ID: 1103702216

View in Genome Browser
Species Human (GRCh38)
Location 12:122853780-122853802
Sequence GGCTTCCAGAGACCTCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 228}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103702216_1103702218 -9 Left 1103702216 12:122853780-122853802 CCAGGTGGAGGTCTCTGGAAGCC 0: 1
1: 0
2: 3
3: 25
4: 228
Right 1103702218 12:122853794-122853816 CTGGAAGCCCTTGCTGAGCTGGG 0: 1
1: 0
2: 4
3: 33
4: 255
1103702216_1103702217 -10 Left 1103702216 12:122853780-122853802 CCAGGTGGAGGTCTCTGGAAGCC 0: 1
1: 0
2: 3
3: 25
4: 228
Right 1103702217 12:122853793-122853815 TCTGGAAGCCCTTGCTGAGCTGG 0: 1
1: 0
2: 2
3: 21
4: 252
1103702216_1103702220 -4 Left 1103702216 12:122853780-122853802 CCAGGTGGAGGTCTCTGGAAGCC 0: 1
1: 0
2: 3
3: 25
4: 228
Right 1103702220 12:122853799-122853821 AGCCCTTGCTGAGCTGGGCTGGG 0: 1
1: 0
2: 9
3: 281
4: 859
1103702216_1103702219 -5 Left 1103702216 12:122853780-122853802 CCAGGTGGAGGTCTCTGGAAGCC 0: 1
1: 0
2: 3
3: 25
4: 228
Right 1103702219 12:122853798-122853820 AAGCCCTTGCTGAGCTGGGCTGG 0: 1
1: 0
2: 4
3: 43
4: 505

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103702216 Original CRISPR GGCTTCCAGAGACCTCCACC TGG (reversed) Intronic
901050428 1:6423524-6423546 GGTTTCCAACGACTTCCACCAGG - Intronic
901762647 1:11480574-11480596 AGATTCCAGAGCCCACCACCTGG + Intronic
902398349 1:16144375-16144397 AGCTCCCAGAGTCTTCCACCTGG + Intronic
902729253 1:18357754-18357776 GGCACTCAGAGCCCTCCACCAGG + Intronic
904309633 1:29620430-29620452 AGCTTCCTGAGACCTCCCCAGGG - Intergenic
904536390 1:31202203-31202225 GGCTTGCAGAGCCCCCCAGCTGG - Intronic
905004891 1:34701506-34701528 GGCTTCCAGAGACCTTCTTCAGG - Intergenic
905025705 1:34847876-34847898 GGCTGCTGGAGAGCTCCACCTGG + Intronic
905357752 1:37396571-37396593 GGCTTCCCTTCACCTCCACCTGG + Intergenic
905940582 1:41860098-41860120 GGATTCTGAAGACCTCCACCAGG + Intronic
905982338 1:42241204-42241226 AGCTTCCTGACAGCTCCACCAGG + Intronic
906242190 1:44248907-44248929 GGCTGCCAGCAACCTCCACCTGG + Intronic
906581840 1:46941379-46941401 GGATTCCAGAGACATCACCCAGG + Exonic
907527788 1:55063787-55063809 AGCTTCCTGGCACCTCCACCTGG - Exonic
908047824 1:60190550-60190572 AGCTTCCTGAGGCCTTCACCAGG + Intergenic
912278059 1:108281518-108281540 GGCTCCCAGTGACCCCAACCAGG - Intergenic
912290167 1:108412839-108412861 GGCTCCCAGTGACCCCAACCAGG + Intronic
913311698 1:117503530-117503552 TGTTTACAGAGACCTCTACCTGG - Intronic
920420114 1:205827536-205827558 GCCTTCCAGTGCCCCCCACCTGG + Intergenic
922185889 1:223273990-223274012 GGCTCCCTGAGACCACCATCAGG - Intronic
923441438 1:234024376-234024398 GGCTTCCAAACACCTCCACTGGG - Intronic
924087516 1:240468387-240468409 AGCATCCATAGACCCCCACCAGG + Intronic
1062923911 10:1299987-1300009 TGCCTCCAGGGTCCTCCACCGGG - Intronic
1064761067 10:18621280-18621302 AGCTTCCAGAGTCCTCTTCCAGG - Intronic
1065257871 10:23892415-23892437 GGCTTCCAGAGAATGCCATCAGG - Intronic
1067030379 10:42875566-42875588 GCCTGCCAGACACCTCTACCGGG - Intergenic
1067435996 10:46278380-46278402 GGCTTGCAGAGACCTTCTCATGG - Intergenic
1067556839 10:47278676-47278698 GCCTTCCATGGACCTCCTCCAGG + Intergenic
1067578754 10:47425927-47425949 GGCCTCCAGCCACCCCCACCAGG + Intergenic
1069152535 10:64982102-64982124 AGCTTCCAGAGCACTCCAGCAGG + Intergenic
1069582412 10:69574814-69574836 GGTTTCCAGAGAGCGCTACCAGG - Intergenic
1069893992 10:71669177-71669199 GGCTTCCTGAGGCCTTCTCCAGG + Intronic
1070623200 10:78029650-78029672 GGCTTCCAGTAAGCGCCACCAGG - Intergenic
1071119604 10:82262041-82262063 AGCTTCCTGAGGCCTTCACCAGG + Intronic
1073139838 10:101239807-101239829 GTCTTTCAGAGCCCACCACCTGG + Intergenic
1073254234 10:102140850-102140872 GCCTTCCAGAGACTCCCACAGGG + Exonic
1074070149 10:110059489-110059511 GGATTACAGACACCTGCACCCGG - Intronic
1074707486 10:116147872-116147894 GGCTTTCTGACACCTCCACTGGG - Intronic
1075655037 10:124155828-124155850 GGTGTCCAGAGACCCCCACCAGG + Intergenic
1076394619 10:130129658-130129680 GGTTTACAAAGACCCCCACCAGG + Intergenic
1076461560 10:130650663-130650685 GACTTGCAGAGGCCTCCAGCGGG + Intergenic
1083829515 11:65222475-65222497 GGCTTCCAGAGTCATCCCGCTGG + Intergenic
1084556506 11:69879218-69879240 GCCTTCCAGAGCCTTCCACTGGG - Intergenic
1084563350 11:69916176-69916198 GGCATCCAGAGGCCTCCAGCTGG + Intergenic
1084682953 11:70677715-70677737 GGCTTCCGGAGCCCTCAACAGGG - Intronic
1084953227 11:72678101-72678123 GGCTTCCAAAGACATCTATCTGG + Intergenic
1085527436 11:77172553-77172575 GGACTCCAGATACCTCCTCCAGG - Intronic
1086240854 11:84688849-84688871 GGATTTCATAGTCCTCCACCAGG - Intronic
1089536098 11:119161558-119161580 GACTTCCAGTGGACTCCACCAGG - Exonic
1089564452 11:119363636-119363658 GACTTCCTCGGACCTCCACCCGG + Intronic
1090643676 11:128750153-128750175 GCCTTCCAGAGCCCTGCACTGGG + Intronic
1091180557 11:133600573-133600595 GGCTTCCGTATACCACCACCTGG - Intergenic
1092120245 12:6038541-6038563 GGCTTCCATAGACCCACACCTGG - Intronic
1093387844 12:18581676-18581698 GGCTTCCAGAGACGTCAAGTAGG + Intronic
1098445623 12:70563061-70563083 GGATCACAGAGAACTCCACCAGG - Exonic
1102888384 12:116538774-116538796 TGCTGCTAGAGACCACCACCGGG + Intergenic
1103702216 12:122853780-122853802 GGCTTCCAGAGACCTCCACCTGG - Intronic
1103990659 12:124797178-124797200 AGCTTCCAGAGTCCTCTTCCAGG - Intronic
1105068843 12:133221559-133221581 GGCTTCCAGAGACCAAGACACGG + Intronic
1106082499 13:26512022-26512044 TGCTTCCTGAGAGCTCCACAAGG + Intergenic
1106099008 13:26678824-26678846 GGCAGCCAGAGATCTGCACCAGG - Intronic
1106568548 13:30906850-30906872 GGCTCCCAGAGACCGCAGCCGGG - Intronic
1107037092 13:35912886-35912908 GGGTTGCAGAGAGCCCCACCTGG + Intronic
1107637333 13:42405977-42405999 GGCTTCCGGACACCTCCGCATGG + Intergenic
1108644435 13:52412358-52412380 CCCTTCCAAAGCCCTCCACCAGG + Intergenic
1112611627 13:100960563-100960585 GGCCTCCAGAGACCTTCTCAGGG + Intergenic
1112865974 13:103898690-103898712 GGCTTACAGTGACCTCTGCCTGG - Intergenic
1113138028 13:107115357-107115379 CACTTCCAGATACCTCCACCTGG + Intergenic
1113549928 13:111184862-111184884 TGCTTCTAGAGCCCTCCATCCGG - Intronic
1114015391 14:18424122-18424144 GGATTCCAGAGAACTGCTCCTGG - Intergenic
1114027171 14:18538452-18538474 GGATTCCAGAGACCTGCTTCTGG + Intergenic
1116470637 14:45281895-45281917 GCCTTTTAGAGACCTCCCCCTGG - Intergenic
1117554316 14:56868994-56869016 AGCTTCTAGAGACCGCGACCCGG + Intergenic
1119214357 14:72857037-72857059 CTCTTCCAGGGACCTCCTCCAGG - Intronic
1119471399 14:74902300-74902322 GGATCCCAGAGTCCTCCTCCTGG + Exonic
1121231017 14:92358532-92358554 GCCTCCCAGACACCTCCTCCTGG + Intronic
1121562939 14:94887768-94887790 GGCCTCCGGAGAGCTCAACCCGG - Intergenic
1122364302 14:101185393-101185415 GGCTTCCAGAGATATTCAACTGG + Intergenic
1122748834 14:103918162-103918184 GGCTTCCAGAAACCTCCTCTGGG - Intronic
1124555259 15:30719402-30719424 GGCTTCCAGCCACCTCCATTTGG - Intronic
1124675996 15:31686279-31686301 GGCTTCCAGCCACCTCCATTTGG + Intronic
1125280168 15:38034736-38034758 GCCTACCAGACAGCTCCACCAGG + Intergenic
1128657074 15:69470198-69470220 CACTTCCAGAGCCCTCCAACTGG - Intergenic
1130865744 15:87932004-87932026 GGGTTCCAAAGACCTTCACATGG + Intronic
1131396866 15:92093243-92093265 AGCTTCTGGAGACCTTCACCAGG - Intronic
1133337859 16:5017758-5017780 GGGTCCCCGAGACCTCCACATGG - Exonic
1137634366 16:49973268-49973290 GGCCTCAAGACACCTTCACCTGG + Intergenic
1139504612 16:67392732-67392754 GGCTTCCAGTGACCACGGCCTGG + Intronic
1139697858 16:68687891-68687913 GAATTTCAAAGACCTCCACCAGG - Intronic
1139697903 16:68688180-68688202 GAATTCCAAAGACCTCCACCAGG + Intronic
1139921748 16:70464924-70464946 GGATCCCAGGGCCCTCCACCTGG - Intronic
1141661918 16:85446110-85446132 TGCTTCCAGAGAGCCCCGCCTGG + Intergenic
1141921774 16:87140317-87140339 GGACTCCAGAGCCCACCACCTGG - Intronic
1142671473 17:1489343-1489365 GGCTGCCAGACACCTCTGCCTGG + Intronic
1144045802 17:11453402-11453424 TGCTTCCAGAGACCCTCAGCGGG + Intronic
1149825794 17:59826830-59826852 GGCTTCCAGAGTGCTCCCTCAGG - Intronic
1150721097 17:67615013-67615035 GGCTTCCAGAGCCCTTCCCAGGG - Intronic
1152463450 17:80453075-80453097 GACTTCCAGAGACCCCACCCTGG + Intergenic
1155177498 18:23313676-23313698 GGCTTCCTGAGTGATCCACCTGG + Intronic
1156154824 18:34288949-34288971 AGCTTCCTGAGATCTTCACCAGG - Intergenic
1156492394 18:37503975-37503997 GGCTTCCAGAGAGCCCCTCCTGG + Intronic
1157330373 18:46699814-46699836 GCCCTCCAGGAACCTCCACCTGG + Intronic
1157601229 18:48894299-48894321 GCCTCCCAGGGCCCTCCACCTGG - Intergenic
1157985760 18:52435865-52435887 GACTTCCTGAGATCTCCCCCTGG - Intronic
1158627563 18:59084820-59084842 GAATGCCAGAGACCTCCACACGG - Intergenic
1158691298 18:59663580-59663602 TGCTTACAGAGACATCCTCCTGG - Intronic
1160038717 18:75323956-75323978 GGCTTCCAGATACCTCATACTGG + Intergenic
1160750154 19:730169-730191 GGCTCCCAGACACCTCCTGCAGG + Intronic
1161202869 19:3025570-3025592 GGCGTGCTGAGATCTCCACCTGG - Intronic
1163139116 19:15334088-15334110 GGCTTCCAAAGCACCCCACCTGG + Intergenic
1167247320 19:48381468-48381490 GGCTTCCAGAGCCAGCCTCCAGG + Intergenic
1202651002 1_KI270707v1_random:3507-3529 GGATTCCAGAACCCTCCAGCTGG + Intergenic
925625486 2:5838793-5838815 GGTTGCCAGAGTCATCCACCTGG + Intergenic
925987803 2:9230410-9230432 GGCTTCCAGAAACCTCGGCTTGG - Intronic
926624603 2:15080706-15080728 AGCTTCCAGCCACCCCCACCAGG - Intergenic
927001818 2:18803438-18803460 GTCTACCTGAGAACTCCACCTGG + Intergenic
927812576 2:26188062-26188084 GACTGCGAGAGACCTCCTCCAGG - Exonic
930167633 2:48219095-48219117 TGCTTCCAGATACCTTGACCTGG - Intergenic
932218541 2:69982893-69982915 GGGTTCCAGAGGCCCCCACAGGG - Intergenic
933535473 2:83567702-83567724 GGAATCCAGAGTCCTCCTCCAGG + Intergenic
934859879 2:97755675-97755697 GGCCCCCAGAGCCCTCCCCCAGG + Intergenic
936145596 2:109978580-109978602 GGCTTACAGAGACCCCCCCTAGG - Intergenic
936199090 2:110392898-110392920 GGCTTACAGAGACCCCCCCTAGG + Intergenic
938406762 2:131037114-131037136 GACCTCCAGAGGCCTCCACGGGG - Intronic
939054737 2:137350996-137351018 GTCTACCAGAGATCTCCACTAGG - Intronic
946037806 2:216757683-216757705 GTCTCCCAAAGACCTCAACCTGG + Intergenic
946811587 2:223531074-223531096 GGGTTGCAGACACCTCCACCTGG + Intergenic
947592740 2:231394866-231394888 GACTTCCAGAATCCTCCAGCAGG - Intergenic
948095100 2:235327236-235327258 GGCCTCCCCAGGCCTCCACCAGG + Intergenic
948408836 2:237743385-237743407 AGTGTCCAGAGACCACCACCAGG + Intronic
948486279 2:238283273-238283295 GCCTTACAGAGACATCCAGCTGG - Intronic
948599481 2:239100186-239100208 GAATTCCAGACACCTCCTCCTGG + Intronic
949004728 2:241638954-241638976 GGCAGCCAGAGACCTCCGGCTGG + Intronic
1169504878 20:6198782-6198804 GGATTCCTGAGGCCTTCACCAGG - Intergenic
1170025254 20:11882135-11882157 AGCTTACTGAGACCTCCACCTGG - Intergenic
1170038678 20:12017529-12017551 GGCTTCCAGTGACCTGCATTAGG + Intergenic
1170871111 20:20207467-20207489 GGCTTCCAGAGCTCTGCAGCAGG - Intronic
1171837197 20:30168157-30168179 TGCTTCCAGCGAACTCCGCCTGG + Intergenic
1172025413 20:31945156-31945178 GCCTTGCAGAGTCCTGCACCAGG - Exonic
1173082054 20:39877704-39877726 GGCTTCCACAGACATCCATGTGG - Intergenic
1174056543 20:47802272-47802294 GGCTTCCGGAAACTTCCATCAGG + Intergenic
1174161567 20:48554608-48554630 GGCTTCCTGGAATCTCCACCAGG - Intergenic
1175264036 20:57691914-57691936 TGCTTCCTGAAACCTCCCCCTGG + Intronic
1176523015 21:7838805-7838827 GGTCTCCAGAGACCTCCCACAGG + Intergenic
1176601123 21:8795988-8796010 GGATTCCAGAACCCTCCAGCTGG - Intergenic
1178657035 21:34468817-34468839 GGTCTCCAGAGACCTCCCACAGG + Intergenic
1179419873 21:41226963-41226985 CTATTCCAGAGACCTCCATCAGG - Intronic
1179658416 21:42859898-42859920 TGCGTCCAGGGGCCTCCACCTGG - Intronic
1179977258 21:44875085-44875107 GGCTGCCAGAGACCCCGGCCAGG - Intergenic
1180343409 22:11687525-11687547 GGATTCCAGAACCCTCCACCTGG - Intergenic
1180439890 22:15354899-15354921 GGATTCCAGAGAACTGCTCCTGG - Intergenic
1181078237 22:20395490-20395512 GCCTTCCACAGACCTTCACCCGG + Intronic
1181931212 22:26403078-26403100 GGCTTCCAGAGAACCAAACCAGG + Intergenic
1182083100 22:27543100-27543122 GGCCTCCAGGGACCCCCACCTGG + Intergenic
1183046677 22:35226175-35226197 GGCTTCCAGAGACACTCAGCGGG - Intergenic
1183735616 22:39643328-39643350 GAATTCCAGGGAGCTCCACCGGG - Intronic
1184369581 22:44074136-44074158 GGTTTCCAGAGACCCCTTCCAGG - Intronic
1185254588 22:49825303-49825325 TGCTTGCAGAGACCCTCACCAGG + Intronic
949675392 3:6447626-6447648 GGGTCACAGACACCTCCACCTGG - Intergenic
950079207 3:10209170-10209192 GCCTTCCAGAAACCTCCACCAGG - Intronic
950786863 3:15444254-15444276 TGCTTCCAGCCACCTCCACCAGG - Intronic
950813546 3:15673918-15673940 GCCTCCCAGAGTGCTCCACCTGG - Intronic
953555890 3:43946457-43946479 AGCTCCCAGAGACATCAACCCGG - Intergenic
954628275 3:52034763-52034785 GGCCTCCAAAGACCTCCACCTGG + Intergenic
957189160 3:76984116-76984138 GGGATCCAGTTACCTCCACCTGG + Intronic
957531077 3:81441535-81441557 AGCTTCCTGAGGCCTTCACCAGG + Intergenic
957859919 3:85933445-85933467 GGCTTCCTGAGATTACCACCTGG + Intronic
963855040 3:150244645-150244667 GGCTTCCAGAAAGCTTCCCCTGG - Intergenic
964257818 3:154797202-154797224 GGCTTCCAGAGAGCTAAACATGG - Intergenic
964282393 3:155080266-155080288 GACTTCCAGAGCCCTCCTCCAGG - Intronic
968163977 3:196449639-196449661 GGCTCCCTGCAACCTCCACCTGG + Intergenic
970755151 4:19416933-19416955 TGCTTCCAGAGAACTCAACCTGG - Intergenic
970962648 4:21890990-21891012 CTCTTCCAGCAACCTCCACCTGG + Intronic
974899676 4:67981910-67981932 GGTCTCCAGACACCTCCAACAGG - Intergenic
976155914 4:82144699-82144721 GGCTCCCAGAGATCCCCAGCAGG + Intergenic
976245644 4:83003596-83003618 GGCTCACAGCAACCTCCACCTGG + Intronic
979562669 4:122118022-122118044 GTATTCCAGAGCTCTCCACCAGG + Intergenic
979820081 4:125160480-125160502 AGCTTCCTGAGACCCTCACCAGG - Intergenic
981877705 4:149568217-149568239 GCCTTCCAGAGACCGTGACCTGG - Intergenic
982217952 4:153098869-153098891 GTTTTCTAGAGACCTGCACCTGG + Intergenic
986287387 5:6369966-6369988 GCCTTCCAGAGCTCTCCACCCGG - Intergenic
987089568 5:14498898-14498920 GGCAGCCAGAGGCCTTCACCAGG - Intronic
990665078 5:58062894-58062916 GGAATCCAAAGACCACCACCAGG - Intergenic
992299675 5:75365369-75365391 GCCTTCCAGAGACCTCAGTCTGG - Intergenic
992549131 5:77844857-77844879 GGCTTCGAGAGACATCCACGCGG - Intronic
995541254 5:113188192-113188214 GGCATCCAGAGACAACCACAAGG - Intronic
997431896 5:133846704-133846726 GCCCTCCAGAGAGCTCCAACAGG + Intergenic
998050413 5:139028038-139028060 GCCATCCAGAGACCTCTAGCTGG - Intronic
999096562 5:148983489-148983511 GGTTTCTTGGGACCTCCACCTGG - Intronic
999272444 5:150304507-150304529 TGCTTCCAGAGGCTTCCACAAGG + Intronic
1001828927 5:174768813-174768835 GGCTCACTGAAACCTCCACCAGG - Intergenic
1003571736 6:7260706-7260728 GGGCTCCAGACATCTCCACCTGG - Intergenic
1005855842 6:29862772-29862794 GCCTGCAAGAGGCCTCCACCTGG - Intergenic
1006068498 6:31479534-31479556 GTCTGCCAGAGACCTCCACCTGG + Intergenic
1007107388 6:39293136-39293158 GGCTTGCAGAGGTCTCCAGCGGG + Intergenic
1008787121 6:55182213-55182235 GGCTTCCAATGACCGCCCCCGGG + Intronic
1012387544 6:98699535-98699557 TGCTTCCATAGACCTACACCTGG - Intergenic
1013105736 6:107025443-107025465 GGTTTCCAGGGACCTCATCCGGG + Intergenic
1013901308 6:115160139-115160161 AGCTTCCAGAGGCCTCCTTCAGG - Intergenic
1014113212 6:117644638-117644660 GGCTCCCAGGGACCTTAACCAGG + Intergenic
1017540315 6:155395535-155395557 TGATTCCAAAGAACTCCACCAGG - Exonic
1018751859 6:166813319-166813341 TGCTTCCAGGGAGCTCCACATGG - Intronic
1021247482 7:18281462-18281484 GGTTTCCTGAAACCTTCACCAGG - Intronic
1025030747 7:55554727-55554749 GTCTAACAGAGACCTCCTCCAGG - Intronic
1025236452 7:57237888-57237910 GGCTTCCAGAAACTTCCATCAGG - Intergenic
1025756868 7:64352340-64352362 GGCTTCCAGCTACCTCCTACAGG - Exonic
1029226770 7:99034181-99034203 GGCCTTCAGAGACCTCCTGCAGG + Intronic
1029361086 7:100089087-100089109 GGCTTCCGGAGACCTCCTTCAGG + Intronic
1029513419 7:101010988-101011010 GACTTCCAGTGACATCCAACTGG - Intronic
1031573901 7:123392687-123392709 GTCTTCCATTGGCCTCCACCTGG - Intergenic
1032388523 7:131540758-131540780 GGCCTCTGGAAACCTCCACCAGG + Intronic
1034446893 7:151118357-151118379 GGCTGCCAGTGACTCCCACCCGG - Intronic
1034572821 7:151970646-151970668 AGCTTCCTGAGGCCCCCACCAGG + Intronic
1036016720 8:4793499-4793521 GGTTCCCAGACACCTACACCAGG + Intronic
1036676381 8:10837338-10837360 AGCTTCCAGAGCCCTCCCCCAGG - Intronic
1037433753 8:18841696-18841718 GTTTTCAAGAGACCTCCATCTGG + Intronic
1037831896 8:22194666-22194688 GGCTGCCAGAGACCCACCCCTGG - Intronic
1037835062 8:22210818-22210840 TTCTTCCAGAGACCTCCCCCAGG + Intronic
1039013271 8:33118856-33118878 GCATTTCAGTGACCTCCACCCGG + Intergenic
1039159112 8:34596865-34596887 GGCTTCCTGAGTCCCTCACCAGG - Intergenic
1039859010 8:41440396-41440418 AGCTTCCTGAGGCCTCAACCAGG - Intergenic
1040817735 8:51526841-51526863 GCCTACCAGACATCTCCACCTGG + Intronic
1041437772 8:57861329-57861351 GGCTTGCAGAGACCTGCAGGAGG - Intergenic
1041756818 8:61323110-61323132 GGCTTCCAGAAAAAGCCACCTGG - Intronic
1042129601 8:65574384-65574406 AGCTTCCTGAGACCCTCACCAGG + Intergenic
1042225001 8:66508357-66508379 GGCTACCAGAGAGGTCCACTTGG + Intronic
1043848818 8:85192307-85192329 GGCTGCCAGAGACCTACCCTAGG - Intronic
1044018290 8:87073732-87073754 GGCCTCCAGACACCTCCTACAGG - Intronic
1044790756 8:95844488-95844510 AGCCTCCAGTGACCTCTACCTGG - Intergenic
1047532108 8:125686078-125686100 AGCTACCAGAGACTTCAACCAGG - Intergenic
1047901028 8:129422706-129422728 GACTTACAGAGACATCCAACAGG + Intergenic
1048197448 8:132343743-132343765 TGCTTGTGGAGACCTCCACCTGG + Intronic
1048217711 8:132511825-132511847 GACTTCCACAGGCATCCACCAGG + Intergenic
1048380606 8:133861905-133861927 TGCTTCCAGAGAACTCAAACTGG - Intergenic
1049256585 8:141617320-141617342 GGCCTCCAGAGACTTCCAGGGGG - Intergenic
1049366411 8:142238949-142238971 GGCTTCCACAGAATCCCACCGGG + Intronic
1049453429 8:142675079-142675101 GTCATCCAGAGACCTCCAGAAGG - Intronic
1049511890 8:143031643-143031665 GTCTTTCAGAAACCCCCACCCGG + Intergenic
1049690775 8:143957933-143957955 TGCTGGCAGATACCTCCACCTGG + Intronic
1049743120 8:144250427-144250449 TGCTCCCCGAGCCCTCCACCCGG + Intronic
1052501450 9:29296431-29296453 AGCTTCCTGAGGCCTGCACCAGG + Intergenic
1054842323 9:69756622-69756644 GGGAGCCAGAGACCTCCACAGGG - Intronic
1055156816 9:73072874-73072896 AGCTTCCTGAGACCCTCACCAGG + Intronic
1057752225 9:97802408-97802430 GGCTTCCAGGGGCCTCCCACTGG + Intergenic
1058001995 9:99875468-99875490 TGCCTCCAGATACCTTCACCTGG + Intergenic
1059506558 9:114804488-114804510 GGCCTCCAGAAACCTGCACTGGG - Intronic
1060209881 9:121703155-121703177 AGCTTCCAGGGACCCTCACCTGG + Intronic
1060532379 9:124355440-124355462 GGCTTTCAGAGTCCTCGCCCAGG + Intronic
1060867372 9:127010997-127011019 GGCTCCCCGAGACCTCCTCTGGG + Intronic
1061304692 9:129725519-129725541 ATCTTCCAGAGGCTTCCACCAGG - Intergenic
1061716450 9:132521319-132521341 TTCTTCCAAAGACCTCCTCCTGG + Intronic
1185917028 X:4047109-4047131 GGGTCCCAGAGACCACCCCCAGG + Intergenic
1189374408 X:40455510-40455532 AGCTTCCTGAGACCCTCACCAGG - Intergenic
1189834904 X:45009757-45009779 GTCTCCCAGAGATCTCCAGCAGG + Intronic
1192173002 X:68868316-68868338 GGCTGCCTCAGACCTCCTCCTGG + Intergenic
1195384925 X:104305142-104305164 GCCTTCCAAAGGCCTCCAGCAGG + Intergenic
1196641146 X:118062818-118062840 GACTTACAGAGACCTGAACCAGG + Intronic