ID: 1103704092

View in Genome Browser
Species Human (GRCh38)
Location 12:122862128-122862150
Sequence GCGTGGGGCTCCCTGCCTTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 215}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103704082_1103704092 14 Left 1103704082 12:122862091-122862113 CCTACGTTTGTAGTCAGCACACT 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1103704092 12:122862128-122862150 GCGTGGGGCTCCCTGCCTTCTGG 0: 1
1: 0
2: 2
3: 25
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103704092 Original CRISPR GCGTGGGGCTCCCTGCCTTC TGG Exonic
900392500 1:2439856-2439878 GCACGCGGCTCCCTGCCTGCAGG + Intronic
900786930 1:4655240-4655262 GCGCGGGGCTCCATGCCGGCCGG - Exonic
900896485 1:5486434-5486456 GCCTGGGGCTGTCTGCCTCCAGG + Intergenic
901157228 1:7148997-7149019 GAGTGGGGCTTCCTGCCCTGTGG + Intronic
901184210 1:7361902-7361924 CCCTGGGGCTGCCTTCCTTCTGG + Intronic
901494462 1:9613343-9613365 CCTTGGGGCTCCCTGGCTTCGGG - Exonic
901842705 1:11964059-11964081 GCTTGGGGATCCCTGCGTGCAGG + Intronic
905905189 1:41613107-41613129 GCTAGGGGCTCACTGCCTGCAGG + Intronic
906568789 1:46818893-46818915 AGTTGGGGCCCCCTGCCTTCAGG + Exonic
908660606 1:66431526-66431548 CAGTGGGGCTACCAGCCTTCTGG + Intergenic
910647068 1:89525209-89525231 TCGTTGTGCTCCCTGCCTTCGGG + Intronic
915244465 1:154546576-154546598 GGGTGGTGCTCCCTGCCCACTGG - Intronic
915497749 1:156293542-156293564 CTGTGGGGCTCCCTCCCATCAGG - Exonic
915914536 1:159932926-159932948 GCGTGGGGCTTCCTGCCTGCTGG + Intronic
916322766 1:163523146-163523168 GTGTGGAGTGCCCTGCCTTCAGG + Intergenic
917797636 1:178543103-178543125 GCGTGGAGCGCCCGGCCTGCAGG + Intronic
918048758 1:180956477-180956499 GAGTGGGGCCTCCTGCCTTGGGG - Intergenic
920301990 1:204994580-204994602 GCCTGGGCCTCCCTTCCTACAGG - Intronic
921857711 1:220005324-220005346 GCTAGGGGATCCCTGCCTTAAGG - Exonic
1069792228 10:71030071-71030093 GCCTGGCCCTGCCTGCCTTCAGG + Intergenic
1070289123 10:75103448-75103470 GCCTGGGTGTCCCTGCCTTTTGG - Intronic
1070702626 10:78614558-78614580 TGGCGGGGCTCCCTGCCTCCAGG + Intergenic
1072503772 10:96044021-96044043 GGCTGGGGCTCCCTGCGTCCGGG - Intronic
1073323824 10:102631161-102631183 CCCTGGGCCTCCCAGCCTTCAGG + Exonic
1075455481 10:122582214-122582236 GCATGGGCCTCTCTGCCTTCTGG - Intronic
1075457604 10:122594917-122594939 GCATGGGCCTCTCTGCCTTCTGG - Intronic
1075458677 10:122601411-122601433 GCATGGTCCTCTCTGCCTTCTGG - Intronic
1075459308 10:122605470-122605492 GCATGGTCCTCTCTGCCTTCTGG - Intronic
1075459940 10:122609529-122609551 GCATGGTCCTCTCTGCCTTCTGG - Intronic
1075460572 10:122613588-122613610 GCATGGTCCTCTCTGCCTTCTGG - Intronic
1076905179 10:133357790-133357812 GCTCGGGCCTCCCTGGCTTCCGG - Intronic
1076981552 11:207477-207499 GCTTCGGGCTCGCTGACTTCCGG + Intergenic
1077250736 11:1559547-1559569 GCCTGGGGCTCCCAGCCAGCTGG - Intronic
1077443700 11:2580511-2580533 GCGTGGGGATCCCCGTCCTCTGG - Intronic
1078170625 11:8926483-8926505 GCCTGAGCCTCCCTGCCTCCTGG + Intronic
1079136973 11:17780904-17780926 GCGGAGGGCTGCCAGCCTTCGGG + Intronic
1081736731 11:45409587-45409609 GCTTGGGGCTCCCAACCTTATGG - Intergenic
1083328383 11:61885288-61885310 GTCTGGGGCTCCCTGGCTCCTGG - Intronic
1083628769 11:64085382-64085404 GCGGCGGGCTGCCTGCCTTCCGG + Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1084219416 11:67668067-67668089 CCCTGGGCCTCCCTCCCTTCTGG + Intronic
1084221350 11:67681898-67681920 CCGGGGGGGTCACTGCCTTCTGG + Intergenic
1084334718 11:68450003-68450025 TCATGGGGCTCCTTGCCCTCAGG - Intergenic
1084568861 11:69947853-69947875 GCGTGGGTTTCCCTGCCTCTAGG - Intergenic
1084725653 11:70940085-70940107 GGGTGGGGCTGCCTTCCTTCTGG - Intronic
1087662365 11:101002477-101002499 GGGTGGGGTTGCCTTCCTTCTGG + Intergenic
1091454045 12:591987-592009 GGCTGGGGCTCCAGGCCTTCAGG - Intronic
1091673183 12:2467481-2467503 TCCTGGGGCTTCCTCCCTTCTGG - Intronic
1092065147 12:5583946-5583968 GCATGGTGCTCCGTGCCTTCAGG - Intronic
1093658595 12:21726465-21726487 GTGTGTGGCACCCTTCCTTCAGG + Intronic
1098123976 12:67270265-67270287 GCGTGGGCCTTGCTGCATTCAGG + Intronic
1102199432 12:111047153-111047175 GCGTGGCGCGCCCTGTCGTCCGG + Intronic
1102758532 12:115365338-115365360 ACGTGGGGCTGGCTGACTTCAGG - Intergenic
1103704092 12:122862128-122862150 GCGTGGGGCTCCCTGCCTTCTGG + Exonic
1104752506 12:131248607-131248629 CAGTGGGGCTCCCTGCCCTCTGG - Intergenic
1104779434 12:131410630-131410652 CAGTGGGGCTCCCTGCCCTCTGG + Intergenic
1104923066 12:132301128-132301150 GGCTGGGGCTCACTGCCTCCTGG - Intronic
1104965780 12:132508269-132508291 GCCCGGGGCTGCCTGCCTCCAGG - Exonic
1106956394 13:34942867-34942889 CCGTGGGGCTCATTGCCGTCGGG + Exonic
1107632583 13:42356969-42356991 GCCTGGGGCTCCCCACCTTGGGG + Intergenic
1109240631 13:59882887-59882909 GAGTACTGCTCCCTGCCTTCAGG - Intronic
1109996459 13:70133724-70133746 GCTTGGGGCTCCCAGCCGTTGGG + Intergenic
1111268942 13:85854461-85854483 GCTTGGAGCTCCCTGCCCTGTGG + Intergenic
1113563921 13:111306261-111306283 GCGTGTGGCTACCTGACCTCTGG - Intergenic
1113670314 13:112171457-112171479 CCAATGGGCTCCCTGCCTTCCGG + Intergenic
1113942935 13:114028044-114028066 GTGTGGCCCTCCCTGCCTTCCGG - Intronic
1115900004 14:38135192-38135214 GAGTGGTGCTCCCTGACTCCTGG - Intergenic
1117950453 14:61078223-61078245 AGGTGGGGTTCACTGCCTTCTGG + Intronic
1119327584 14:73770444-73770466 GCCTGGGCCTACCTGCCCTCTGG - Intronic
1119478649 14:74946457-74946479 AAGTGGGGCTCCCTGCCGCCCGG + Intronic
1121828851 14:97033124-97033146 GCGTGGCGCTCCCCGCCTTTGGG + Intergenic
1122143318 14:99675098-99675120 GCGGGGTGCTCCGTGTCTTCGGG - Exonic
1122410622 14:101524190-101524212 GCCTGGGGCTCCTTGCCAGCAGG - Intergenic
1122500175 14:102192457-102192479 GCGTGAGCCACCGTGCCTTCTGG + Intronic
1122506976 14:102237919-102237941 GCATGAGGCTCCCTCCTTTCCGG + Intronic
1122552494 14:102557465-102557487 GTGTGGCCCTCCCTGCCTCCCGG - Intergenic
1122721155 14:103723385-103723407 GCCAGGGGCTCCCTGCCCACGGG - Intronic
1123072236 14:105647514-105647536 GGGTGAGGCTCCGTGCGTTCAGG - Intergenic
1124962585 15:34409797-34409819 GCGTGGGGCTCTCTGGCCGCAGG - Intronic
1124979210 15:34556019-34556041 GCGTGGGGCTCTCTGGCCGCAGG - Intronic
1127264997 15:57353981-57354003 CTCTGGGGCTCCCTGCCTACAGG + Intergenic
1131258736 15:90877626-90877648 GCCTGGGCCACCCTGTCTTCAGG + Intronic
1131936527 15:97511987-97512009 GAGTGGGGCTCTCTGTTTTCTGG - Intergenic
1132516601 16:368887-368909 CAGTGGGGTTTCCTGCCTTCAGG - Intronic
1132573431 16:653929-653951 TGGTGGGGCTCCCTGCACTCTGG + Intronic
1134117987 16:11563793-11563815 GCTTTGGGCACCCTGCCTCCAGG - Intronic
1135586501 16:23675873-23675895 GTTTGGGACTCACTGCCTTCAGG + Exonic
1135592847 16:23717075-23717097 GCCTGGGTCTCCCTTCCTTGGGG - Intergenic
1136067487 16:27768710-27768732 GTGTGGTGCTACCTGGCTTCGGG - Intronic
1137620467 16:49873435-49873457 GGGTGGAGCTCACAGCCTTCTGG - Intergenic
1138564636 16:57824228-57824250 CAGTGAGGCTCCCTGCCTTGGGG + Intronic
1140606821 16:76549104-76549126 TTGTGGGGCTTCCTACCTTCTGG + Intronic
1141143481 16:81513258-81513280 GTGTGGGGCTTCCTGCCAGCAGG + Intronic
1141593959 16:85086358-85086380 GCGTGGTGCTCCGTGCCTTCAGG + Intronic
1142211196 16:88809423-88809445 TCCTGGGGCTCCCTGCCCTGGGG + Exonic
1142273985 16:89106053-89106075 GCCAGGGGGTCCCTGCCTTGGGG + Intronic
1142363473 16:89638011-89638033 GGGTGGGGCAGCCTGCCTGCTGG - Intronic
1145995905 17:29104833-29104855 GCATGGGGCTCCGTTCTTTCTGG - Intronic
1147262076 17:39214548-39214570 CCCTGGGGCTGCCTGCCTTTGGG + Intronic
1151443904 17:74150925-74150947 GCCTCGGCCTCCCAGCCTTCAGG - Intergenic
1151552109 17:74828202-74828224 GCTTGGGGCGCCCTGACCTCAGG + Intronic
1152264294 17:79285079-79285101 GAGTGGTGCTACCTGCCTTGCGG + Intronic
1152375924 17:79919031-79919053 GCATGTGGCTCCCTGGCTTCTGG + Intergenic
1152628194 17:81397786-81397808 GTTTGGGGCTCCCTTCCCTCTGG - Intronic
1152711435 17:81872058-81872080 GCCAGGAGCTCCCTGCCTCCTGG - Intergenic
1153226771 18:2906207-2906229 GCGTGCGTCTCCCGGCCCTCTGG - Intronic
1155337850 18:24783688-24783710 TTGAGGGACTCCCTGCCTTCTGG - Intergenic
1157727552 18:49976635-49976657 GAGTGAGGCCTCCTGCCTTCTGG + Intronic
1158025722 18:52894930-52894952 CCGTGGGGCACCCAGCCTTTTGG - Intronic
1158870749 18:61685427-61685449 TGGTGGGGCTGCATGCCTTCTGG + Intergenic
1159952605 18:74496274-74496296 GCGTGGCGATGCCTGCCCTCCGG + Exonic
1160461460 18:79041987-79042009 CCTTGGGTCTCACTGCCTTCAGG - Intergenic
1160578578 18:79870958-79870980 GCGTGGGGCCTCCAGCCTCCAGG - Intronic
1160607158 18:80059722-80059744 GCTTGGGGCCCCCTGGCTGCAGG + Intronic
1160983984 19:1828982-1829004 GTGTGGAGCTCCCAGCATTCAGG + Intronic
1161051121 19:2164443-2164465 GCGCGGGGCTCCCACCCTGCGGG - Intronic
1161067883 19:2247519-2247541 GCCTCGGGCTCCCTGCCTGATGG + Intronic
1161159650 19:2754870-2754892 TCCTGGGGCTCCCTGGCTCCTGG - Exonic
1161852641 19:6745668-6745690 ACATGGGCCTCCCTGCCTCCTGG + Intronic
1162391134 19:10390880-10390902 GCTTGGGCCACCCTGCATTCTGG + Intergenic
1163328873 19:16623232-16623254 GCGTGGTGTTCTCTGACTTCGGG - Intronic
1163442356 19:17328458-17328480 TAGTGGGGCTCCCTTCCTCCAGG + Exonic
1163833178 19:19557508-19557530 GCGGGGGGCTCCCAGCCTGAAGG - Intergenic
1164595423 19:29528385-29528407 ACGTGAGGCTCGCGGCCTTCTGG - Intronic
1164989670 19:32674951-32674973 GGGAGGGGCTCCCTGCTCTCCGG - Intronic
1167693058 19:50999115-50999137 GCGAGGGGCTCTCTGGATTCTGG + Intronic
926137078 2:10343912-10343934 GCTTGGGCCTCCATGCCTCCTGG + Intronic
926138364 2:10353427-10353449 TCGTGGGGGGCCCTGCCTGCAGG + Intronic
928084400 2:28336816-28336838 GCGTGGGGCTCTTTGCCCTATGG + Intronic
931232789 2:60388638-60388660 GCCTGGGGCTGCCTGCCTCATGG + Intergenic
931233351 2:60392619-60392641 GCCTGGGGCTGCCTGCCTCGTGG + Intergenic
933704247 2:85277933-85277955 GCGGGGCCCTCCCTACCTTCTGG + Intronic
934519672 2:95012102-95012124 TAGAGGGGCTCCCTACCTTCAGG + Intergenic
934921360 2:98347348-98347370 GCGCCGGGCTCCCAGCCGTCAGG + Intronic
935615378 2:105074679-105074701 GCCTGGGCCTCCCTACATTCTGG - Intronic
936462882 2:112725010-112725032 GCCTCGGGTTCCCTGCCTCCAGG - Intronic
937304049 2:120860364-120860386 GGGTGGGGCTCACTGTCCTCAGG + Intronic
938223872 2:129598291-129598313 ACGTGAGCCTCCCTGCCTTCAGG - Intergenic
938444610 2:131367246-131367268 CCCTGGGGCTCCCAGGCTTCGGG - Intergenic
939730359 2:145777121-145777143 GCGTGGAGCACTCTGCCTACAGG + Intergenic
942447557 2:176088179-176088201 GCCTCGGGCTCCCTGTCTTCAGG + Intergenic
947384631 2:229578654-229578676 CAGTGGTGCCCCCTGCCTTCAGG + Intronic
947813961 2:233023614-233023636 GCGTGGGGCTTGCTACCTCCAGG + Intergenic
948281537 2:236751044-236751066 GCGAGGGCCTGCCTGCTTTCCGG + Intergenic
949021020 2:241741525-241741547 GTGTGGGGCTTGCTGCCTCCAGG + Intronic
949021067 2:241741797-241741819 GTGTGGGGCTTGCTGCCTCCAGG + Intronic
1171011408 20:21511154-21511176 GCAGAGGGCTCCCTGCCTACAGG + Exonic
1172386012 20:34534698-34534720 GCACGGTGCTCCGTGCCTTCAGG - Exonic
1173923275 20:46761837-46761859 GGCTGGGGGTCCTTGCCTTCGGG - Intergenic
1174303788 20:49600860-49600882 GCCTGGGTCTTCCTGTCTTCTGG + Intergenic
1174914822 20:54643583-54643605 GCGTGGGGCTACCTGTGTCCAGG + Intronic
1175820052 20:61904266-61904288 TCGTGGGGCTCCCAGTCCTCTGG + Intronic
1175978397 20:62725130-62725152 GGATGGGGCTCCCTGGCTCCTGG + Intronic
1176083204 20:63284310-63284332 CCGTGCTGCTCCCTGCCTTTGGG + Intronic
1178599901 21:33986237-33986259 TTCTGGGGCTCCCTGCCTTCTGG + Intergenic
1179719365 21:43306602-43306624 GCTTGGGGCTCCCTGGCTTGTGG - Intergenic
1180007351 21:45028848-45028870 GCCTGGGGCTCCTTGGCTTGTGG + Intergenic
1181477816 22:23179783-23179805 GCCTGGCCCTCCCTGCCTTGCGG + Intronic
1181594046 22:23902909-23902931 GCTGTGTGCTCCCTGCCTTCTGG + Intergenic
1182290623 22:29276329-29276351 GCTTGGGGCTTCCTGTTTTCTGG + Intronic
1182604947 22:31496108-31496130 GCGTGGGCCTCTCTGGCTTTTGG - Intronic
1182910336 22:33978942-33978964 CCATGGGGGTCACTGCCTTCTGG - Intergenic
1183781462 22:40001831-40001853 GGGTGGGGCTCCCTAACTTCTGG - Intronic
1184272418 22:43392411-43392433 GCATGGGGCTCCCTGGGATCTGG + Intergenic
1185340612 22:50289277-50289299 CGGTGGGGCTCCCTGCCATGTGG - Intronic
949504571 3:4714820-4714842 GTTTGGGTCTCCCTGCCTTGGGG + Intronic
950196846 3:11015444-11015466 GAGTGGGGCCCGCTGCCCTCGGG - Intronic
955370235 3:58344902-58344924 GCTGGGGGCTGCCTCCCTTCAGG - Intronic
956622503 3:71235484-71235506 GTGGTGGGCTCCCTGACTTCAGG - Intronic
956783790 3:72625395-72625417 GCCTGGGGCCTCCTGCATTCAGG + Intergenic
959674475 3:109019215-109019237 GCGTTAGGATCCCTGCCTTCAGG - Intronic
961305810 3:125958736-125958758 GCCGGGGGCTGCCTGCCTCCAGG - Intergenic
961332985 3:126153893-126153915 GAATGAGGCTACCTGCCTTCAGG + Intronic
961935115 3:130574764-130574786 GAGTGGGAATGCCTGCCTTCAGG + Intronic
962411469 3:135144716-135144738 GCCTGTGACTCCCTGCCTTGGGG + Intronic
962677740 3:137769014-137769036 GTCTGGGGCTCCCTGGCTACCGG - Intergenic
965020467 3:163222181-163222203 GCAAGAGGCTCCCTGACTTCAGG + Intergenic
969284892 4:6196979-6197001 AAGTGGGGCTCCCTGACTCCGGG - Intronic
975661435 4:76692350-76692372 GCGATGGGTTCCCTGCCCTCAGG + Intronic
975821880 4:78279140-78279162 TCATGCGGCTCCCTCCCTTCAGG - Intronic
979495811 4:121380992-121381014 GCCTCTGGCTCCCCGCCTTCTGG + Exonic
985599593 5:819861-819883 GGGTGGGGCTCGCAGACTTCAGG - Intronic
990659367 5:57995904-57995926 GAGGAGGGCTCCCTGACTTCAGG + Intergenic
997844896 5:137277519-137277541 GCATGGGGCTGCCTGCCCTGTGG + Intronic
1001573053 5:172743419-172743441 CCGTGGTGCACCCAGCCTTCTGG - Intergenic
1002273213 5:178086486-178086508 GCGCGGAGCTGGCTGCCTTCAGG - Intergenic
1002417039 5:179126130-179126152 CCGTCGAGCTCTCTGCCTTCAGG - Exonic
1002432810 5:179212972-179212994 GCAGCGGGCTCCCTTCCTTCTGG - Intronic
1002643239 5:180640471-180640493 ACGTGGGCCTTCCTGCCTGCAGG - Intronic
1006919738 6:37619515-37619537 GACTGGGGCTCCCTGCATTAAGG - Intergenic
1007721330 6:43887122-43887144 CCCTGGGCCTCCCTGCCCTCTGG + Intergenic
1007963834 6:45985610-45985632 TCAAGGGGCTCCCTGCCCTCTGG + Intronic
1010952789 6:82057003-82057025 GCCTGTGGCTCCCTTCTTTCTGG + Intergenic
1013604936 6:111738892-111738914 GGGAGGGGCTTTCTGCCTTCTGG + Intronic
1014270022 6:119326206-119326228 GGGTGGCTCTCCCTGCCTTCAGG + Intronic
1015629052 6:135212906-135212928 GCATGGGGCTCCCAGGCTTCAGG + Intronic
1017801538 6:157900518-157900540 CCGGGGGGGTCACTGCCTTCTGG + Intronic
1018706839 6:166469687-166469709 CCTGGGGGCTCCCTGCCTGCAGG + Intronic
1019322731 7:422953-422975 GCCTGGGGCGCCCGGCCCTCTGG - Intergenic
1020071258 7:5228389-5228411 GCCCGGGGCTCCCTGTCTTGCGG - Intronic
1020279607 7:6643552-6643574 GGGCGGGGCTCCCTGTCTCCTGG + Intronic
1022090331 7:27103798-27103820 GCGTGCGGCTCCTGGCATTCTGG + Intergenic
1022111613 7:27235738-27235760 GCCAGCGGCTCCCTGGCTTCTGG + Intergenic
1029111440 7:98214772-98214794 GCCTGGGGGTCACCGCCTTCAGG + Exonic
1029450690 7:100640608-100640630 GACTGGGCCTCCCTGCCTCCTGG - Intronic
1032489159 7:132310997-132311019 GAGTGGTGCTGCCTGACTTCTGG + Intronic
1033449892 7:141453236-141453258 GGCAGGGGCTCCCTGCCTTGTGG + Intronic
1033662156 7:143409419-143409441 CCTTGAGGCTCCCTGCCTTCAGG - Intergenic
1034900630 7:154906032-154906054 GCGGGGGGCTCCCTGGATTGTGG + Intergenic
1034997571 7:155587720-155587742 CCGTGGCGCTCCCTGGCTTGTGG + Intergenic
1035122659 7:156581204-156581226 GCCTGAGGCTTTCTGCCTTCTGG - Intergenic
1035305074 7:157926900-157926922 CCCTGGGGCTTCCTGTCTTCAGG - Intronic
1035305117 7:157927080-157927102 CCCTGGGGCTTCCTGTCTTCGGG - Intronic
1035305132 7:157927140-157927162 CCCTGGGGCTTCCTGTCTTCGGG - Intronic
1035305190 7:157927379-157927401 CCCTGGGGCTTCCTGTCTTCAGG - Intronic
1035305218 7:157927498-157927520 CCCTGGGGCTTCCTGTCTTCGGG - Intronic
1035305247 7:157927617-157927639 CCCTGGGGCTTCCTGTCTTCGGG - Intronic
1035909891 8:3554853-3554875 GCAGGGGGCTCCCTGCCTGCTGG - Intronic
1048303350 8:133267087-133267109 GCCTGGGGCTGGCTGGCTTCGGG - Intronic
1049253517 8:141601939-141601961 GGCTGCTGCTCCCTGCCTTCGGG + Intergenic
1049483717 8:142840394-142840416 GTATGGGGCTCCTTCCCTTCAGG + Exonic
1049693934 8:143974579-143974601 GCAGGGGCCTCCCTGCCCTCCGG + Intronic
1049771532 8:144384455-144384477 ACGTGGGTCTCCCTGGCATCTGG + Intronic
1049788670 8:144463067-144463089 GCGTGGGCCTCCCTGCCCCCAGG - Intronic
1052326184 9:27218691-27218713 GGGTGGGTCTCCCTGGCTTTTGG + Intronic
1057744696 9:97741630-97741652 GCGGGTGGCTCCGGGCCTTCAGG + Intergenic
1057792958 9:98136004-98136026 GGGTGTTCCTCCCTGCCTTCAGG - Intronic
1059832771 9:118116956-118116978 CCGGGGGGGTCACTGCCTTCTGG + Intergenic
1060943941 9:127558922-127558944 GATTGGTGCTCCCTGCCTTTGGG - Intronic
1061715961 9:132519091-132519113 GGGGGTGGCTCCCTGCCCTCTGG - Intronic
1062052854 9:134456391-134456413 GCGTGCAGCTTCCTGCCTGCAGG - Intergenic
1062250233 9:135590154-135590176 GAGTGGGGGTCCCTGCTTGCAGG - Intergenic
1062374155 9:136254465-136254487 TCGGGGAGCTCCCTGCCTGCAGG - Intergenic
1062735374 9:138134535-138134557 CCGTGGGGCCCAGTGCCTTCTGG + Intergenic
1190058020 X:47193405-47193427 GCCTGGGTCTCCTTGGCTTCCGG + Intronic
1191269479 X:58444980-58445002 CCATGGGGGTCTCTGCCTTCTGG + Intergenic
1192129986 X:68540740-68540762 GGATGGAGCTCACTGCCTTCAGG - Intergenic
1192586976 X:72326832-72326854 TCCTGGGGTTCCCTGGCTTCAGG - Intergenic
1194977622 X:100409880-100409902 GCGTTGGGCTCCCTTCCTCCCGG + Exonic
1197709221 X:129654117-129654139 GCGGGAGGCTCCCAGCCTTCAGG + Intronic
1198310920 X:135425300-135425322 GGGTGGGGCTCCCTGCAGTGGGG - Intergenic
1199874947 X:151921835-151921857 GGGGTGGGCTCCCTGCCTTGGGG - Intronic
1200120002 X:153785739-153785761 GCGTGGGCCTCCCTCACTCCAGG - Intergenic