ID: 1103704110

View in Genome Browser
Species Human (GRCh38)
Location 12:122862194-122862216
Sequence CGGCTGATGGGACGAGGGTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103704096_1103704110 28 Left 1103704096 12:122862143-122862165 CCTTCTGGACTCCTGAAGGTCGT 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1103704110 12:122862194-122862216 CGGCTGATGGGACGAGGGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 118
1103704100_1103704110 17 Left 1103704100 12:122862154-122862176 CCTGAAGGTCGTGGATGGATGGA 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1103704110 12:122862194-122862216 CGGCTGATGGGACGAGGGTCAGG 0: 1
1: 0
2: 0
3: 5
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103704110 Original CRISPR CGGCTGATGGGACGAGGGTC AGG Exonic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900436413 1:2633255-2633277 GGGCTGCTGGGAGGAAGGTCAGG + Intergenic
900436966 1:2635386-2635408 AGGCAGGTGGGACGGGGGTCAGG + Intergenic
900437058 1:2635770-2635792 CGGCTGCTGGGACGACAGCCGGG + Intergenic
901606493 1:10463307-10463329 CGGCTGCTGGGATGCGGGACGGG - Intronic
903247946 1:22030177-22030199 AGGCTGATGGAACCTGGGTCTGG + Intergenic
904311581 1:29632776-29632798 GGGCTGAGGGGAAGAGGGGCTGG - Intergenic
905453738 1:38073637-38073659 GGGCTGATGAGACGAGGGGAGGG + Intergenic
906108575 1:43308809-43308831 CAGCTGATGGGATGTGGGGCTGG + Intronic
906344362 1:45005960-45005982 GGGCTGATCGGACGGGGGTGTGG + Intronic
907828422 1:58040406-58040428 CGGCAGATGAGACCAGGGTTGGG - Intronic
908544304 1:65148558-65148580 GGGCTGCGGGGACGAGGGCCGGG + Intronic
914001706 1:143699916-143699938 CGGCTGAGTGGCGGAGGGTCGGG - Intergenic
915161363 1:153922829-153922851 CTGCTGACGGGACTAGGGACGGG + Exonic
918449124 1:184642017-184642039 CTGCTTATGGGAGGAGGGACTGG - Intergenic
922527949 1:226320645-226320667 GGGCTGATGGGAATAGGGGCAGG + Intergenic
922816516 1:228453072-228453094 TGGCTGCTGGGTCCAGGGTCTGG + Intergenic
922950970 1:229558421-229558443 CGGCTGCCGGGGCGGGGGTCCGG - Exonic
1065545084 10:26810742-26810764 CGTCTGATGGCATGAAGGTCTGG + Intronic
1067275275 10:44828345-44828367 TGGCGGCTGGGAAGAGGGTCGGG + Intergenic
1068482127 10:57605030-57605052 AGACTGGTGGGACGAGGGTCAGG + Intergenic
1069687011 10:70324798-70324820 GGGCTGATGGGAGGAGGAACTGG + Intronic
1069921547 10:71818692-71818714 GGGCTTATGGGCCGAGGGGCAGG + Exonic
1070718362 10:78739047-78739069 GGGGAGATGGGACCAGGGTCTGG + Intergenic
1073290703 10:102411953-102411975 GGGGTGATGGGTGGAGGGTCAGG - Intronic
1080581316 11:33646158-33646180 GGGATGATGGGATGAGGGCCTGG - Intronic
1084978187 11:72814593-72814615 CGGCTGAGGGGACGCGGCTACGG + Intronic
1087634452 11:100687165-100687187 CGGCGGCGGGGAGGAGGGTCTGG + Intergenic
1088595003 11:111434909-111434931 TGGCTGATGGAATAAGGGTCAGG - Intronic
1091002692 11:131923837-131923859 CTGGGGATGGGAGGAGGGTCGGG - Intronic
1092449690 12:8590444-8590466 TGGCTTATGGGACCAGGGACAGG + Intergenic
1096835861 12:54350909-54350931 GGGCTGTTGGGATGAGGGCCAGG - Exonic
1097651491 12:62303596-62303618 CGGGGGATGGGGGGAGGGTCGGG - Intronic
1099347472 12:81520701-81520723 CAGCTGAGAGGAAGAGGGTCAGG + Intronic
1102427121 12:112852629-112852651 CTGCTGATAGGATGAGGGGCAGG - Intronic
1102474802 12:113181684-113181706 CGGCTGATGGGGCGGGGGTAGGG - Intronic
1103704110 12:122862194-122862216 CGGCTGATGGGACGAGGGTCAGG + Exonic
1104975053 12:132548563-132548585 AGGCTGAGGGGACGTGGCTCAGG - Intronic
1105558357 13:21466689-21466711 CGGCTGGTGGAAAGAGGGTGTGG - Intergenic
1110339302 13:74370308-74370330 AGGCTGAAGGGCCGAGGGGCTGG - Intergenic
1112458140 13:99580319-99580341 CAGCTGATTGGACCAGGGGCTGG - Intergenic
1114184614 14:20391094-20391116 GGGCTGATTGGACAAGTGTCAGG + Exonic
1114594840 14:23902824-23902846 CGGAGGATGGGAAGAGGGTGAGG - Intergenic
1119694180 14:76699494-76699516 CGGCTTGTGGAACAAGGGTCAGG - Intergenic
1121026485 14:90620168-90620190 GGAATGATGGGACGAGGGCCAGG + Intronic
1121448747 14:93994748-93994770 CGTGGGAAGGGACGAGGGTCTGG + Intergenic
1129137796 15:73569875-73569897 AGGCAGATGGGACTAGGGTTTGG + Intronic
1131828694 15:96340980-96341002 CGGCTGCAGGGACGGGGGCCTGG + Intergenic
1132641884 16:981798-981820 CGGCGGCAGGGGCGAGGGTCGGG + Exonic
1136554096 16:30997614-30997636 GGGCACATGGGGCGAGGGTCCGG + Intronic
1140829077 16:78734737-78734759 CAGCTGATGAGACGAAGCTCAGG - Intronic
1142395327 16:89828501-89828523 CGGCTGCATGGACGCGGGTCCGG + Exonic
1143776837 17:9205193-9205215 TGGCTGGTGGGAGGAGGGGCAGG + Intronic
1145305843 17:21674673-21674695 CGGCTGAGGGGACTGGGGACTGG + Intergenic
1146839604 17:36141443-36141465 TGGCTGATGGAACGATGGTTAGG + Intergenic
1147168304 17:38604817-38604839 CGGCTGAGGGGTGGAGGGTGGGG - Intronic
1151674182 17:75589362-75589384 CGAGCGAGGGGACGAGGGTCGGG + Intergenic
1151929018 17:77219140-77219162 AGGCTGTTGGGAAGAGGATCGGG + Intergenic
1152566927 17:81104494-81104516 CGGCTGCTGGGACAAGGGACAGG - Exonic
1153991682 18:10406137-10406159 CAGCTGATGGGATGAGAGGCAGG - Intergenic
1157661878 18:49452699-49452721 CGGTTGATGGGACCAGGCGCTGG - Intronic
1161125019 19:2550919-2550941 CGGCTGCTGGGAACAGGGCCAGG + Intronic
1163172268 19:15540551-15540573 CGGCGGATGGGCGGAGGTTCCGG + Exonic
1164836561 19:31358704-31358726 TGGCTGAAGAGAAGAGGGTCTGG + Intergenic
1166774356 19:45303296-45303318 GGGCTGACAGGAGGAGGGTCGGG - Exonic
1167674023 19:50873594-50873616 GGGCTGAAGGGACGAGGCTGGGG - Intronic
1167847407 19:52175997-52176019 TGGATGGTGGGAGGAGGGTCAGG - Intergenic
926624521 2:15080067-15080089 TGGCTCATGGGATGAGGGTGGGG - Intergenic
927428615 2:23007998-23008020 GGGCTGAAGGGGAGAGGGTCAGG + Intergenic
927940918 2:27102327-27102349 GGGCTGATGGGGCCAGGGACGGG - Intronic
928418749 2:31121056-31121078 CTGCTGATGTGACCAGGGCCTGG - Intronic
935709838 2:105888620-105888642 ATGCTGAAGGGAAGAGGGTCAGG - Intronic
935872789 2:107469436-107469458 CGGTTGATGGGACTTGGGACCGG + Intergenic
943470763 2:188291902-188291924 CGGCAGCTGGGACGCGGGGCTGG - Intronic
945768023 2:214004214-214004236 CTGCAGAAGGGAAGAGGGTCTGG + Intronic
946377803 2:219324211-219324233 GGGGTGATGTTACGAGGGTCAGG + Intergenic
947596058 2:231412423-231412445 CGGCTGCAGGGCCGCGGGTCGGG + Intergenic
948854779 2:240725004-240725026 CAGCGGATGGGAGGAGGGGCAGG - Intronic
1169113085 20:3045815-3045837 GGGCTGGAGGGACGCGGGTCCGG + Intergenic
1178212098 21:30547424-30547446 TGGGTGATGGGAGGAGGGTAAGG - Intronic
1179438380 21:41377339-41377361 GGGCTGCTGCGACGTGGGTCTGG + Intronic
953409972 3:42685377-42685399 GGGCTTATGGGACGGGGGTGGGG - Intergenic
956132590 3:66068448-66068470 AGGCTGATGGGAAGAGGGTAGGG + Intergenic
961028906 3:123585094-123585116 CGGAGGAAGGGACGAGGGGCAGG + Exonic
962279257 3:134037867-134037889 CAGCTCATGGGAAGAGGCTCAGG + Intronic
964720372 3:159763812-159763834 CGGCGGGTGGGAGGAGGGGCCGG + Intronic
965681781 3:171259327-171259349 CGGCTGATGGGATAAGACTCAGG + Intronic
971689401 4:29813468-29813490 CAGCTGATGGGATGGGGGCCAGG - Intergenic
978314697 4:107422692-107422714 GGGGTGATGGGAGGAGGGTAAGG + Intergenic
984396451 4:179207652-179207674 TGGATGATGGGAGGAGGGTAAGG - Intergenic
985747469 5:1655302-1655324 CGGCTGAGGGGACCAGGGCCTGG - Intergenic
991457938 5:66824291-66824313 TGACTGGTGGGACGAGGGGCAGG + Intronic
997584400 5:135035800-135035822 GGGCTGCTGGGGCCAGGGTCGGG + Intronic
1000329944 5:160198378-160198400 CGGCTGATGGGGCGAGTGGGAGG - Intronic
1002850759 6:994907-994929 CGGCAGATGGGCAGAGGGACAGG + Intergenic
1005117666 6:22356416-22356438 CGGTTGATGGGACCAGGGCGTGG + Intergenic
1006136162 6:31897470-31897492 CGGATGAGGGGACCAGGGTGTGG - Intronic
1006164612 6:32057075-32057097 GGGCTGAGGGCAGGAGGGTCAGG - Intronic
1006276230 6:33007374-33007396 CGGCTGAGGGCACGAAGGGCAGG + Exonic
1010882148 6:81190742-81190764 GGGATGATGGGAGGAGGGTGAGG + Intergenic
1013779048 6:113710305-113710327 GGGCTGAAAGGGCGAGGGTCAGG + Intergenic
1019127130 6:169848217-169848239 CAGGTGATGGGCAGAGGGTCAGG - Intergenic
1020136552 7:5591399-5591421 GGGCTGATGGGAGGGGGTTCTGG + Intergenic
1022567245 7:31415833-31415855 CTGCTCATGGGAAGAGGGGCTGG - Intergenic
1023630276 7:42156814-42156836 CTGGTGATGGGAGGAGGGTGTGG - Intronic
1025200071 7:56956607-56956629 GGGCTGATGGGACCACGGGCTGG - Intergenic
1026307785 7:69156907-69156929 GGGCTGAGGGTAAGAGGGTCAGG - Intergenic
1027258249 7:76444982-76445004 TGGCAGATGGGACTAGGGCCTGG - Intergenic
1027280599 7:76607036-76607058 TGGCAGATGGGACTAGGGCCTGG + Intergenic
1029695714 7:102211911-102211933 CGGCTGATGAGATGAGGCTGGGG + Intronic
1036142059 8:6217770-6217792 GGGCTGCTGGGATGTGGGTCTGG - Intergenic
1036710647 8:11076446-11076468 CTGCTGATGGGGTAAGGGTCAGG - Intronic
1037699486 8:21261952-21261974 GGGCAGATGGGAGGAGGGCCAGG - Intergenic
1039137128 8:34337862-34337884 TGGAGGATGGGAGGAGGGTCAGG + Intergenic
1042137362 8:65644978-65645000 CGGCTGAGGGCGCGTGGGTCGGG + Intronic
1049519481 8:143080689-143080711 CGGGGGCTGGGATGAGGGTCGGG + Intronic
1058347412 9:103980433-103980455 GTGCTGATGGCATGAGGGTCTGG + Intergenic
1060748355 9:126152530-126152552 TGGTTCATGGGACGAGGATCAGG + Intergenic
1061654644 9:132079611-132079633 CGGCTGAAGGGGCCGGGGTCGGG - Intronic
1061821011 9:133227162-133227184 CAGCTGGTGGGATGAGGCTCAGG - Intergenic
1061828949 9:133278352-133278374 GAGCTGATGGGACGAGGGGTCGG - Intergenic
1185791163 X:2928999-2929021 CGACTGAGGGGACGAAGGGCGGG - Intronic
1187102222 X:16205406-16205428 CTGATGCTGGGACCAGGGTCTGG - Intergenic
1190209175 X:48430874-48430896 TGGAAGATGGGACGAGGGACAGG - Intergenic