ID: 1103703168

View in Genome Browser
Species Human (GRCh38)
Location 12:122858427-122858449
Sequence CTGGCTACACTCACCTGCCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 193}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103703168_1103703179 -4 Left 1103703168 12:122858427-122858449 CCTTGGCAGGTGAGTGTAGCCAG 0: 1
1: 0
2: 1
3: 15
4: 193
Right 1103703179 12:122858446-122858468 CCAGGGCAGGGCGGAGGCGGGGG 0: 1
1: 1
2: 14
3: 144
4: 1182
1103703168_1103703177 -5 Left 1103703168 12:122858427-122858449 CCTTGGCAGGTGAGTGTAGCCAG 0: 1
1: 0
2: 1
3: 15
4: 193
Right 1103703177 12:122858445-122858467 GCCAGGGCAGGGCGGAGGCGGGG 0: 1
1: 1
2: 9
3: 109
4: 1128
1103703168_1103703180 22 Left 1103703168 12:122858427-122858449 CCTTGGCAGGTGAGTGTAGCCAG 0: 1
1: 0
2: 1
3: 15
4: 193
Right 1103703180 12:122858472-122858494 TGTCCCAGTTCCAGCGCCCATGG 0: 1
1: 0
2: 1
3: 10
4: 176
1103703168_1103703175 -7 Left 1103703168 12:122858427-122858449 CCTTGGCAGGTGAGTGTAGCCAG 0: 1
1: 0
2: 1
3: 15
4: 193
Right 1103703175 12:122858443-122858465 TAGCCAGGGCAGGGCGGAGGCGG 0: 1
1: 0
2: 4
3: 70
4: 678
1103703168_1103703174 -10 Left 1103703168 12:122858427-122858449 CCTTGGCAGGTGAGTGTAGCCAG 0: 1
1: 0
2: 1
3: 15
4: 193
Right 1103703174 12:122858440-122858462 GTGTAGCCAGGGCAGGGCGGAGG 0: 1
1: 0
2: 1
3: 35
4: 403
1103703168_1103703176 -6 Left 1103703168 12:122858427-122858449 CCTTGGCAGGTGAGTGTAGCCAG 0: 1
1: 0
2: 1
3: 15
4: 193
Right 1103703176 12:122858444-122858466 AGCCAGGGCAGGGCGGAGGCGGG 0: 1
1: 0
2: 14
3: 146
4: 1203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103703168 Original CRISPR CTGGCTACACTCACCTGCCA AGG (reversed) Exonic
900726980 1:4222970-4222992 CAGGCTACACACACCTTCCTGGG - Intergenic
900758552 1:4454739-4454761 CTGACACCTCTCACCTGCCAGGG + Intergenic
902787634 1:18743409-18743431 TTGGCTCCACCCACCTGCCCTGG + Intronic
904469999 1:30730276-30730298 CAGGCTGCCCTCACCTGCCCAGG + Intergenic
905365541 1:37449196-37449218 CTGGGTGCACACAGCTGCCAGGG + Intergenic
905494782 1:38376305-38376327 TAGGCTACACTCTCTTGCCATGG + Intergenic
905508996 1:38503498-38503520 CTGGCCACACACAACAGCCAGGG + Intergenic
907243987 1:53095729-53095751 CTCGGTACACTCAACTGCCTCGG + Intronic
907796082 1:57719134-57719156 CTGGATTCACTCAGCGGCCATGG - Intronic
907917135 1:58881585-58881607 CTGGGCACACCCACCTGGCAGGG + Intergenic
908390858 1:63682409-63682431 CTGGCTACCCTGGCCTGTCATGG + Intergenic
909662304 1:78097623-78097645 CTAGCTACACTCCACTTCCAGGG + Intronic
911610210 1:99951916-99951938 CTGGGTCCACTCACCTGGTACGG - Intergenic
914323878 1:146592071-146592093 ATGGCTAGACTCAACTGGCAAGG - Intergenic
917710692 1:177681121-177681143 CTGGCTCCACTCACCCGTTAGGG - Intergenic
922719978 1:227895380-227895402 CTGGCTAAACCCACCTCACAGGG + Intergenic
922749600 1:228064372-228064394 ATGGCCTCCCTCACCTGCCAAGG + Intergenic
922767587 1:228163919-228163941 CTGGCTAAACCCACCTCACAGGG - Intergenic
1065195286 10:23258290-23258312 GTGGCTACACTCACCTCCTAAGG + Intergenic
1065206729 10:23364113-23364135 CTGGCTACCCCTACCTGCAAGGG + Intergenic
1065552680 10:26885017-26885039 ATGGCCACACTGACCTGCAAGGG + Intergenic
1065600363 10:27361799-27361821 ATGGCCACACTGACCTGCAAGGG - Intergenic
1067289369 10:44930046-44930068 CAGCCTGCATTCACCTGCCATGG - Intronic
1068192023 10:53664955-53664977 CTGGCAACACTCAGCTGCTAAGG - Intergenic
1070644686 10:78193571-78193593 CTGGCCACACCTACCTGCAAGGG + Intergenic
1070799199 10:79235208-79235230 CTGGCTCCCCTCATCTGCCATGG + Intronic
1070804629 10:79263909-79263931 CTGCCTACACCCACCTGGGAAGG + Intronic
1072913986 10:99526181-99526203 CTGGCTTCTCACACCAGCCAAGG - Intergenic
1073076297 10:100827398-100827420 CTGGCTCCACTGCCCAGCCAAGG + Intronic
1073350066 10:102813231-102813253 CTGGGCACCCGCACCTGCCACGG + Exonic
1074441633 10:113482326-113482348 CTGGCTATAGTTACCTGCAAAGG + Intergenic
1080690271 11:34550986-34551008 CTTGTTACAGTCACCTGGCATGG + Intergenic
1083207489 11:61161377-61161399 CAGTCTCCGCTCACCTGCCAGGG + Exonic
1083709609 11:64539900-64539922 CTGGGTACCTTCGCCTGCCAAGG - Intergenic
1083718111 11:64590810-64590832 CTGCCTCCACTCACCTGCTGTGG - Exonic
1083724737 11:64622277-64622299 CTGGATGCAGTCACCTGGCATGG - Intronic
1083738983 11:64697761-64697783 GAGGCTTCACTCACCTTCCATGG + Exonic
1083935646 11:65868509-65868531 CTGGCCACACGCCTCTGCCAAGG - Exonic
1084685198 11:70689609-70689631 CTGGCAATTCTCACCTGCCAGGG + Intronic
1085413037 11:76302828-76302850 CTTTCCACACTCCCCTGCCAGGG + Intergenic
1085539375 11:77252965-77252987 CGGCCTACAATCAACTGCCATGG + Intronic
1086371083 11:86156476-86156498 CTGTCTGCCCTCACCTGCTAGGG + Intergenic
1086555234 11:88102519-88102541 ATGGCTATACTCATCTGCAAGGG + Intergenic
1088322578 11:108568885-108568907 CAGGCTTCACTCACCACCCATGG + Intronic
1089624544 11:119742826-119742848 CTGCCTAAACTCTCCTGCCCTGG - Intergenic
1090463272 11:126910799-126910821 CAGGCTCCATTCACCTGCTAGGG + Intronic
1090939978 11:131378941-131378963 CTGGCTCCACTCACATGGCCAGG + Intronic
1092669936 12:10851487-10851509 CTTCCTGCACTCACCAGCCAAGG - Intronic
1093958527 12:25249849-25249871 CTGTCTACACTCAACTAGCAAGG + Intronic
1094490411 12:30957333-30957355 CTGACTTGTCTCACCTGCCACGG - Intronic
1098921119 12:76303091-76303113 CTGGCTATACTCACTTCCTAGGG + Intergenic
1101958553 12:109231205-109231227 CTGGCTACATCCCCCTGCGATGG + Intronic
1103405442 12:120671702-120671724 CTGGCTACCCTCAGCTGCCTGGG - Intergenic
1103703168 12:122858427-122858449 CTGGCTACACTCACCTGCCAAGG - Exonic
1104273781 12:127306209-127306231 CTGGGGATTCTCACCTGCCACGG - Intergenic
1104924448 12:132306577-132306599 CTGGGTACCCCCACCTGCCCCGG + Intronic
1106968800 13:35109421-35109443 CTGGATACATACACCTGCAAAGG + Exonic
1108881251 13:55120113-55120135 CTGGCTATAATCACCCACCATGG + Intergenic
1113102374 13:106734620-106734642 CTGGCCTCATTCACCTGCCAAGG - Intergenic
1113433625 13:110271439-110271461 CTGGCATCACACACCTCCCAAGG + Intronic
1113651000 13:112034203-112034225 CTGTCTGCACTCACCGCCCAGGG + Intergenic
1113941307 13:114019827-114019849 CAGGCTCCACCCACCTGACAGGG - Intronic
1113941328 13:114019907-114019929 CAGGCTCCACCCACCTGACAGGG - Intronic
1113941361 13:114020026-114020048 CAGGCTCCACCCACCTGACAGGG - Intronic
1113941394 13:114020145-114020167 CAGGCTCCACCCACCTGACAGGG - Intronic
1113941415 13:114020225-114020247 CAGGCTCCACCCACCTGACAGGG - Intronic
1115711883 14:36059681-36059703 CTGTCTGCCCTCACCAGCCAAGG + Intergenic
1118090194 14:62466343-62466365 GTGGCTAAACTCAGCTTCCAAGG - Intergenic
1119499710 14:75114248-75114270 CTGGCTAGAGTCAACTTCCATGG + Exonic
1122134681 14:99626034-99626056 CTGGCTGCACCCACCTGACGGGG - Intergenic
1122928907 14:104924309-104924331 ATGGCTACACTTAGCTGCAAGGG - Intergenic
1202829422 14_GL000009v2_random:10534-10556 ATGACTACATTCAACTGCCATGG - Intergenic
1123484202 15:20671112-20671134 CTGGATACATACACCTGCAAAGG - Intergenic
1124396720 15:29308613-29308635 CTGCCTCCAGTCACCTGCAAGGG - Intronic
1124845151 15:33282841-33282863 CCTGCTACACTCACCTGTCCAGG - Intergenic
1126574130 15:50181618-50181640 CTGCCCTCACTCACCTGGCAGGG + Intronic
1129075178 15:72988884-72988906 CTGCCTGCATTCACTTGCCAGGG - Intergenic
1129144851 15:73637393-73637415 CTGGCAACACTCAGCTGCTCAGG - Intergenic
1129607821 15:77033352-77033374 CTGGCTGCAGTCAAGTGCCAAGG + Intronic
1134244687 16:12531310-12531332 CTGAGTTCACACACCTGCCAGGG - Intronic
1136028041 16:27482459-27482481 CTGACTACACTGTCCTGCAATGG + Intronic
1136455910 16:30379421-30379443 CTGGCCTCACTCACCCTCCACGG + Exonic
1137761683 16:50945980-50946002 CTGGCCACAATTACCTGCAAGGG - Intergenic
1137803293 16:51280762-51280784 CTGCATACTCTCACCTGTCAAGG + Intergenic
1137965730 16:52931425-52931447 CTGGCAACACTCAGTTGCTAAGG - Intergenic
1138439890 16:57027825-57027847 CTGGCCACACTGAGCTGCAAGGG + Intronic
1140009685 16:71118773-71118795 ATGGCTAGACTCAACTGGCAAGG + Intronic
1142525326 17:536194-536216 CAGGGTGCACTCACCTGCCTTGG + Intronic
1144220756 17:13097721-13097743 CTGGCTAAACTGACTTACCAGGG + Intergenic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1151160481 17:72160954-72160976 CTGGCTACCCTCACCACCAATGG + Intergenic
1151443680 17:74149774-74149796 CTGGCTGCGCTCAGCTGACAAGG + Intergenic
1152579521 17:81159905-81159927 CTGGCTCTACCCACCTGCCAGGG - Intronic
1153088699 18:1318910-1318932 CTGGCTACATTCACCAACCTTGG + Intergenic
1154374662 18:13799151-13799173 CTGGCTCCACTCACCTGAAGAGG - Intergenic
1156134261 18:34017719-34017741 CTGCCTACACTCTCCTTCAAAGG + Intronic
1160159454 18:76460215-76460237 CTGCCTGCACTCACCGTCCAGGG + Intronic
1160361864 18:78290179-78290201 CAGGCCACCCTCACCTGCCTGGG + Intergenic
1161358339 19:3832067-3832089 CCGGCTTCTCTCTCCTGCCATGG + Intronic
1162028789 19:7908655-7908677 ACGGCTACACACACCTACCAAGG - Intronic
1162790885 19:13062370-13062392 ATGGCTACACTGACCACCCAGGG - Intronic
1165765786 19:38350165-38350187 CTGGCTACATCCAACTGCAAGGG + Intronic
1167635845 19:50655119-50655141 ATGGCCACACTTACCTGCAAGGG + Intronic
1167942444 19:52958575-52958597 CTTGGCACACTCAACTGCCATGG - Intronic
1202643271 1_KI270706v1_random:117248-117270 ATGACTACATTCAACTGCCATGG + Intergenic
928167382 2:28981093-28981115 CTGGCTGCAGTCACCAGGCAGGG + Intronic
930059587 2:47277124-47277146 CTGGGGACAGCCACCTGCCAGGG - Intergenic
931226995 2:60340297-60340319 ATGGCTACACCCAACTGCAAGGG + Intergenic
934499162 2:94840746-94840768 ATGACTACATTCAACTGCCACGG + Intergenic
935218209 2:100990927-100990949 CTGGCCAGACTCACCCGCCTGGG + Intronic
939651629 2:144769830-144769852 CTGGCCACACCCTCCTGCCTGGG + Intergenic
939861965 2:147431737-147431759 CTGGCTCCACTCAGCTGCCTGGG - Intergenic
940005562 2:149006774-149006796 CTGGCTTCACTCTCCTGCCAGGG - Intronic
940344147 2:152612161-152612183 CTGGCTAAACTCTTCTGCAAGGG - Intronic
941185716 2:162319043-162319065 CTGCCTACATTCACCAGCCGAGG - Intronic
941774568 2:169378211-169378233 CTGTCTTCACTCACTAGCCATGG - Intergenic
945493389 2:210481568-210481590 TTGGCTACTCTCCCCTGCCAGGG - Intronic
946780319 2:223188056-223188078 CTGGGAACACTCACCTGGTAAGG - Intronic
1169920895 20:10733263-10733285 CTGGGCACACTCACATGCCTGGG + Intergenic
1171890396 20:30707451-30707473 ATGACTACATTCAACTGCCATGG + Intergenic
1175835409 20:61990656-61990678 ATGCCCACACTGACCTGCCAGGG + Intronic
1176608606 21:8855375-8855397 ATGACTACATTCAACTGCCATGG - Intergenic
1177518983 21:22192961-22192983 CTGGGCAGACTCAACTGCCAAGG + Intergenic
1179570018 21:42273223-42273245 CTGGCTCCCCTCTCCTGCCCCGG + Intronic
1180358691 22:11865190-11865212 ATGACTACATTCAACTGCCATGG - Intergenic
1180379575 22:12127141-12127163 ATGACTACATTCAACTGCCATGG + Intergenic
1181633689 22:24164555-24164577 GTGGCTGCACTCACTTGCCCTGG - Exonic
1183028504 22:35084446-35084468 CTGGCTTCACTCAGCTGCTGTGG - Exonic
1183751173 22:39721576-39721598 CTGGCTACTCTCCTGTGCCACGG - Intergenic
1184015472 22:41782772-41782794 CTGTCTGCAGTCACCTGCCTAGG + Intronic
1185175751 22:49325571-49325593 CTGGCTACACTGACCCAACAGGG - Intergenic
949528877 3:4933955-4933977 TTGGCTGCCCTCACCTGCAATGG - Intergenic
950578243 3:13846018-13846040 CTGGGGCCCCTCACCTGCCAAGG + Intronic
956240448 3:67124137-67124159 CTGGCTTCACTCAGCCCCCAAGG - Intergenic
960958090 3:123049086-123049108 CTGGCTACATTCAGCTCCCACGG + Intergenic
966800232 3:183756653-183756675 GTGGCTCCAATCACCTGCCCCGG - Exonic
968673653 4:1865453-1865475 CTGGCCAGACTCAACTGCAAGGG + Intergenic
969145729 4:5122805-5122827 CTTGCTGCACTCTCCTGCCTGGG + Intronic
971676036 4:29630795-29630817 CTGGCTAAACTCTCCTGCTGGGG + Intergenic
972635782 4:40882914-40882936 CTGGCCACACTCAGCTGCAAAGG - Intronic
975400410 4:73930698-73930720 CTGGCTACACTCAGCCTCTATGG - Intergenic
975728550 4:77316079-77316101 CTGGCAACCCTGACCTGTCATGG - Intronic
979357415 4:119721406-119721428 CTAGCTACACACACATACCATGG + Intergenic
980541910 4:134206986-134207008 TTGGGCACTCTCACCTGCCAGGG - Intergenic
981852462 4:149246950-149246972 CTGGCTACACTCACCAAAAATGG - Intergenic
981941209 4:150283236-150283258 GTGGCTTCACTCAGTTGCCAAGG - Intronic
984860959 4:184237787-184237809 TTGGCCACACTCACCTTCCGTGG + Intergenic
1202770644 4_GL000008v2_random:203159-203181 ATGACTACATTCAACTGCCATGG + Intergenic
985733740 5:1565644-1565666 CTGGCTACGCACACTGGCCAGGG + Intergenic
988589056 5:32533201-32533223 CTGGCTACACCTACTTGTCAGGG - Intronic
991029333 5:62066416-62066438 CTGGCTTCTGTCACCTGCCATGG - Intergenic
991311676 5:65249978-65250000 CTTGCCACACCCACCTCCCAAGG + Intronic
996669445 5:126100357-126100379 CTGGTCACACCCACCTGCAAGGG + Intergenic
998138322 5:139686031-139686053 CTGGGTACACAACCCTGCCAGGG - Intergenic
999127251 5:149254750-149254772 CTGGCTTCACTGAGCTGCCCTGG - Intronic
1003173502 6:3738043-3738065 CTGGCCACACTCACTTTACAGGG + Exonic
1003308862 6:4951566-4951588 CTGGCTACAGTCACCTCACACGG - Intronic
1006343300 6:33459265-33459287 CTGGCTAACCTCACCAGACAAGG + Intergenic
1010016100 6:71106214-71106236 CTGGCTTCACACACCTCTCATGG - Intergenic
1013542850 6:111128342-111128364 CTGGCATCACTGACCTGCTACGG - Intronic
1017588120 6:155948555-155948577 CCAGCCACACTCACCTGTCAGGG - Intergenic
1018692608 6:166360769-166360791 CAGGGGACACTGACCTGCCAGGG + Intergenic
1026426489 7:70299649-70299671 CGTGCTTCCCTCACCTGCCAAGG + Intronic
1027755939 7:82212122-82212144 CTGGCTAAATTCTCCTGCCCTGG - Intronic
1028126423 7:87118440-87118462 CTGAATACACTCACATTCCATGG + Intergenic
1028210535 7:88069017-88069039 CTGGCTGCACTCACAGGCCTGGG + Intronic
1029440831 7:100585867-100585889 CCGGCTGCACTCACCAGCCTGGG + Exonic
1030192394 7:106822561-106822583 CTGGCTACAGTCACCTCTGAGGG + Intergenic
1033656641 7:143380028-143380050 CCGGCTACACTCTACTGGCAAGG - Intergenic
1034486550 7:151368400-151368422 CTGGCTACACCCAGCTGCAAGGG + Intronic
1034893855 7:154862728-154862750 CTGGCATCAAACACCTGCCATGG + Intronic
1035163190 7:156966462-156966484 CTGGCTCAACCCACCTGCAAAGG + Intronic
1035241909 7:157537764-157537786 CTGGCTAAACCCACCTAACAGGG - Intergenic
1036387378 8:8294218-8294240 CTGGGCACCCTCAGCTGCCATGG + Intergenic
1037611220 8:20477970-20477992 CTTGCTCCACTTGCCTGCCATGG + Intergenic
1041847838 8:62352039-62352061 CTGGCAACACTAACCAGGCAGGG + Intronic
1045724413 8:105155470-105155492 CTGGCTCCACTCCCCTACCCAGG + Intronic
1049710022 8:144059252-144059274 TTGGCTGCACTCAGCTGCCTAGG - Intronic
1049932721 9:471861-471883 CTAGCAACACCCACCTACCATGG - Intronic
1050331886 9:4554204-4554226 CTGGCAACACTCTGCTGCCAAGG + Intronic
1051097627 9:13484487-13484509 CTGGCTACAGGGACCTGACAAGG + Intergenic
1052893130 9:33721851-33721873 CTGCCAGCACTCACCTGCCGAGG + Intergenic
1053657994 9:40239798-40239820 ATGACTACATTCAACTGCCATGG - Intronic
1053908363 9:42869072-42869094 ATGACTACATTCAACTGCCATGG - Intergenic
1054358498 9:64088743-64088765 ATGACTACATTCAACTGCCATGG - Intergenic
1054370115 9:64386074-64386096 ATGACTACATTCAACTGCCATGG - Intronic
1054526602 9:66136423-66136445 ATGACTACATTCAACTGCCATGG + Intronic
1054677746 9:67875828-67875850 ATGACTACATTCAACTGCCATGG - Intronic
1057475162 9:95393729-95393751 CTGGCTGTAGTCACCTGTCAGGG + Intergenic
1057942194 9:99295017-99295039 ATGGCTACCCTCAGCTGCAAGGG - Intergenic
1058577727 9:106421563-106421585 CTAGCTACATTCACTTACCATGG + Intergenic
1059306917 9:113360957-113360979 CTGGCTACACTGACTTAGCAGGG - Intronic
1060196544 9:121627671-121627693 TTGGCTAGACTCTGCTGCCAGGG - Intronic
1061032532 9:128094477-128094499 CTGGCTACACTAGGCTGTCATGG + Intronic
1062014298 9:134283522-134283544 CTGGGCACACTCACTCGCCAAGG - Intergenic
1062314928 9:135962226-135962248 CTGGCTAAACCGACCTGACAGGG - Intergenic
1203704004 Un_KI270742v1:20589-20611 ATGACTACATTCAACTGCCATGG - Intergenic
1203560007 Un_KI270744v1:45234-45256 ATGACTACAATCAACTGCCATGG + Intergenic
1185931852 X:4212350-4212372 CTGCATGCACTCACCTGCAATGG + Intergenic
1186641426 X:11460026-11460048 CTGCCTACACTCACATGGGAAGG - Intronic
1187549749 X:20290366-20290388 CTGGCCACACTGAGTTGCCAGGG - Intergenic
1188009524 X:25041486-25041508 ATGGCCACACTCAACTGCAAGGG - Intergenic
1189486058 X:41433105-41433127 ATGGCTACTCTCAACTGCAAAGG + Intergenic
1189697978 X:43685379-43685401 ATGGCTACCCTCAGCTGTCAGGG + Intronic
1189740480 X:44112626-44112648 CTGGCAACACACACATGCCTTGG + Intergenic
1191754909 X:64582481-64582503 CTGGCTGAACTCCCCTTCCAGGG + Intergenic
1192197541 X:69038530-69038552 CTGCCTCCACACAGCTGCCAAGG + Intergenic
1192935134 X:75850932-75850954 CTGCCCACACCCTCCTGCCATGG - Intergenic
1193841636 X:86414400-86414422 CTGGCCACACTCAAATGTCAAGG - Intronic
1196657838 X:118238253-118238275 CTGGCTACCCTAACCTGCTTAGG + Intergenic