGCCTCCTCCCCAAGG - Intronic
1147947100 17:44086485-44086507 CAGCCTCTTCCCCCTGCCATGGG + Intronic
1147977199 17:44254691-44254713 CTTCCCCATCCTCCTGCCCTTGG - Intronic
1148087134 17:45001096-45001118 TAGAGTCTGCCTCCTGCCCTAGG + Intergenic
1148249956 17:46068486-46068508 CAGCCTCTGCCTCCTGGCTCAGG - Intronic
1148342422 17:46881225-46881247 CCACCTCTGCCTCCCGCCCTGGG - Intronic
1148480369 17:47956082-47956104 CAGCCCTTGTGCCCTGCCCTGGG + Intronic
1148872528 17:50667282-50667304 CATCCTCTGTCCCCTGCCCTGGG - Intronic
1148926550 17:51091190-51091212 CAACCTCTGCCTCCTGGGCTTGG - Intronic
1148931155 17:51128397-51128419 CAGTCCCTGCCTCCTACCTCAGG + Intergenic
1149577432 17:57724257-57724279 CAGCCCCTGCCTCCCGGTCCAGG + Intergenic
1149655188 17:58306134-58306156 CATCCCCTGCCTCCCCCCATGGG - Intronic
1149995817 17:61405469-61405491 CAGGCCCTGCTCCTTGCCCTCGG - Exonic
1150125069 17:62629927-62629949 CTGCCCCTGCCCCGTGCTCTGGG - Intronic
1150425939 17:65077142-65077164 CAGCTCCTGTCTCCTACTCTGGG + Intergenic
1150632660 17:66890869-66890891 CAGCCCCTGCCTCCTGATGGAGG + Intergenic
1151002902 17:70399286-70399308 CAGCCCCAGCTGCCTGCCTTTGG - Intergenic
1151227576 17:72658249-72658271 CTGCCCCTGCATCCAGCCCACGG - Intronic
1151242711 17:72770578-72770600 CAGCTCCTGCTCCCTCCCCTTGG + Intronic
1151269039 17:72978864-72978886 AAGGCCCTGCCTTCAGCCCTGGG + Intronic
1151326013 17:73380171-73380193 CTGCCCCTGCTTCCTTCCCCTGG + Intronic
1151391704 17:73791576-73791598 CAGCACCTTCCTCCACCCCTGGG + Intergenic
1151509475 17:74549509-74549531 CAGCCCCTACGTCCTGCTCCTGG - Intergenic
1151747858 17:76021439-76021461 CCGCCCCTGCCGCCTGCCCGAGG + Intronic
1151785407 17:76272660-76272682 CTGCCTCTGCCTCCTGCCCGGGG + Intergenic
1151884860 17:76917600-76917622 CAGCCCCTGCATCCTGGATTCGG - Intronic
1152071909 17:78138264-78138286 CTGCTCCTGCCCCCTTCCCTGGG + Intronic
1152126522 17:78450536-78450558 CAGACCCCTTCTCCTGCCCTGGG + Intronic
1152128914 17:78464543-78464565 GAGCCACTGCCCCCAGCCCTCGG + Intronic
1152235610 17:79136751-79136773 CTGGCACTGCCGCCTGCCCTGGG - Intronic
1152484874 17:80583948-80583970 CACCCTCTGCCTCCTGTCCTCGG + Intronic
1152537247 17:80957834-80957856 CAGGCCCTGACTCCACCCCTGGG - Intronic
1152580297 17:81162786-81162808 CACGCCCTGTCTCCTGCCCAAGG - Intronic
1152598848 17:81251424-81251446 CAGCCCCCTCCCCCAGCCCTGGG - Intronic
1152605125 17:81285739-81285761 CAGCCCCAGCTTCCTGCCCCTGG + Intronic
1152678448 17:81653486-81653508 CAGCCCCTGCAATCCGCCCTGGG + Intronic
1153545766 18:6203637-6203659 CAGCCAGTCCCTCCTGCCCTAGG + Intronic
1153582832 18:6592544-6592566 CATCCCTTGCTTTCTGCCCTTGG - Intergenic
1153771730 18:8422197-8422219 CAGGCCCCACCTCCAGCCCTGGG - Intergenic
1153939354 18:9964550-9964572 CAGTCCCTGCCTCCTCCTTTGGG + Intergenic
1154216620 18:12420683-12420705 CAGCCCGTGCCCCCTGATCTCGG - Intronic
1155021887 18:21904021-21904043 CGGGGCCTGCCTCCTGCCTTTGG + Intergenic
1155588914 18:27402057-27402079 CTGGGCCTGCCTCATGCCCTTGG + Intergenic
1157198146 18:45636888-45636910 CATCCACTGCCTCCTCTCCTAGG - Intronic
1157257635 18:46153004-46153026 CACCCGCTGCCGCCTGCCCCAGG + Intergenic
1157339903 18:46769574-46769596 CCGACCCTGCCTCTGGCCCTGGG - Intergenic
1157440287 18:47706286-47706308 CAGGCCCTGCCTCCAGCACTGGG + Intergenic
1157602536 18:48902759-48902781 GAGCCCATGCCTCCTGCCCATGG + Intergenic
1157653514 18:49361799-49361821 CAACCTCTGCCTCCCGACCTTGG + Intronic
1158496178 18:57956962-57956984 CAGCCCCTGCCTCTTTGCCTGGG - Intergenic
1158688123 18:59633067-59633089 CAGCCTCCTCCTCCTTCCCTGGG + Intronic
1159516543 18:69466170-69466192 CCGCCCCTCCCTCCAGCCCTTGG + Intronic
1159560468 18:69987272-69987294 CAGCCCCTGGCTTCTCCCTTAGG + Intergenic
1159714422 18:71804223-71804245 CAGGCCCCGCCTCCTGCACTGGG + Intergenic
1159955163 18:74513780-74513802 CAGGCCCTGTCACCTTCCCTGGG + Intronic
1160010819 18:75106021-75106043 CAGCCCCTGCCACCTGCCACAGG + Intergenic
1160012603 18:75117159-75117181 GGGTCCCTGCTTCCTGCCCTGGG + Intergenic
1160013241 18:75122565-75122587 CAGCTTCTCCCTCCTGCCCTCGG - Intergenic
1160186592 18:76680908-76680930 CAGAATCTGCCTCCTGCACTGGG - Intergenic
1160201843 18:76802259-76802281 CAGCCCCAGCCTCCTACCCTGGG - Intronic
1160236366 18:77089231-77089253 CAGGCCCTGTCTCCCTCCCTCGG + Intronic
1160291962 18:77603097-77603119 CAGGCCCTACCTCCGGCTCTGGG + Intergenic
1160562908 18:79770736-79770758 CAGACGCTGCCTCATGCCCCCGG - Intergenic
1160667736 19:340958-340980 CATCTCACGCCTCCTGCCCTGGG + Intronic
1160681936 19:415830-415852 CAGGCCCTACCCCCTGCCCTGGG - Intergenic
1160836768 19:1128286-1128308 CCGCCCCTGCCTCCGGCACAGGG - Intronic
1160844121 19:1159186-1159208 CAGCCCCCGCCCCCTGCACCCGG - Intronic
1160896952 19:1407604-1407626 CGGCGGCTGCCTCCTCCCCTCGG - Exonic
1160941419 19:1622025-1622047 CACCCCCTGCCCCCTGCCCTGGG + Intronic
1160973361 19:1780197-1780219 CAGCCTCGGCCTCCCTCCCTGGG + Exonic
1161038791 19:2099193-2099215 CACCCCCTGCCTCCCTCCCTGGG - Intronic
1161065650 19:2236102-2236124 CGGCCCCGGCCTCCCGCCCCTGG + Intronic
1161207980 19:3051801-3051823 CAGCCTCAGCCTCCTGAGCTGGG - Intergenic
1161209232 19:3057571-3057593 CAACCCCGGCCACCTCCCCTGGG - Intronic
1161277413 19:3426483-3426505 TAGCCCCCAGCTCCTGCCCTTGG + Intronic
1161492563 19:4570290-4570312 CAGCCCCTCCCTGCAGACCTTGG + Intergenic
1161925787 19:7298450-7298472 CAGCCTCTACCTCCTGATCTCGG + Intergenic
1161997751 19:7724399-7724421 CAGCCCCCACCTCCAGCACTGGG + Intergenic
1162048300 19:8016178-8016200 GAGCCCCAGCCACCTGCCCCCGG - Intronic
1162061428 19:8097969-8097991 TAGCCCCTCCCTTCTGCCCCTGG - Intronic
1162110286 19:8396380-8396402 CAGGACCTGATTCCTGCCCTTGG + Intronic
1162199281 19:9009253-9009275 AAGCCCCAACTTCCTGCCCTCGG + Intergenic
1162386366 19:10362521-10362543 CAGCCCCAGCCCCCAGCCCTGGG + Intronic
1162500284 19:11049563-11049585 CAACCTCTGCCTCCCTCCCTGGG + Intronic
1162537962 19:11275311-11275333 CAGCCCCTCCCCCGAGCCCTAGG - Intergenic
1162607982 19:11726160-11726182 CAGCCCCAACCTCCTGCGCTTGG - Intronic
1162818503 19:13209616-13209638 CATCCCCTGGCCCCTGCCCCAGG - Intronic
1162890647 19:13730761-13730783 CAGCCCCATTCTCATGCCCTCGG + Intergenic
1162937137 19:13986903-13986925 GACCCTCTGCCTCCTGCCCCTGG + Intronic
1163018946 19:14472645-14472667 CCGCCCTTGGCTCCGGCCCTCGG + Exonic
1163296358 19:16415414-16415436 CAGACCCTGCCTCCTGCCCAGGG + Intronic
1163411928 19:17160319-17160341 CAGCCCCTGCCTGGTGCCTTTGG - Intronic
1163536037 19:17877090-17877112 CAGCCAATGCCTCCTGCTCCAGG + Intronic
1163593006 19:18204759-18204781 CAGCCCCTTCCTCCTTTTCTGGG - Intergenic
1163598811 19:18235747-18235769 CAGCTCCTGCCTACTTCCCGGGG + Intronic
1163644209 19:18479124-18479146 CAGACATTGCCTCGTGCCCTGGG - Intronic
1163692953 19:18746967-18746989 CAGCCGGGGCTTCCTGCCCTGGG + Intronic
1164451830 19:28372685-28372707 CAGCCCCTGCCTCCAAACCCAGG - Intergenic
1164647758 19:29872315-29872337 CAGCCCCTGCTCCCCGCCCGCGG + Intergenic
1165055671 19:33174806-33174828 CAGCTCATGTCTCCTGCCATGGG - Intronic
1165075737 19:33278992-33279014 CACATCCTGCCTCCTGCCCTGGG - Intergenic
1165264617 19:34649793-34649815 CAGACCCAGCCTGATGCCCTTGG + Intronic
1165360247 19:35332052-35332074 CGGCCCCTGGCTCCTGCTCCTGG + Exonic
1165363352 19:35350201-35350223 CCGCTCCTTCCTCCAGCCCTGGG + Intergenic
1165369898 19:35398580-35398602 CTGCCCCTGCCTCATTCCCACGG + Intergenic
1165476236 19:36032568-36032590 CAGCGCCTGCCACCTCCCCCAGG + Intronic
1165855650 19:38878175-38878197 CAGCCCCTGCTGCCTCCCTTTGG - Intronic
1165894546 19:39133735-39133757 CTGCTCCTGCCACCTGTCCTGGG + Intronic
1166049834 19:40252125-40252147 CAACCCCTGCCTCCCTCCCCAGG + Intronic
1166054016 19:40277942-40277964 CACCCCCTCCCCACTGCCCTAGG - Intronic
1166499714 19:43331536-43331558 CCGCCCCTGCCCCTGGCCCTAGG - Intergenic
1166750371 19:45161659-45161681 AAGGCTCTGTCTCCTGCCCTCGG + Intronic
1166836659 19:45671348-45671370 CTGCCCGTGCGTCCTGCCCCTGG + Exonic
1166939838 19:46355922-46355944 CAGCCCCTGCTCCTTACCCTGGG - Intronic
1167078837 19:47265488-47265510 CTGCCCCTGCCTCCTCTTCTAGG - Intronic
1167103695 19:47418925-47418947 CTGCCCCTCCCTCCGCCCCTGGG - Intronic
1167175406 19:47860917-47860939 TAGCCGCTGCCTCCTTCCCTGGG + Intergenic
1167367287 19:49061525-49061547 CAGCCCCCTCCACCTGCCCCCGG + Exonic
1167409019 19:49334097-49334119 CAGCCCCTGCCCCCAGCACCTGG + Intergenic
1167548535 19:50143865-50143887 CTGCCTCTGCCTCCTGCCCCTGG + Intergenic
1167600262 19:50450942-50450964 ATGCCCCTTCCTCCTTCCCTGGG + Intronic
1167688012 19:50968670-50968692 CGGCCCCTGCGTCCTCCGCTTGG - Exonic
1168200694 19:54813329-54813351 CTGCCTCTGGCTCCTGCCTTGGG - Intronic
1168337451 19:55604666-55604688 AAGCCCCGGCCCCCGGCCCTCGG - Intergenic
1168339174 19:55613988-55614010 CCGCCCCTGCCGCCCGCCTTCGG + Exonic
1168385863 19:55962697-55962719 CAACCTCTGCCTCCTGGGCTCGG - Intronic
1168386638 19:55968851-55968873 CAGCTCCTGACCACTGCCCTGGG + Intronic
1168445033 19:56404312-56404334 CGGCCCCTGCGGCCTGCCCTAGG + Exonic
925010711 2:483795-483817 CAGGCCCTGCCTCCAACACTGGG + Intergenic
925034535 2:675705-675727 AGGCCCCTGCCTCCTGCGCTGGG - Intronic
925087194 2:1117499-1117521 CAGGCACGGCCTCCTGCCCCTGG + Intronic
925123288 2:1436494-1436516 GAGCCCCTGGTTCCTGTCCTTGG + Intronic
925155903 2:1648857-1648879 CATCCCCTGCTTCCTGGCCGGGG - Exonic
925160191 2:1678069-1678091 CCGCCCCAGCCTCCTGACCCGGG - Intronic
925371201 2:3346921-3346943 CAGGCCCTGCCTCCAGCACTGGG - Intronic
925406178 2:3606587-3606609 CAGCCCCTGCTCCTTGCTCTGGG + Intronic
925533937 2:4895361-4895383 CAGCCCCCGCCTCCAACACTGGG + Intergenic
926152524 2:10432883-10432905 CCTCCCCAGCCTCCTGCCCCAGG - Intergenic
926682390 2:15673933-15673955 CAACCACTGCCTCCTGCCCCAGG - Intergenic
926920664 2:17936942-17936964 CAGGCCCTGCCTCCAGCATTGGG - Intronic
927053673 2:19351746-19351768 CTGCTTCAGCCTCCTGCCCTAGG - Exonic
927464789 2:23328940-23328962 TGGCCCCTGCATCCTTCCCTGGG + Intergenic
927641808 2:24850137-24850159 GAGCCCCTGGCCCCTGCCCAGGG + Intronic
927725039 2:25415614-25415636 CAGCCCCTTCCACCAGGCCTTGG + Intronic
927846322 2:26474352-26474374 CAGCCCCAGCCCCCAGCCCCAGG + Intronic
927868125 2:26606027-26606049 CCGCGCCTCCCCCCTGCCCTTGG - Intronic
928692757 2:33817649-33817671 CAGGCCCTGCCTCCAACACTGGG + Intergenic
929218025 2:39436803-39436825 GAGCCCTTGCCGCCTGTCCTCGG - Intronic
929325988 2:40611189-40611211 CAGGCCCCGCCTCCAACCCTGGG + Intergenic
929501491 2:42494276-42494298 CTGCTCCCGCGTCCTGCCCTGGG + Intergenic
929604832 2:43227110-43227132 GAGCCCCCGCCTCCTGGCCGGGG - Intergenic
930477517 2:51902202-51902224 CATCCCCTGCTTCCTGCACCTGG - Intergenic
931052348 2:58428587-58428609 CAGCCCCCTCCTCTTGCCCCCGG + Intergenic
932000139 2:67877521-67877543 GAGCCCCTCCCTCTTGGCCTTGG + Intergenic
932009703 2:67962810-67962832 CAGACCCTGCCTCCAACACTGGG + Intergenic
932232646 2:70095261-70095283 CAGCTTCTGCCTCCTGCCACAGG + Intergenic
932737028 2:74261394-74261416 CAGCCCCTGCCTGTGGCCTTGGG - Intronic
933093067 2:78145814-78145836 CAGCCCCAGCTTCATACCCTGGG - Intergenic
933212363 2:79585719-79585741 CAGCCCCTCCCTCCCTCCCCCGG + Intronic
933621852 2:84552190-84552212 CATGCCCTGCTTCCTGCCCTGGG - Intronic
933655166 2:84880988-84881010 GACCCTCTGCCTCCTGCCCACGG - Exonic
933717314 2:85370935-85370957 CAGCTTCTGCCTCCTTCCCTTGG + Intronic
933762738 2:85683912-85683934 CCACCCCTTCCTCCTTCCCTAGG - Intergenic
933803845 2:85983932-85983954 CAGCCTCTGCCCCCTCTCCTGGG + Intergenic
933833565 2:86229080-86229102 CAACCCCTGCCACCTGTCCAGGG + Intronic
934037046 2:88096902-88096924 CATGCCCTGCCTCCTCCCCAGGG - Intronic
934514730 2:94979603-94979625 TTTCACCTGCCTCCTGCCCTAGG - Intergenic
934653956 2:96107807-96107829 CACCCGCTTCCACCTGCCCTGGG + Intergenic
935006042 2:99077985-99078007 AAGCCGCTGCACCCTGCCCTAGG - Intronic
935379114 2:102432713-102432735 CTGCCTTTGCCTCCTGGCCTGGG + Intronic
935946313 2:108289703-108289725 CAGCACATGGTTCCTGCCCTTGG - Intronic
936151348 2:110023959-110023981 CAGCCCCTGCCTCTGCCCCAGGG - Intergenic
936193327 2:110347410-110347432 CAGCCCCTGCCTCTGCCCCAGGG + Intergenic
937119364 2:119431444-119431466 CTGCGCCTGCCTCCTCCCTTCGG + Intronic
937375336 2:121332431-121332453 CAGGCACTGCCTCCTGGCCTCGG - Intergenic
937859543 2:126697063-126697085 CAGCCTCTGCTTCCACCCCTGGG - Intergenic
938227514 2:129628495-129628517 CCAGCCCTGCCTCCAGCCCTGGG - Intergenic
938338033 2:130516600-130516622 CACCCTCTCCCTCCTACCCTAGG + Intergenic
938351805 2:130604138-130604160 CACCCTCTCCCTCCTACCCTAGG - Intergenic
940711436 2:157167141-157167163 CCTCCCATCCCTCCTGCCCTTGG + Intergenic
940789460 2:158016621-158016643 CAGCCACTGCACCCAGCCCTGGG + Intronic
940859103 2:158753931-158753953 CAGCCCTTTTCTCCTCCCCTTGG + Intergenic
940981355 2:160007341-160007363 CAGCCTCTGCCCCCAGACCTAGG + Intronic
942148474 2:173050551-173050573 CAGACCCTGGCTCCTGACCGGGG - Intronic
942450455 2:176105570-176105592 CAGCCAGCGCCGCCTGCCCTGGG + Intronic
942462610 2:176178645-176178667 CCAGCCCTGCCGCCTGCCCTCGG + Intergenic
942579963 2:177407637-177407659 CAGGCCCTACCTCCAGCCCCGGG + Intronic
942965764 2:181891611-181891633 CAGCCCCCGACTACTGCCCGCGG - Intergenic
943060038 2:183032966-183032988 CAGCCTCTGCCTCCTGGCTCAGG - Intronic
943753170 2:191531186-191531208 CAGGCCCTACCTCCAGCACTGGG + Intergenic
944445914 2:199788266-199788288 CAGCCCCTGCTTCATGCCAAGGG - Intronic
944490378 2:200252836-200252858 CAGCCAGTGCCTCCTAGCCTAGG + Intergenic
944636541 2:201680867-201680889 CAGACCCTGCTACCTGCGCTGGG - Exonic
944664963 2:201952254-201952276 CAGCGGCTGCCTCCTTCCCAGGG - Intergenic
944665488 2:201955768-201955790 CAGTTCCTGGCTACTGCCCTTGG - Intergenic
944768778 2:202891250-202891272 CAACCTCTGCCTCCTGGGCTGGG + Intronic
945172417 2:207010890-207010912 CACCTCCTGCCTCCTGCTGTGGG + Intergenic
946035820 2:216741273-216741295 GTGCCCCTTCTTCCTGCCCTAGG - Intergenic
946175500 2:217919815-217919837 CATCCCCCGCCTCCAGCCCCAGG + Intronic
946211043 2:218147747-218147769 CATGCCCTGCATCCTGCCCAGGG + Intergenic
946253566 2:218428114-218428136 CAGCCCCTGCCCTCCACCCTGGG - Intronic
946326488 2:218987066-218987088 CAGCTCTTACCTCCTGCCCCTGG - Intergenic
946572432 2:221039716-221039738 CAGCCCCTGCCTCCTCTACATGG - Intergenic
947512190 2:230766516-230766538 CAGGCCCTACCTCCAGCACTAGG + Intronic
947536604 2:230943634-230943656 CAGGCCCCGCCTCCAGCACTGGG - Intronic
947731733 2:232435063-232435085 GAGCTCCTTCCTCCTGCCCTGGG + Intergenic
947744619 2:232501219-232501241 GAGCCCCTTCCCCCTGCCCCTGG + Intergenic
948455157 2:238101422-238101444 CAGCTCCCGCCTGCTGCCCTTGG - Intronic
948566742 2:238892095-238892117 CAGCCACTCCCACCTGCCCTCGG + Intronic
948629551 2:239293334-239293356 CAGGGCCTGTCCCCTGCCCTCGG + Intronic
948822920 2:240559101-240559123 CAGCCTCTGTCTCCTGGACTTGG - Intronic
948863792 2:240765396-240765418 AAGCTCCTGCCTCCTGGCCCAGG - Intronic
948901380 2:240958421-240958443 CAGCCTGTGCCCCCTGCTCTTGG - Intronic
949041080 2:241850248-241850270 CAGCCCTGCCCTCCTGACCTTGG + Exonic
1168736637 20:145699-145721 CAGCCTCTGTCTCCTGCTCTAGG + Exonic
1168830830 20:844510-844532 CACCCCCTCCCTCCTGCCCCGGG - Intronic
1169367292 20:5001588-5001610 CCGCCCCCGACCCCTGCCCTCGG + Intronic
1169853892 20:10082662-10082684 CAGGCCCATCCTACTGCCCTGGG - Intergenic
1170101809 20:12709579-12709601 CCTCCCCTTCCTCCTGCCCTTGG + Intergenic
1170613157 20:17930040-17930062 CCTGCCCAGCCTCCTGCCCTTGG - Intergenic
1170697698 20:18674740-18674762 CTGCCCCTGCCTCTGCCCCTGGG + Intronic
1170745960 20:19099159-19099181 CAGCCACAGCCTGCTGCCTTCGG + Intergenic
1170955878 20:20978980-20979002 CAGCCCCTGCCCCACTCCCTGGG - Intergenic
1171016269 20:21544684-21544706 CAGGCCCTGCCTCCAGTACTGGG + Intergenic
1171290761 20:23981736-23981758 CAGACCATGCCTCTAGCCCTTGG + Intergenic
1171312399 20:24155162-24155184 CAGCCTCTGCCTGTGGCCCTGGG - Intergenic
1172106751 20:32521721-32521743 CAGCCCTTTCCTCTTGCTCTGGG + Intronic
1172163897 20:32887011-32887033 AAGCCCCTCTCTCCTGCCCAGGG - Intronic
1172270091 20:33650170-33650192 CACCCCCTGCTTCATGCCCTTGG - Intergenic
1172318026 20:33971521-33971543 CTTCCCCTTCCTGCTGCCCTAGG - Intergenic
1172596670 20:36154949-36154971 TAGGCCCAGCCTCCAGCCCTGGG + Intronic
1172754268 20:37272467-37272489 CAACCTCTGCCTCCTGGGCTTGG + Intergenic
1172766951 20:37356093-37356115 CAGCCCCTACCTTTTGCCCCAGG - Intronic
1173139351 20:40468577-40468599 CAGGCCCTGCCTCCAACACTGGG - Intergenic
1173458918 20:43226041-43226063 CAGCCCATCCTTCTTGCCCTGGG - Intergenic
1173595933 20:44258367-44258389 CTGCCCCGGCCACCTGCCCCCGG - Intronic
1173726044 20:45298438-45298460 CAGCCCCACCCGCGTGCCCTCGG + Exonic
1173846619 20:46192692-46192714 CAGCCCCTCCCTCCTCCCCGAGG + Intronic
1174169095 20:48605135-48605157 CAGCCCGTGCCTCCCTCCCCAGG - Intergenic
1174199890 20:48799796-48799818 CAGCCCCTGCCCCCTCACCCAGG - Intronic
1174282307 20:49448074-49448096 CTGACCCTGCCCCCTGCCCCAGG + Intronic
1175237485 20:57524912-57524934 CAGCGTCTGCCGCCCGCCCTTGG + Intronic
1175274855 20:57761299-57761321 AAGCTTCTGCCTCCAGCCCTGGG + Intergenic
1175727794 20:61331597-61331619 CTGCCCCGGCCACCTGCCCCAGG + Intronic
1175727815 20:61331646-61331668 CCGCCCCAGCCACCTGCCCCAGG + Intronic
1175772149 20:61630584-61630606 CAGCGCCTTCCTCCTCCTCTTGG + Intronic
1175908070 20:62391617-62391639 CTGCCCATGCGCCCTGCCCTGGG - Intronic
1175913491 20:62415351-62415373 TAGCCTCTGCTGCCTGCCCTGGG + Intronic
1175935976 20:62514216-62514238 CAGACCCTGCCTCCTCTCCCTGG - Intergenic
1175948619 20:62570403-62570425 CTGGTCCTGGCTCCTGCCCTGGG + Intronic
1175965683 20:62658963-62658985 CCTGCCCTGCCTCCTGCCCTGGG - Intronic
1175972120 20:62691975-62691997 TAGCCCCTGAGTCCTGCCCTGGG - Intergenic
1176022029 20:62966868-62966890 CAGCCCCATCCTCCTCTCCTGGG - Intronic
1176050313 20:63115855-63115877 CAGCCCCTGGCTGCTGCCTCTGG - Intergenic
1176101037 20:63364746-63364768 CAGCCCCCGCCCCCCACCCTGGG + Intronic
1176164264 20:63664586-63664608 CAGCCCCTGCCTGTCCCCCTTGG + Intronic
1176181845 20:63753130-63753152 TACCCCTTGCCTCCTGCCTTTGG - Intronic
1176264899 20:64204009-64204031 CTGCCCCTCCCACCTGCCTTAGG + Intronic
1176268685 20:64224049-64224071 CAGTCCCTGACTCCAGCCCCAGG - Intronic
1176271967 20:64239990-64240012 CTGCCTCTGGGTCCTGCCCTAGG + Intronic
1176301814 21:5102209-5102231 CAGCCCCTCCCGCTTGCCCAGGG + Intergenic
1176424959 21:6542898-6542920 CCGCCCCGGTCTCCAGCCCTGGG + Intergenic
1178928406 21:36794882-36794904 CAGCCCTTGCCTCCTGCTTTTGG - Intronic
1179069712 21:38060130-38060152 CAGCACATGCCTGCTGCCGTGGG - Intronic
1179271107 21:39851615-39851637 CAGGTGCTGCCTCCTTCCCTTGG + Intergenic
1179474170 21:41632829-41632851 CAGCCCCTGCCACCTGCAAAGGG + Intergenic
1179583546 21:42360548-42360570 CAGCCCTTGCAGCCTGCCTTTGG - Intergenic
1179644382 21:42766754-42766776 CGGCGCCTCCCTCCTTCCCTTGG - Intronic
1179700448 21:43151207-43151229 CCGCCCCGGTCTCCAGCCCTGGG + Intergenic
1179726671 21:43344831-43344853 AAGCCCCTGCCTGCCGCCCCCGG - Intergenic
1179855217 21:44159691-44159713 CAGCCCCTCCCGCTTGCCCAGGG - Intergenic
1179882755 21:44300318-44300340 CCGCCCCGGCCTCCTGCCCCGGG + Intronic
1179921989 21:44512435-44512457 AAGCCCCTGTCTCCATCCCTAGG - Intronic
1180001299 21:44996693-44996715 CAGCCCCTTCCTCCTGCCACAGG - Intergenic
1180049479 21:45324753-45324775 CAGACCCCACCTTCTGCCCTGGG - Intergenic
1180066555 21:45415416-45415438 CAGCTCCTGGCTGCTGCCCTGGG - Intronic
1180072040 21:45441450-45441472 CAGCAGCTGCCTCCAGGCCTCGG + Intronic
1180154146 21:45970072-45970094 CAGCCTCTGACTCCCGCCCGAGG + Intergenic
1180500465 22:15924698-15924720 CAGCCCTGGCCTCATTCCCTTGG - Intergenic
1180766665 22:18349330-18349352 CAGACCATGCCTCTAGCCCTTGG - Intergenic
1180779649 22:18513048-18513070 CAGACCATGCCTCTAGCCCTTGG + Intergenic
1180812364 22:18770369-18770391 CAGACCATGCCTCTAGCCCTTGG + Intergenic
1180834647 22:18923789-18923811 CTTCCCCTTCCACCTGCCCTGGG + Intronic
1180921293 22:19522901-19522923 GAGCCCCAGCCTCCAGCCCTGGG + Intergenic
1180941454 22:19662050-19662072 CCACCCCTGCCTGCTGCCCCCGG + Intergenic
1181103236 22:20555370-20555392 CATCCCCACCCTCCTGCCCAGGG - Intronic
1181182500 22:21077964-21077986 CACCTCCCTCCTCCTGCCCTGGG + Intergenic
1181198524 22:21204616-21204638 CAGACCATGCCTCTAGCCCTTGG + Intergenic
1181401211 22:22651184-22651206 CAGACCATGCCTCTAGCCCTTGG - Intergenic
1181406319 22:22687336-22687358 CATCCTCTTCCTCCTGCCCCAGG + Intergenic
1181414265 22:22747976-22747998 CATCCCCTTCCTTCTGCCCCAGG + Intronic
1181469033 22:23126802-23126824 CAGCCCCAGCCTCCTTTCCCAGG + Intronic
1181523746 22:23466334-23466356 GAGCCCCCATCTCCTGCCCTAGG - Intergenic
1181648319 22:24245707-24245729 CAGACCATGCCTCTAGCCCTTGG + Intergenic
1181703176 22:24632264-24632286 CAGACCATGCCTCTAGCCCTTGG - Intergenic
1181745457 22:24952708-24952730 CAGCCCGCGGCACCTGCCCTGGG - Intronic
1182107217 22:27698155-27698177 AGGCGCCTGCCTCCTGCCCTCGG + Intergenic
1182183429 22:28375850-28375872 TAGTCCCTTCCTCCTGTCCTAGG + Intronic
1182245013 22:28950262-28950284 CACCCACCGCCCCCTGCCCTGGG + Intronic
1182248952 22:28984312-28984334 TTGCCCCTCCCTGCTGCCCTTGG + Intronic
1182636108 22:31728326-31728348 GAGCCACTGCCCCCGGCCCTAGG - Intronic
1182684051 22:32107151-32107173 CAGCCCCTTCCTGCCTCCCTGGG + Intronic
1183083788 22:35474216-35474238 CAGAGCCTCCGTCCTGCCCTTGG + Intergenic
1183365230 22:37403356-37403378 CTGGCCCTGCCCTCTGCCCTAGG - Intronic
1183382463 22:37496994-37497016 GAGGCCCTGCCTCCTGAGCTGGG - Intronic
1183483511 22:38077454-38077476 CAGCACCTGCCTTCTCCCCACGG - Intergenic
1183629903 22:39026597-39026619 CAGCCCCTCCCTCCAGACCATGG + Intronic
1183633098 22:39045306-39045328 CCGCCCCTGCAGGCTGCCCTGGG - Intronic
1183639724 22:39085456-39085478 CAGCCCCTCCCTGCAGGCCTGGG + Intronic
1183657408 22:39195675-39195697 CAACCTCTGCCTCCTGAGCTCGG - Intergenic
1183690281 22:39384327-39384349 CAGGCCCTGCCTGCCACCCTAGG + Exonic
1183847642 22:40555304-40555326 CAGGCCCTGCCTCCAACACTGGG - Intronic
1184034336 22:41911290-41911312 GAGCCACTGCCTCCCACCCTGGG - Exonic
1184078575 22:42200986-42201008 CAGGCCCTGCCTCCAGCATTGGG - Intronic
1184285412 22:43468323-43468345 CAGCCTCTGCCACAAGCCCTAGG - Intronic
1184518223 22:44976088-44976110 CAGCCTCAGCCTCCTGGGCTCGG - Intronic
1184520542 22:44991477-44991499 GATCCTCTGCCTCCTTCCCTGGG - Intronic
1184538881 22:45106759-45106781 CAGCCCATGCCTTCTGCTCCTGG + Intergenic
1184644444 22:45888659-45888681 GAGCCCACGCCCCCTGCCCTCGG + Intergenic
1184677988 22:46053893-46053915 GGGCCCCTGGCTCCTGGCCTCGG - Exonic
1184684024 22:46087969-46087991 GGGCCCCTGCGTCCAGCCCTCGG + Intronic
1184684424 22:46089740-46089762 CTGCCCCTGCCTCCTGCCCGAGG + Intronic
1184741168 22:46429867-46429889 CTGGCACTGCCTCCAGCCCTGGG + Intronic
1184866055 22:47202419-47202441 CAGCCCCAGCTTTGTGCCCTTGG + Intergenic
1184886030 22:47344990-47345012 CTGCCTCTGTCTCCTGCCCATGG - Intergenic
1185008479 22:48299675-48299697 GAGGGGCTGCCTCCTGCCCTGGG - Intergenic
1185019426 22:48365555-48365577 AAGTCCCAGCCTCCAGCCCTGGG + Intergenic
1185299545 22:50072326-50072348 GAGCACCTGCCTCCAGCCCATGG + Intronic
1185359917 22:50399857-50399879 CTGCTGCTGCCTCCAGCCCTGGG - Intronic
1203228281 22_KI270731v1_random:90221-90243 CAGACCATGCCTCTAGCCCTTGG - Intergenic
1203284736 22_KI270734v1_random:149088-149110 CTTCCCCTTCCACCTGCCCTGGG + Intergenic
950254751 3:11495205-11495227 CAATCCCTGCCTCCTTCCCTGGG - Intronic
950486024 3:13274395-13274417 CAGGCCCTGTCTTCTGCCCTTGG + Intergenic
950505071 3:13389443-13389465 GAGCCTCAGCCTCCTGCCCTGGG - Intronic
950918073 3:16665588-16665610 CAGCTCCTGCCTCCTCCCGCAGG - Intronic
952160248 3:30686237-30686259 CAGCCACTGCCTTGTGCCTTAGG + Intronic
952334967 3:32396120-32396142 CAACCCCTGCTCCCTGACCTAGG - Intronic
952659752 3:35831295-35831317 AACCCCTTGCCCCCTGCCCTTGG - Intergenic
952955872 3:38556831-38556853 CAGTGCCTGGCTCCGGCCCTGGG + Intronic
953957127 3:47240242-47240264 CACCCCCTGCCACCAGCTCTAGG + Intronic
954137826 3:48590188-48590210 CAGGCCCTGCCCCCGTCCCTTGG - Intronic
954244017 3:49316733-49316755 GAACCCCTGCCCCCTGCCCTGGG + Intronic
954257384 3:49416190-49416212 CTGGACCTGCCTCCTTCCCTCGG + Exonic
954418515 3:50406080-50406102 CTGCCCCTGCCCCCTGGTCTGGG + Intronic
954537507 3:51372341-51372363 CTCCCCCTGCCCTCTGCCCTGGG - Intronic
954663475 3:52238120-52238142 CACCCCCAGCCCCCAGCCCTAGG - Intronic
954802373 3:53194638-53194660 CAGCAGCTGCTTCCTGTCCTGGG - Intergenic
954926047 3:54235590-54235612 CAGGCCCTGCCTCCAACACTGGG + Intronic
954982847 3:54761729-54761751 CTGCCCCACCCTCCTGGCCTGGG - Intronic
955363944 3:58296116-58296138 CAGAACCTGCCTACTGTCCTGGG - Intergenic
955492625 3:59498452-59498474 CAGTCCCTCACTCCTGCTCTGGG + Intergenic
955611846 3:60765892-60765914 CCTCCCATCCCTCCTGCCCTTGG + Intronic
956304191 3:67805795-67805817 CAGGGACTGCATCCTGCCCTAGG - Intergenic
956467667 3:69535641-69535663 CCGCCCCTGCCTCCGGCCCTAGG + Intronic
956863985 3:73351557-73351579 AAGCCACTACCTCATGCCCTTGG + Intergenic
956885670 3:73556946-73556968 CAGCCCCTCCCACATGCCCCTGG + Intronic
957149053 3:76461333-76461355 CAGGCTCTGCCTCCAGCACTGGG + Intronic
957193352 3:77039098-77039120 CCTCCCCTTCCTCCTTCCCTTGG + Intronic
957784181 3:84859853-84859875 CAGTCTCTGCCTCCTCCTCTTGG - Intergenic
960663464 3:120086712-120086734 CAGCCTCTGCCTCCTGGGCTCGG - Intronic
960943882 3:122952941-122952963 CAGCCCCTGCGTACTGCACAGGG + Intronic
961043703 3:123694716-123694738 CGGCCCCTGCCTCCTCTCCCAGG + Intronic
961282620 3:125775643-125775665 CTGGCCCTGGCTCCTGCCCCGGG - Intergenic
961514008 3:127421683-127421705 CTGCTCCTGCCCCCTGCCCTGGG - Intergenic
961524095 3:127485658-127485680 CAGCCTCTTACTCCTGCACTTGG + Intergenic
961743878 3:129051024-129051046 CAGGCCCTGCCTGCTGATCTTGG - Intergenic
961782227 3:129326962-129326984 GAGCCTCAGCCTCCTGCCCTGGG - Intergenic
961810915 3:129521240-129521262 CAGGGGCTGCCTCCAGCCCTGGG + Intergenic
961921168 3:130428050-130428072 CAGCCCCTTCCACCTACCTTTGG - Intronic
962168633 3:133077388-133077410 CTGCCCCTGGCACCTCCCCTGGG - Intronic
962732830 3:138299276-138299298 CAGCCCCTGGCTCCTGGCTTTGG + Intronic
962883029 3:139596792-139596814 GAGCTGCTGCCTGCTGCCCTTGG + Intronic
963867540 3:150378881-150378903 CAGACCCTGCCTCCAACACTGGG - Intergenic
964478609 3:157120244-157120266 CTTCCCCCGCCTCCTGCCGTAGG - Intergenic
964724443 3:159799748-159799770 CAACCCATCCCTCCTGTCCTAGG - Intronic
966600234 3:181767623-181767645 CAGTCTCTCCCTCCTACCCTTGG - Intergenic
966766970 3:183472252-183472274 CAGGCCCCACCTCCAGCCCTGGG - Intergenic
966853893 3:184181018-184181040 CAGGCCCAGGATCCTGCCCTGGG - Intronic
967572764 3:191050330-191050352 CATCCTCTGCATCGTGCCCTAGG - Intergenic
967685256 3:192409813-192409835 CTGCACCTGCCTCCTGGCCCCGG - Intronic
968475571 4:805129-805151 CAGCCCCTCCCTCCCGCTCCAGG - Intronic
968729986 4:2265052-2265074 CATCTCCAGCCTCCTTCCCTGGG + Intergenic
968786133 4:2623576-2623598 CAGCACCTGCCACAGGCCCTTGG + Intronic
968905021 4:3447008-3447030 CTGCCTCGGCCTCCTGCCCTGGG - Intronic
968981746 4:3853849-3853871 CAGCACCTGCCTCCTTCACACGG + Intergenic
969015116 4:4098789-4098811 CTGGCCCTGGCTTCTGCCCTGGG + Intergenic
969107253 4:4816982-4817004 CAGGCCCTGCCTCCAACACTGGG + Intergenic
969338812 4:6527844-6527866 CAGGCCCTGCCTTCTGTCCAGGG - Intronic
969521106 4:7678187-7678209 CACTCCCTGACTCCTGCCCCAGG - Intronic
969521180 4:7678552-7678574 CACTCCCTGACTCCTGCCCCAGG - Intronic
969655826 4:8497942-8497964 CAGCTCCTGCTCCCTGCCCCTGG - Intergenic
969656074 4:8499276-8499298 CAGCCTGGGCCCCCTGCCCTGGG + Intergenic
969725949 4:8918128-8918150 CAGGCCCTGCCTGCTTCTCTGGG - Intergenic
969738818 4:9009495-9009517 CTGGCCCTGGCTCCTGCCCCGGG - Intergenic
969798020 4:9541108-9541130 CTGGCCCTGGCTCCTGCCCTGGG - Intergenic
969869585 4:10096266-10096288 GAGCTGCTTCCTCCTGCCCTGGG + Intronic
970485957 4:16525117-16525139 TTACACCTGCCTCCTGCCCTGGG + Intronic
970827636 4:20295594-20295616 CAGTCCCTGCGTCATGCCCCTGG + Intronic
970874077 4:20849313-20849335 CAGCCCCTTCTCCTTGCCCTGGG - Intronic
970994280 4:22247778-22247800 CACTGCCTGCTTCCTGCCCTGGG + Intergenic
972453932 4:39233243-39233265 CAGGCCCTTCATCCTGCTCTAGG - Intronic
972765621 4:42150950-42150972 CCGCCCCTCCTTCCTGCCCCGGG - Intronic
974032454 4:56788042-56788064 CAGCCTCAGCCTCCTGGGCTCGG + Intergenic
974362038 4:60893954-60893976 CTGTCCATTCCTCCTGCCCTTGG + Intergenic
974617382 4:64307092-64307114 TAGCCCCTTCTTCCTGCCCAGGG - Intronic
979241867 4:118454265-118454287 CAGCTCCTGCATCCTGCTCAGGG - Intergenic
981636516 4:146887046-146887068 CAACTCCTCCCTCCTGCCCCTGG - Intronic
982065249 4:151649438-151649460 CAGCCTCTGCCTCCTGTGCAGGG + Exonic
982236185 4:153253186-153253208 CCTCTCCTGCCTCCTGCCCCTGG - Intronic
983635580 4:169894811-169894833 AAGCCTCTACCTCCTGGCCTGGG - Intergenic
983640868 4:169942960-169942982 CAGTCCCTGCCTCATCCTCTGGG + Intergenic
985558814 5:571121-571143 AGGCCCCGGCCTCCTGCCCCAGG - Intergenic
985577303 5:679349-679371 CTGCCCCTGCATCCTCCGCTGGG - Intronic
985592217 5:771400-771422 CTGCCCCTGCATCCTCCGCTGGG - Intergenic
985624432 5:977619-977641 CAGCCCCTGCCTCATTTCCTGGG - Intergenic
985661000 5:1156378-1156400 CATCCCCAGACTCCAGCCCTTGG + Intergenic
985677845 5:1241497-1241519 CAACCCCAGCCTCCTGTGCTTGG + Intronic
985727489 5:1523794-1523816 CCGCCCCTGCCTCCAGCGCAGGG - Exonic
985794340 5:1950609-1950631 CCGCCCTGGCCTCCTGCCCGGGG + Intergenic
985939341 5:3121954-3121976 CAGCCCCTTCCTCCCTCGCTCGG + Intergenic
985960818 5:3301974-3301996 AAGCCTCTGCCTTCTGCCCTAGG + Intergenic
986002717 5:3642816-3642838 CAGCCCCTCCCCACTGCCCTGGG - Intergenic
986506286 5:8455611-8455633 CAGCCCCCGCCTCCAACACTGGG - Intergenic
987308200 5:16658184-16658206 CAGGCCCTACCTCCAACCCTGGG + Intergenic
987412966 5:17632687-17632709 CAGACCCTGCCCTCTGGCCTTGG - Intergenic
988497021 5:31754176-31754198 CAGCCTCTGCCTGCAGCCCTTGG + Intronic
988544989 5:32147351-32147373 CAGCCTCCGCCTCCTGCACCAGG - Intronic
988856226 5:35230215-35230237 CAGCCCCTGCCGCGCGCCGTCGG + Intronic
989035347 5:37165023-37165045 CAGCCTCTACCTCCTGGGCTCGG - Intronic
989146716 5:38257750-38257772 CCGCCCCGGCCCCCTGCCCCAGG + Intergenic
989401476 5:41012222-41012244 CTGCCCTTGACTCCTGCCCTTGG + Intronic
989589002 5:43096124-43096146 CTGCCTCTGCCACCTGCCTTTGG - Intronic
990910192 5:60844374-60844396 CGGCTCCTCCCTCCGGCCCTCGG - Exonic
991176630 5:63695871-63695893 CAGCCACTGCACCCTGCCTTGGG - Intergenic
992291350 5:75283278-75283300 CAGTACCTGCCTCCGGCCTTGGG + Intergenic
995911483 5:117193065-117193087 CAGGCCCAGCCTCCAGCACTGGG - Intergenic
996887824 5:128379638-128379660 CAGCCCCTGAATCCTGCAATGGG - Intronic
997304314 5:132826656-132826678 CTGCCTCTGCCCCTTGCCCTGGG - Intronic
997363549 5:133310955-133310977 AAGACCCTCTCTCCTGCCCTCGG - Intronic
997367738 5:133336583-133336605 CAGCCTCTCACCCCTGCCCTGGG - Intronic
997415978 5:133729030-133729052 CAGACACTGTCTCCTGGCCTTGG - Intergenic
997505287 5:134412037-134412059 CAGCCCGTGGCTCCTGCCCTGGG + Intergenic
997904997 5:137807624-137807646 CAGTCCCTGTCTCCTGCCTCGGG + Intergenic
998080953 5:139274401-139274423 AAGTCCCTGCCTCTGGCCCTGGG - Intronic
998088862 5:139349529-139349551 GAGCCACTGCCTCCTGCCCTTGG + Intronic
998098916 5:139415665-139415687 CTGCTCCTGCATCCTGCCCAGGG + Intronic
998871161 5:146553589-146553611 CAACCCCTTCCTCCTGCCAGAGG + Intergenic
998880480 5:146640463-146640485 CAGCCACTGACCCATGCCCTGGG + Intronic
999273144 5:150309712-150309734 CCCCCGCTGCCTCCTGGCCTTGG + Intronic
999297428 5:150468463-150468485 GTGCCCCTGCCTCCTTCCCTTGG - Intergenic
999325168 5:150639306-150639328 CAGGCCCAGCCTCCTTCCCCTGG + Intronic
999355613 5:150928126-150928148 CTGCACTTGCCTCCTGGCCTTGG + Intergenic
999753501 5:154647523-154647545 CAGCTCCTGTCTCCTGCGCTTGG + Intergenic
1000275705 5:159733051-159733073 CAGGCCCTTCCTACTGCACTAGG - Intergenic
1001083947 5:168686923-168686945 CAGCCCCTGCCACCTGGCCCAGG + Intronic
1001130987 5:169063320-169063342 CAGCCCCTCCTTCCAGCGCTGGG - Intronic
1001171412 5:169422889-169422911 CAGGCCCTCTCTGCTGCCCTCGG - Intergenic
1001287295 5:170433265-170433287 CAACCCCTGCCTCCTGGGTTCGG + Intronic
1001481472 5:172092003-172092025 GGGCCCCTGTCTCCTGCCCATGG + Intronic
1002000015 5:176192166-176192188 CCTCCCCTGCCTCCTGCCCAGGG + Intergenic
1002427691 5:179185783-179185805 CAGCTCCCACCTCCTGCGCTGGG + Intronic
1002563787 5:180099119-180099141 CAGGCCCTGCCTCATGCCTGCGG + Intergenic
1002577157 5:180180621-180180643 CAGGACCTGGCTCCTGCCCAAGG + Intronic
1002641244 5:180631614-180631636 CAGCCACCACCTCCTGCCTTGGG + Intronic
1002855111 6:1029332-1029354 CAGTCCCTGCCTCCAACACTGGG - Intergenic
1002927205 6:1611429-1611451 CAGCTCCGGCCTTCTGGCCTCGG + Exonic
1002961090 6:1915425-1915447 CTGCCCCTGCTGCTTGCCCTTGG - Intronic
1003136485 6:3438487-3438509 CAGCTCCGGCCTCCAGCGCTTGG + Intronic
1003167474 6:3693382-3693404 CCCCCACTGCCGCCTGCCCTCGG - Intergenic
1003403178 6:5807582-5807604 CAGGCCCTACCTCCAGCACTGGG - Intergenic
1003405391 6:5823516-5823538 CAGCCTCATCCTCCTGCCCCTGG - Intergenic
1003642569 6:7887999-7888021 CTGCCCCAGCCCCCTGCCATTGG + Intronic
1003816816 6:9851111-9851133 AAGGCTCTGCATCCTGCCCTGGG + Intronic
1004113966 6:12749272-12749294 CAGCCCCAGTTTCCAGCCCTTGG - Intronic
1004342365 6:14818856-14818878 CACCCCCAGCACCCTGCCCTGGG + Intergenic
1004456196 6:15793582-15793604 CAGCCCCTGCCTCATGCCTGGGG - Intergenic
1005449630 6:25960318-25960340 CAGCCCCTCCTTCCTGCAATGGG + Intergenic
1006024778 6:31139816-31139838 CAGCCCCTTCCTCCTCCCTCAGG + Exonic
1006154252 6:32005773-32005795 CACCTCCTGCCTCTTGCCCCGGG + Intergenic
1006244073 6:32714923-32714945 TAGCCCCTGACTCCTTTCCTTGG - Intergenic
1006277262 6:33015339-33015361 CTGCACCAGCCTCCTGCCCTGGG + Intergenic
1006404791 6:33838659-33838681 CAACCCCTCAGTCCTGCCCTGGG + Intergenic
1006860834 6:37170665-37170687 CACCCCCCGCCTCCGGCCCGGGG + Intronic
1007074378 6:39057548-39057570 CTGCCCCTGGTACCTGCCCTGGG + Exonic
1007301493 6:40871196-40871218 CAGCCCATGAAACCTGCCCTGGG + Intergenic
1007341045 6:41191798-41191820 CTGCTCCTCCCTCCTGTCCTGGG - Exonic
1007696286 6:43736197-43736219 CAGCAGCTGCCTCCGGCCTTGGG - Intergenic
1007726363 6:43918279-43918301 CAGCCACTGGCTCATGCCTTTGG - Intergenic
1007731658 6:43951228-43951250 GAGCCCATGCCTCCTGCCCTGGG - Intergenic
1007733678 6:43967281-43967303 CTGCCCCACCCTCCTGTCCTAGG - Intergenic
1007996383 6:46312486-46312508 CAAACCCTGGTTCCTGCCCTGGG - Intronic
1008098591 6:47366894-47366916 CAGGCCCTACCTCCAACCCTGGG + Intergenic
1008268049 6:49456177-49456199 CAGCCCCTGCTTCCTGCATATGG + Exonic
1008656254 6:53617069-53617091 CATCCCCTTTGTCCTGCCCTTGG - Intergenic
1009036043 6:58118004-58118026 CAGCCACTGCCTCTGGCCATGGG - Intergenic
1010229723 6:73523624-73523646 CCGCCCCAGCCTCCCTCCCTAGG - Intronic
1011601221 6:89062117-89062139 CAGCCTCTGCCTCCTGGACTCGG + Intergenic
1011765123 6:90611417-90611439 CAGCCCCCGCCTGCAACCCTCGG - Intergenic
1012464835 6:99505558-99505580 CAACCTCTGCCTCCTGGGCTGGG - Intronic
1013612155 6:111805684-111805706 CAGCCCCCTCCCCCTTCCCTTGG + Intronic
1013656883 6:112255185-112255207 CAGCCCCGGCCTCTTCCTCTTGG + Intergenic
1014095438 6:117454515-117454537 CAGCCCCCACCTCCTGGGCTCGG - Intronic
1014946510 6:127504908-127504930 CTGCCCCTGCTTCCTGCCCCTGG - Intronic
1015939805 6:138436985-138437007 GAGCCACTGCCCCCTGGCCTAGG - Intronic
1016051773 6:139537467-139537489 CCCTCCCTGTCTCCTGCCCTGGG + Intergenic
1016363398 6:143291355-143291377 CACCCCCTGGCTCCTGTCCAGGG - Intronic
1016992038 6:149936947-149936969 CTGTCCCTCCCTCCTGCACTTGG - Intergenic
1017065895 6:150528791-150528813 CAGCCCCTGCAGTCTGCTCTGGG + Intergenic
1017083722 6:150693833-150693855 AGGTCCCTGCCTCCTGACCTGGG - Intronic
1017450277 6:154548552-154548574 CTGCCCCAGGCCCCTGCCCTCGG + Intergenic
1017496531 6:154988544-154988566 CAGGCCCTGCCTCCAACACTGGG + Intronic
1017760671 6:157565729-157565751 CAACCTCCGCCTCCTGCACTGGG - Intronic
1017773891 6:157664846-157664868 CAACCCTTGCCTACAGCCCTTGG + Intronic
1017981068 6:159401591-159401613 GAGCCCCTGGCTCCTCCCGTGGG - Intergenic
1018100028 6:160429420-160429442 CATCCCCTTCCCCCTGCCCATGG + Intronic
1018670306 6:166171530-166171552 CGGCCCCTCCCTGCTGCTCTAGG + Intergenic
1018774447 6:166999741-166999763 CATCCCCTGCCTCATTCCGTGGG + Intronic
1018848332 6:167570602-167570624 CATCCGCTCCTTCCTGCCCTGGG + Intergenic
1018923471 6:168191342-168191364 CTGCCCCTGCCCCTCGCCCTTGG + Intergenic
1019040003 6:169095919-169095941 CAGGCCCCACCTCCTGCACTGGG + Intergenic
1019134530 6:169899863-169899885 CAGCCCCTCCCCGCTTCCCTGGG + Intergenic
1019349722 7:548956-548978 CAGCTCCTGCTTCCAGCCCAAGG - Intergenic
1019419645 7:945131-945153 CAGCCCGTCCCTTCTGCCTTGGG - Intronic
1019461999 7:1164760-1164782 CTGTCCATTCCTCCTGCCCTTGG - Intergenic
1019477219 7:1249737-1249759 GAACCCCTCCCTCCAGCCCTGGG - Intergenic
1019502988 7:1374614-1374636 CAGGCCCCGCCTCCAGCACTGGG + Intergenic
1019524344 7:1474035-1474057 CAGGCCAGGCCACCTGCCCTGGG - Intronic
1019528973 7:1494318-1494340 CTGCCCCCACCTCGTGCCCTGGG - Intronic
1019555169 7:1625679-1625701 CAGCCCCAGTGTCCAGCCCTTGG + Intergenic
1019595531 7:1856716-1856738 CAGTCCCTGCTTCCTGCCAGCGG + Intronic
1019643266 7:2115888-2115910 CTTCCCCTTCCTCCTGCCCCAGG + Intronic
1019726564 7:2606102-2606124 CAGCGCCTGCCGCCTGCCAGCGG + Intronic
1019760920 7:2812004-2812026 CAGCCCCTTCCCACTGCCCCTGG - Intronic
1019768309 7:2867259-2867281 CAGGCCCTGCCTCCAACACTGGG + Intergenic
1019777827 7:2923020-2923042 CAGCTCCCTCCTCCTGCCCGGGG + Intronic
1019784501 7:2966696-2966718 CAGCCTCTGCCTTATCCCCTGGG + Intronic
1019895264 7:3977475-3977497 CAGCCCCTGCCTTCAGGCATTGG + Intronic
1019910723 7:4099311-4099333 CATTCCCTGCCCCCTCCCCTTGG - Intronic
1020067362 7:5199102-5199124 CAGCCTCAACCTCCTGTCCTGGG + Intronic
1020799752 7:12719119-12719141 CAGCCCTGGCCACCAGCCCTAGG - Intergenic
1021312985 7:19116265-19116287 CACCCACTTCCTCTTGCCCTTGG - Intronic
1021379275 7:19948013-19948035 CATCCCCTGCCTTCAGCACTGGG - Intergenic
1021783808 7:24133158-24133180 TGCCCCCTGCCTCCTCCCCTGGG - Intergenic
1022617895 7:31951395-31951417 CAGCCACTGGCTCCTGGCTTCGG + Intronic
1022979263 7:35588793-35588815 CTTCCCATTCCTCCTGCCCTTGG + Intergenic
1023339775 7:39207556-39207578 CAGCTGCTGCCACCAGCCCTTGG - Exonic
1023850210 7:44146134-44146156 CGGACCCCGCCTCCTCCCCTTGG + Intronic
1023850244 7:44146210-44146232 CTGTCCCAGCCTCCTGCCCTTGG + Intronic
1023900827 7:44477211-44477233 TAGGCCATTCCTCCTGCCCTGGG - Intronic
1023969187 7:44978839-44978861 GAGCCACTGCCTCCTGCCCTGGG + Intronic
1024200143 7:47098120-47098142 CAGCCCCTTCCTTCTGTTCTAGG + Intergenic
1024948361 7:54834028-54834050 CAGGGCCGGCCTCCTGCCCTAGG + Intergenic
1025026390 7:55519800-55519822 CAGCCCTTCCCTCCTACACTGGG + Intronic
1025271279 7:57520280-57520302 CTTCCCCTGCTTCCTGCCATAGG + Intergenic
1026084700 7:67253619-67253641 CAGCCCCCGCCCCCTACCCCAGG - Intergenic
1026540364 7:71274972-71274994 CAGTCCCTGCCTCTGGCCCTGGG + Intronic
1026836825 7:73645310-73645332 GAGCCACTGCCTCTGGCCCTAGG + Intergenic
1026875583 7:73877286-73877308 CTGCCTCTGCCCCCTGCCCCAGG - Intergenic
1026941364 7:74289670-74289692 GAGCCCCGGCCTCCTCCTCTCGG - Exonic
1028728923 7:94122370-94122392 CCACCTCTGCCTTCTGCCCTCGG + Intergenic
1029073786 7:97920412-97920434 CCGGCCCTGGCTCCTGCCCCGGG + Intergenic
1029146976 7:98453419-98453441 CAAGCCCTTCCTCCTGCTCTTGG - Intergenic
1029484988 7:100834790-100834812 CAACCTCTGCCTCCTGGGCTCGG - Intronic
1030266833 7:107629878-107629900 CAGTCCCAGCCTCCTTCCTTGGG - Intergenic
1030362594 7:108610623-108610645 CCCCCCCTTCATCCTGCCCTGGG + Intergenic
1030713553 7:112782919-112782941 CAGCCTCTTCCTCCTCCCATTGG + Intronic
1031872636 7:127103287-127103309 CAGGCCCTGCCTCCATCACTGGG - Intronic
1032087345 7:128891068-128891090 CAGCCCCCGCCGGCTGCCCACGG - Exonic
1032194273 7:129780474-129780496 CTATCCCCGCCTCCTGCCCTCGG + Intergenic
1032410451 7:131690324-131690346 TCGCCCCTCCCTGCTGCCCTAGG - Intergenic
1032509742 7:132463229-132463251 CTGGCCCTTCCTCCTCCCCTGGG - Intronic
1033478276 7:141712027-141712049 CAGGCCCTACCTCCAGCACTGGG + Intronic
1033584976 7:142767756-142767778 CAGTCCCTGCCTCCTTCCTTGGG + Intergenic
1033586459 7:142778369-142778391 CAGTCCCTGCCTCCTTCCTCGGG + Intergenic
1034307819 7:150059832-150059854 CAGCTCTTCCCTCCTGCCCCGGG - Intergenic
1034343108 7:150370312-150370334 CACCCACAGCCTGCTGCCCTCGG - Intronic
1034678807 7:152912096-152912118 CTGCAGCGGCCTCCTGCCCTTGG - Intergenic
1034799029 7:154040837-154040859 CAGCTCTTTCCTCCTGCCCCGGG + Intronic
1035019622 7:155792740-155792762 CCGGCTCTGCCTCTTGCCCTGGG + Intergenic
1035255165 7:157621261-157621283 GAACCCTGGCCTCCTGCCCTCGG + Intronic
1035258310 7:157646202-157646224 CAGGCCCCACCTCCAGCCCTGGG - Intronic
1035294890 7:157861444-157861466 TGGCATCTGCCTCCTGCCCTCGG + Intronic
1035299550 7:157887965-157887987 CGCCCCCTGCCTCCCACCCTTGG + Intronic
1035313655 7:157984834-157984856 CTGCCCCTGACTTCTGCACTAGG + Intronic
1035349864 7:158238304-158238326 CCTCCCCTCCCTCCTGCCCTGGG + Intronic
1035372662 7:158389162-158389184 CCGCACCTGCCTCCTGCCGAGGG - Intronic
1035433241 7:158838202-158838224 CAGGCCCCACCTCCAGCCCTGGG + Intergenic
1035460281 7:159034397-159034419 CAGTCCCTCCCTCCTTCCCTGGG + Intronic
1035614064 8:989321-989343 CAGCCCCTCCCTCAGGCCCTGGG - Intergenic
1036179259 8:6568812-6568834 CTGCCCCTGCCTGCAGGCCTTGG + Intronic
1036243915 8:7100848-7100870 CTGGCCCTGGCTCCTGCCCTGGG - Intergenic
1036256885 8:7213204-7213226 CTGGCCCTGGCTCCTGCCCCGGG + Intergenic
1036308935 8:7671803-7671825 CTGGCCCTGGCTCCTGCCCCGGG + Intergenic
1036360603 8:8074309-8074331 CTGGCCCTGGCTCCTGCCCCGGG - Intergenic
1036436946 8:8743464-8743486 CAGCCCCAGCCTCCTGCTGCAGG + Intergenic
1036890368 8:12592658-12592680 CTGGCCCTGGCTCCTGCCCCGGG + Intergenic
1036897936 8:12650575-12650597 CTGGCCCTGGCTCCTGCCCCGGG + Intergenic
1036910322 8:12753765-12753787 CAGCCTCGGCCTCCTAACCTAGG - Intronic
1037600144 8:20387036-20387058 CAGCCTCAACCTCCTGGCCTGGG - Intergenic
1037755405 8:21706915-21706937 CTTCCTCTTCCTCCTGCCCTGGG + Intronic
1037780582 8:21865733-21865755 TAGGCCCTGCCTCCTGCACTGGG - Intergenic
1037975061 8:23203354-23203376 CAGCCCATGCCACCTGCCATGGG + Intronic
1037988559 8:23304802-23304824 CTTCCCCAGCCCCCTGCCCTTGG + Intronic
1038128665 8:24703830-24703852 CAGGCCCTGCCTCCAACACTGGG + Intergenic
1038346347 8:26735745-26735767 CAGCCCTTGCCTGCTTCACTGGG - Intergenic
1038349357 8:26762361-26762383 CTGGCACTGTCTCCTGCCCTGGG + Intronic
1038482173 8:27909388-27909410 CAGACCCTGGCTCCTGGGCTGGG + Intronic
1038746799 8:30261845-30261867 CACCCCCTTGCTCCTGCCCTTGG + Intergenic
1038775561 8:30527645-30527667 CAGCCCCAGCATCCTGTGCTGGG + Intronic
1038781484 8:30572007-30572029 GAGCCCCTCACTCCTGGCCTTGG - Intronic
1039251861 8:35674750-35674772 CTGTCCCTGCCTCATGTCCTTGG + Intronic
1039821968 8:41142436-41142458 CAGCCTCTGGCTCTTGTCCTAGG - Intergenic
1040059706 8:43093662-43093684 CAGCCCCGGCCGCCTGCCCGCGG + Intronic
1040080338 8:43277268-43277290 GAGCCGCCGCCTCCAGCCCTCGG + Intergenic
1040525185 8:48216563-48216585 CATCCCCTCCCACCAGCCCTTGG - Intergenic
1041270057 8:56102962-56102984 CAGGCCCTGCCTCCAACTCTGGG - Intergenic
1044021745 8:87113211-87113233 CATCCCCTACCTACTGCCCATGG - Intronic
1044944088 8:97374973-97374995 CTGGCACTGCCTCCTGCTCTTGG - Intergenic
1045054990 8:98361252-98361274 CAGGCCTTGCCTCCTGCCCACGG + Intergenic
1046351216 8:113014683-113014705 CATTCCCTGACTCCTTCCCTTGG - Intronic
1046661960 8:116957602-116957624 CAGCCCCTTCCCCCTGCAATGGG + Intronic
1047147413 8:122218830-122218852 CAGCCTCAGCCTCCTTACCTGGG - Intergenic
1047211896 8:122847341-122847363 CCCGCCCTGCCTCCTGCCCCAGG + Intronic
1047313809 8:123714222-123714244 GAGCCCCTTTGTCCTGCCCTTGG + Intronic
1047404476 8:124573689-124573711 CACCCCCTCCCTCCTCCTCTTGG - Intronic
1047560572 8:125983930-125983952 CAGACCCTACCTCCAGCACTGGG - Intergenic
1048766941 8:137854867-137854889 CCCCTCCTCCCTCCTGCCCTCGG + Intergenic
1049062715 8:140288260-140288282 CAGCCTCAGCCTCCTGGGCTCGG - Intronic
1049157064 8:141073735-141073757 CAGCTCCTGCCTGCAGCCCCAGG + Intergenic
1049174207 8:141181517-141181539 CTGCACCTGCCTCCTGTGCTTGG + Intronic
1049214771 8:141402572-141402594 CTGTCCCGGCCTCCTGCCTTCGG + Intronic
1049311478 8:141936046-141936068 TAGGCCCTCCCACCTGCCCTGGG + Intergenic
1049337555 8:142094506-142094528 CGGCCCCTCCCTACTGTCCTTGG + Intergenic
1049346820 8:142143670-142143692 CAGGCCCTGCCCCCTCCCCCGGG + Intergenic
1049384770 8:142337651-142337673 CAGCCCCTGCCTCGTAACCGTGG - Intronic
1049529846 8:143148726-143148748 CAGCCCCTGTCTCCCGCTCTGGG + Intergenic
1049544194 8:143221857-143221879 CAGCCTCTGTCCCCTGCCCCCGG + Intergenic
1049544250 8:143222009-143222031 CAGCCTCTGTCCCCTGCCCCTGG + Intergenic
1049613878 8:143567986-143568008 CCGACCATGCCACCTGCCCTGGG - Intronic
1049663366 8:143830484-143830506 CTACCCCTGCCTCCACCCCTGGG + Intergenic
1050029239 9:1367604-1367626 CAGGCCCTGCCTCCAGCATTGGG + Intergenic
1050129497 9:2396666-2396688 CTGCCCTTGCCTCCTTGCCTAGG - Intergenic
1050301095 9:4259682-4259704 CAGGTCCTGCCTCCTTCGCTAGG - Intronic
1050411648 9:5372592-5372614 CAGCTACTGCCTCCTGCCACAGG + Intronic
1051339453 9:16097900-16097922 CACCCCATGCATCCTGCCCTAGG + Intergenic
1051605274 9:18912119-18912141 CAGCTCCTCCCTCCTGCCGTGGG - Intergenic
1051711201 9:19933033-19933055 CAGCCCCCACCTCCTGCCCCAGG - Intergenic
1052819199 9:33125561-33125583 GAGCCCCTGCCTTTGGCCCTTGG - Intronic
1052902217 9:33803025-33803047 CAGTCCCTGCCTCCTTCCTTGGG + Intergenic
1052933903 9:34077465-34077487 CTGCCCCAGCCTCCTGCCACAGG - Intergenic
1053199295 9:36141956-36141978 CAGCCCCTTCCCTCAGCCCTGGG + Intronic
1053214331 9:36258238-36258260 CTCCCCCGGCCTCCTGCCCCAGG - Intronic
1053288445 9:36864698-36864720 CAGGCCCTGCCTGCTCCCCTGGG + Intronic
1054771819 9:69090523-69090545 GAGCCACTGGCTACTGCCCTGGG + Intronic
1055166102 9:73196032-73196054 CAGGCCCTGCCTCCAACACTGGG - Intergenic
1055681916 9:78724435-78724457 CAGAGACTGCATCCTGCCCTGGG + Intergenic
1056054151 9:82803400-82803422 CAGGCCCTACCTCCAGCACTGGG - Intergenic
1056202633 9:84291273-84291295 CATCCCATGCTTCCTTCCCTAGG - Intronic
1056761989 9:89422347-89422369 CAGCCCCTGCTTTCTGGCTTGGG + Intronic
1056762474 9:89425203-89425225 CAGGCCTTGCCACCTCCCCTAGG + Intronic
1056955206 9:91075700-91075722 CAGCCACTGCCTGCTGGCTTTGG - Intergenic
1057499583 9:95585941-95585963 CAGCCTCTGGCTCCTGCCCTGGG + Intergenic
1057818627 9:98314591-98314613 GAGCCCCTCCCTCCTGCTCCCGG + Intronic
1057819858 9:98322412-98322434 CTGCCCCAGGCTCTTGCCCTCGG + Intronic
1059457897 9:114411418-114411440 GAGCCACTGCCCCCTGCCCCAGG + Intronic
1060493775 9:124103151-124103173 CAGCCCCTGCTTCCTTCACTGGG + Intergenic
1060927186 9:127463252-127463274 CACCACCTGCCTCCTGCACCTGG - Intronic
1060969749 9:127731284-127731306 CATGCCCTGGCTCTTGCCCTGGG - Exonic
1061089930 9:128420808-128420830 CAGGCCCCGCCCCCTCCCCTCGG + Exonic
1061147579 9:128808875-128808897 CTGCCCCTGCTTTCTGCCCAGGG + Exonic
1061194571 9:129100756-129100778 CCTCCGCAGCCTCCTGCCCTGGG + Intronic
1061390442 9:130314747-130314769 CAGCCTCTGCCTCCCACCCAGGG - Intronic
1061727543 9:132589810-132589832 CAGCCTCTGCCGGCTCCCCTAGG + Exonic
1061781015 9:132996111-132996133 CGGTCCCTGCCTCCTTACCTCGG - Intergenic
1061792213 9:133064745-133064767 CAGACCTTGCTTCCTGCCCTGGG - Exonic
1061854178 9:133432767-133432789 CTGGTCCTGCCTCCTGACCTAGG - Intronic
1061896898 9:133652893-133652915 CAGCACCTGCCACCTGGCGTTGG - Intronic
1061905146 9:133692854-133692876 CACCCCTTCCCTCCTGCCGTTGG - Intronic
1061959207 9:133979478-133979500 CCGCTCCTTCCTGCTGCCCTGGG - Intronic
1062031873 9:134365492-134365514 CTGCCCCTGCCTCCTGTCTCTGG + Intronic
1062156606 9:135052490-135052512 CAGGCCCTACCTCCAGCACTGGG - Intergenic
1062167383 9:135114683-135114705 CAGCCCCTCCCTCCCTCCCCAGG - Intronic
1062261938 9:135667236-135667258 CTGGCCCTGCCCCCTGCCCGGGG + Intergenic
1062290593 9:135792626-135792648 CAGCCCTGGCCCCCAGCCCTTGG - Exonic
1062326189 9:136013681-136013703 CAGCCCCTCCCTCCCTCCCTGGG + Intronic
1062377284 9:136267857-136267879 AAGCCCGTTCCTCCCGCCCTGGG - Intergenic
1062407760 9:136404994-136405016 CAGCCGGTGCAGCCTGCCCTTGG - Intronic
1062417170 9:136457418-136457440 CTGCCCCTGGCGCCTGTCCTCGG - Intronic
1062428596 9:136517124-136517146 CCGCCCCCACCCCCTGCCCTCGG - Intronic
1062460399 9:136660415-136660437 GAGCCCAGGCCTCCTTCCCTTGG + Intronic
1062482944 9:136760775-136760797 CAGCCCCTGGCTCCCTCCCCAGG - Intronic
1062520089 9:136954141-136954163 CAGCTCCTGCCTGCAGCCCAGGG - Exonic
1062566128 9:137164753-137164775 CGACACCTGCCTCCAGCCCTCGG + Intronic
1062628046 9:137451898-137451920 CAACCCCAGCCTCTTCCCCTTGG + Intronic
1062628091 9:137452055-137452077 CAACCCCAGCCTCTTCCCCTTGG + Intronic
1062730350 9:138105029-138105051 CAGCCTCAGCCTGCAGCCCTGGG + Intronic
1185431415 X:13849-13871 CAGACCCCCGCTCCTGCCCTCGG + Intergenic
1185627460 X:1492782-1492804 GAGCCCAGGCCACCTGCCCTGGG + Intronic
1186480838 X:9895234-9895256 CAGCCCCTGGCTCCTGCCCAAGG - Exonic
1186594266 X:10964166-10964188 CAGTCCCTGCCTCTTCTCCTTGG + Intergenic
1189221211 X:39373814-39373836 CAGTCCCTGCCTCTTAACCTGGG - Intergenic
1189383799 X:40520568-40520590 CATCCCCTGCCTTCTGCCCTTGG - Intergenic
1190011852 X:46791918-46791940 CAGCTCCTGACTTCTTCCCTGGG + Intergenic
1190860646 X:54341551-54341573 TAGCCACTGCCTGCTACCCTGGG + Intronic
1192529238 X:71871599-71871621 TGGCCTCTGCCTCCTGGCCTGGG - Intergenic
1194090281 X:89576483-89576505 GAGCTCCTGCCTCCTGCACTTGG + Intergenic
1194236037 X:91384016-91384038 CAGCCCCTACCTCCAGCACTGGG - Intergenic
1194708063 X:97200123-97200145 CAGCCCCTCACTGCTTCCCTTGG - Intronic
1194782106 X:98036349-98036371 CAGCACTTGTCTCCTGCCATTGG + Intergenic
1194949406 X:100107184-100107206 CAGCCCCTACCTCCAGCATTGGG - Intergenic
1195294729 X:103464667-103464689 CAGTCACTTCCTGCTGCCCTGGG + Intergenic
1195989426 X:110667957-110667979 CAGCCCCTTCCTCCTCACCAGGG + Intergenic
1197708821 X:129652256-129652278 CCTCCACTGCCTCCTGACCTGGG - Intronic
1197871588 X:131067347-131067369 CAGCCCCTGTATCGCGCCCTAGG + Intronic
1198060627 X:133042415-133042437 CAGTCCCTCCCGCCTTCCCTTGG + Intronic
1198092876 X:133349311-133349333 CACCCCTTTCCTCCTCCCCTAGG + Intronic
1198618408 X:138481932-138481954 CAGCCCCTGCTATCAGCCCTAGG + Intergenic
1199002804 X:142659788-142659810 CAGCCTCTACCTCCTGGGCTTGG - Intergenic
1199330493 X:146552594-146552616 CAGCCCCTTCCTCCAACACTGGG + Intergenic
1199684796 X:150256396-150256418 GGGCCCCTGCTTCCTGCCCCAGG - Intergenic
1199858064 X:151776642-151776664 CAGCTCCTGCCTGCTGAGCTTGG + Intergenic
1199991871 X:152991992-152992014 CAGGCCCTGCCTCCTGACGTTGG - Exonic
1200114319 X:153763456-153763478 CTGCCTTCGCCTCCTGCCCTGGG + Intergenic
1200254979 X:154575849-154575871 CAGGCCCCACCTCCAGCCCTGGG - Intergenic
1200259089 X:154602442-154602464 CCGCCACTGGCTCCTGCCCCAGG - Intergenic
1200262790 X:154628559-154628581 CAGGCCCCACCTCCAGCCCTGGG + Intergenic
1200268412 X:154659200-154659222 CATCTCCTGCCTGCTGGCCTTGG - Intergenic
1200442931 Y:3232536-3232558 GAGCTCCTGCCTCCTGCACTTGG + Intergenic
1202389576 Y:24356090-24356112 CAGCTCCTGCATCCTGCTCAGGG - Intergenic
1202481208 Y:25314024-25314046 CAGCTCCTGCATCCTGCTCAGGG + Intergenic